Научная статья на тему 'Влияние рутина и гесперидина на экспрессию Nrf2- и AhR-регулируемых генов и гена CYP3A1 у крыс при остром токсическом действии четыреххлористого углерода'

Влияние рутина и гесперидина на экспрессию Nrf2- и AhR-регулируемых генов и гена CYP3A1 у крыс при остром токсическом действии четыреххлористого углерода Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
244
29
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Вопросы питания
Scopus
ВАК
PubMed
Ключевые слова
РУТИН / RUTIN / ГЕСПЕРИДИН / HESPERIDIN / CCL4 / NRF2 / AHR / ЭКСПРЕССИЯ ГЕНОВ / GENE EXPRESSION / ФЕРМЕНТЫ МЕТАБОЛИЗМА КСЕНОБИОТИКОВ / XENOBIOTIC-METABOLIZING ENZYMES / ФЕРМЕНТЫ АНТИОКСИДАНТНОЙ ЗАЩИТЫ / ANTIOXIDANT ENZYMES

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Балакина Анастасия Станиславовна, Трусов Никита Вячеславович, Аксенов Илья Владимирович, Гусева Галина Владимировна, Кравченко Лидия Васильевна

Целью настоящей работы стало изучение влияния рутина (Р) и гесперидина (Гес), основных представителей двух наиболее изученных подклассов флавоноидов флавонолов и флаванонов, на экспрессию прототипичных Nrf2и AhR-контролируемых генов, а также гена CYP3A1 в печени крыс в условиях токсического действия четыреххлористого углерода (CCl4). Исследования проводили на 5 группах крыс-самцов линии Вистар с исходной массой тела 180-200 г (n=40). Крысы контрольной и 1-й опытной групп в течение 14 дней получали полусинтетический рацион, крысы 2-й опытной группы тот же рацион с включением Р в количестве 400 мг на 1 кг массы тела, животные 3-й опытной группы рацион с включением Гес в том же количестве, а 4-й опытной группы рацион, содержащий Р и Гес в количестве по 400 мг на 1 кг массы тела. Животным опытных групп за 24 ч до окончания эксперимента вводили внутрибрюшинно однократно CCl4 в дозе 0,5 мл на 1 кг массы тела в оливковом масле, крысам контрольной группы вводили равное количество оливкового масла. Для оценки экспрессии генов определяли содержание матричной РНК NAD(P)H-хиноноксидоредуктазы (NQO1), гемоксигеназы-1 (Hmox1), Nrf2 (Nrf2), AhR (AhR), CYP1A1, CYP1A2, CYP3A1 и ß-актина (Actb) в печени крыс методом полимеразной цепной реакции с обратной транскрипцией в режиме реального времени. Полученные результаты показали, что при остром токсическом действии CCl4 обогащение рациона крыс Р, но не Гес приводило к достоверному возрастанию экспрессии генов Hmox1, NQO1 и CYP3A1. При совместном поступлении Р и Гес с рационом отмечались аддитивность их действия на экспрессию гена Hmox1 и синергизм в действии на экспрессию генов NQO1 и CYP3A1. При этом выявлено умеренное усиление экспрессии генов AhR и CYP1A2 относительно уровня их экспрессии у крыс, получавших только CCl4, CCl4и Р или CCl4 и Гес. Таким образом, впервые на модели окислительного стресса у крыс получены данные, демонстрирующие синергизм действия на уровне экспрессии генов двух флавоноидов Р и Гес, широко представленных в ежедневном рационе человека.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Балакина Анастасия Станиславовна, Трусов Никита Вячеславович, Аксенов Илья Владимирович, Гусева Галина Владимировна, Кравченко Лидия Васильевна

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

The effect of rutin and hesperidin on the expression of Nrf2-and AhR-regulated genes and CYP3A1 gene in rats intoxicated with carbon tetrachloride

The purpose of the study was to determine the effects of rutin (R) and hesperidin (Hes), the main representatives of two most studied subclasses of flavonoids flavonols and flavanones, on the expression of prototypical Nrf2 and AhR-regulated genes and CYP3A1 gene in rats intoxicated with carbon tetrachloride (CCl4). Investigations were carried out on 5 groups of male Wistar rats with the initial body weight (b.w.) 180-200 g (n=40). Rats of the control group and the 1st experimental group received for 14 days the semisynthetic diet, rats of the 2nd experimental group the same diet plus R (400 mg/kg b.w.), the animals of the 3rd experimental group received the diet with Hes in the same amount, of the 4th experimental group diet with R (400 mg/kg b.w.) and Hes (400 mg/kg b.w.). Animals of the experimental groups 24 hours before the end of experiment were injected intraperitoneally CCl4 at a dose of 0.5 ml/kg b.w. in olive oil; rats of the control group were injected equal amount of olive oil. For gene expression assessment the mRNA content of NAD(P)H-quinone oxidoreductase (NQO1), heme oxygenase-1 (Hmoxl), Nrf2 (Nrf2), AhR (AhR), CYP1A1, CYP1A2, CYP3A1 and ß-actin (Actb) in rat liver was determined by real-time RT-PCR. The results showed that in rats intoxicated with CCl4, enrichment of the diet with R, but not with Hes, led to a significant increase in the expression of genes Hmox1, NQO1 and CYP3A1. Combined intake of R and Hes with the diet led to additivity of their action on the expression of Hmox1 gene and to synergism in the effect on the expression of genes NQO1 and CYP3A1. A moderate increase in the levels of expression of AhR and CYP1A2 genes as compared to their expression in rats treated with CCl4 only, CCl4 and R or CCl4 and Hes has been noted. Thus, for the first time on the model of oxidative stress in rats the data have been obtained showing at the gene expression level a synergism of action of two flavonoids R and Hes, widely present in the daily human diet.

Текст научной работы на тему «Влияние рутина и гесперидина на экспрессию Nrf2- и AhR-регулируемых генов и гена CYP3A1 у крыс при остром токсическом действии четыреххлористого углерода»

Для корреспонденции

Балакина Анастасия Станиславовна - аспирант ФГБУН «ФИЦ питания и биотехнологии» Адрес: 109240, г. Москва, Устьинский проезд, д. 2/14 Телефон: (495) 698-53-65 Е-таИ: balakina.a.s@yandex.ru

А.С. Балакина, Н.В. Трусов, И.В. Аксенов, Г.В. Гусева, Л.В. Кравченко, В.А. Тутельян

Влияние рутина и гесперидина на экспрессию Nrf2-и AhR-регулируемых генов и гена CYP3A1 у крыс при остром токсическом действии четыреххлористого углерода

ФГБУН «ФИЦ питания и биотехнологии», Москва Federal Research Centre of Nutrition, Biotechnology and Food Safety, Moscow

Целью настоящей работы стало изучение влияния рутина (Р) и гесперидина (Гес), основных представителей двух наиболее изученных подклассов флавоно-идов - флавонолов и флаванонов, на экспрессию прототипичных Ыт/2- и ЛНК-контролируемых генов, а также гена СУР3Л1 в печени крыс в условиях токсического действия четыреххлористого углерода (СС14). Исследования проводили на 5 группах крыс-самцов линии Вистар с исходной массой тела 180-200 г (п=40). Крысы контрольной и 1-й опытной групп в течение 14 дней получали полусинтетический рацион, крысы 2-й опытной группы - тот же рацион с включением Р в количестве 400 мг на 1 кг массы тела, животные 3-й опытной группы - рацион с включением Гес в том же количестве, а 4-й опытной группы - рацион, содержащий Р и Гес в количестве по 400 мг на 1 кг массы тела. Животным опытных групп за 24 ч до окончания эксперимента вводили внутрибрюшинно однократно СС14 в дозе 0,5 мл на 1 кг массы тела в оливковом масле, крысам контрольной группы вводили равное количество оливкового масла. Для оценки экспрессии генов определяли содержание матричной РНК NЛD(P)H-хиноноксидоредуктазы (N^01), гемоксигеназы-1 (Нтох1), Ыт/2 (Ш/2), ЛНК (ЛНК), СУР1Л1, СУР1Л2, СУР3Л1 и /З-актина (Лей) в печени крыс методом полимеразной цепной реакции с обратной транскрипцией в режиме реального времени. Полученные результаты показали, что при остром токсическом действии СС14 обогащение рациона крыс Р, но не Гес приводило к достоверному возрастанию экспрессии генов Нтох1, NQ01 и СУР3Л1. При совместном поступлении Р и Гес с рационом отмечались аддитивность их действия на экспрессию гена Нтох1 и синергизм - в действии на экспрессию генов NQ01 и СУР3Л1. При этом выявлено умеренное усиление экспрессии геновЛНК и СУР1Л2 относительно уровня их экспрессии у крыс, получавших только СС14, СС14и Р или СС14 и Гес. Таким образом, впервые на модели окислительного стресса у крыс получены данные, демонстрирующие синергизм действия на уровне экспрессии генов двух флавоноидов - Р и Гес, широко представленных в ежедневном рационе человека.

Ключевые слова:рутин, гесперидин, СС14, Ш/2, ЛНК, экспрессия генов, ферменты метаболизма ксенобиотиков, ферменты антиокси-дантной защиты

The effect of rutin and hesperidin on the expression of Nrf2- and AhR-regulated genes and CYP3A1 gene in rats intoxicated with carbon tetrachloride

A.S. Balakina, N.V. Trusov, I.V. Aksenov, G.V. Guseva, L.V. Kravchenko, V.A. Tutelyan

The purpose of the study was to determine the effects of rutin (R) and hesperidin (Hes), the main representatives of two most studied subclasses of flavonoids - flavonols and flavanones, on the expression of prototypical Nrf2 andAhR-regulatedgenes and CYP3A1 gene in rats intoxicated with carbon tetrachloride (CCl4). Investigations were carried out on 5 groups of male Wistar rats with the initial body weight (b.w.) 180-200 g (n=40). Rats of the control group and the 1st experimental group received for 14 days the semisynthetic diet, rats of the 2nd experimental group - the same diet plus R (400 mg/kg b.w.), the animals of the 3rd experimental group received the diet with Hes in the same amount, of the 4th experimental group - diet with R (400 mg/kg b.w.) and Hes (400 mg/kg b.w.). Animals of the experimental groups 24 hours before the end of experiment were injected intraperitoneally CCl4 at a dose of 0.5 ml/kg b.w. in olive oil; rats of the control group were injected equal amount of olive oil. For gene expression assessment the mRNA content of NAD(P)H-quinone oxidoreductase (NQO1), heme oxygenase-1 (Hmox1), Nrf2 (Nrf2), AhR (AhR), CYP1A1, CYP1A2, CYP3A1 and fi-actin (Actb) in rat liver was determined by real-time RT-PCR. The results showed that in rats intoxicated with CCl4, enrichment of the diet with R, but not with Hes, led to a significant increase in the expression of genes Hmox1, NQO1 and CYP3A1. Combined intake of R and Hes with the diet led to additivity of their action on the expression of Hmox1 gene and to synergism in the effect on the expression of genes NQO1 and CYP3A1. A moderate increase in the levels of expression of AhR and CYP1A2 genes as compared to their expression in rats treated with CCl4 only, CCl4 and R or CCl4 and Hes has been noted. Thus, for the first time on the model of oxidative stress in rats the data have been obtained showing at the gene expression level a synergism of action of two flavonoids - R and Hes, widely present in the daily human diet.

Keywords: rutin, hesperidin, CCl4, Nrf2, AhR, gene expression, xenobiotic-metabolizing enzymes, antioxidant enzymes

Изучение функциональной роли минорных биологически активных компонентов пищи и в первую очередь флавоноидов показало, что большинство из них участвуют в сложном процессе регуляции защитных реакций организма в ответ на стрессовые воздействия. Важное значение для защитно-адаптационных возможностей имеют связанные общими путями регуляции и взаимодействующие между собой полифункциональные системы, обеспечивающие защиту клетки от повреждающего действия экзо- и эндогенных факторов: система ферментов метаболизма ксенобиотиков I и II фазы и система антиоксидантной защиты. К ключевым факторам регуляции экспрессии генов ферментов и других компонентов этих систем относятся транскрипционные факторы AhR и Nrf2 [1-3].

Транскрипционный фактор Nrf2 инициирует экспрессию генов, содержащих в промоторной области регу-ляторный элемент ARE (антиоксидант-респонсивный элемент) [1, 4]. К Nrf2/ARE-контролируемым генам относятся гены большого числа антиоксидантных ферментов и многих ферментов II фазы метаболизма ксенобиотиков, в том числе NAD(P)H-хиноноксидоредуктазы (ХР) (NQO1) и гемоксигеназы-1 (ГО-1) (Hmoxl). Хотя ХР и ГО-1 часто относят к ферментам II фазы метаболизма ксенобиотиков, они имеют важное значение и для ан-тиоксидантной защиты клетки [5, 6]. Фактор транскрипции Nrf2 и контролируемые им ARE-содержащие гены рассматриваются как центральная система клеточной защиты от стрессов, вызванных электрофильными соединениями и оксидантами [4, 7, 8].

Лиганд-активируемый AhR инициирует экспрессию генов, содержащих XRE (ксенобиотик-респонсивный

элемент) и в первую очередь генов семейства 1 цитохро-ма Р450 - CYP1A1, CYP1A2, CYP1B1 и главных ферментов II фазы метаболизма ксенобиотиков - UDP-глюкуро-нозилтрансферазы и глутатионтрансферазы. Основная функция AhR/XRE-регулируемых генов - биотрансформация и детоксикация ксенобиотиков и небольшого числа лекарственных средств (ЛС) [2, 3, 9].

Имеются данные, свидетельствующие о наличии прямой связи между факторами Nrf2 и AhR [10, 11]. Так, в промоторе гена Nrf2 мыши обнаружены XRE-подобные последовательности, что указывает на возможность прямой регуляции фактором AhR экспрессии гена Nrf2. Вероятна также непрямая активация Nrf2 активными формами кислорода, генерируемыми CYP1A1. Ряд ан-тиоксидантных ферментов и ферментов II фазы метаболизма ксенобиотиков контролируются как AhR, так и Nrf2. К ним относится ХР, ген которой содержит и XRE, и ARE.

В суперсемействе CYP450 особое положение занимает подсемейство CYP3A, на долю которого приходится 30-40% от всех изоформ цитохрома Р450 в печени и 80% в кишечнике [12]. Интенсивное изучение механизмов регуляции ферментов этого семейства связано с тем, что они отвечают за метаболизм 50-60% ЛС и, таким образом, являются одним из факторов, определяющих действие ЛС, лекарственные взаимодействия и взаимодействия ЛС и пищевых веществ [13].

Индуцированное четыреххлористым углеродом (CCl4) поражение печени - это наиболее часто используемая модель для скрининга in vivo гепатопротекторной и антиоксидантной активности [14, 15]. Установлено, что токсическое действие CCl4 связано в первую очередь

с прооксидантным действием образующихся в процессе его метаболизма свободных радикалов - трихлорме-тильного CCl3* и высокореактивного трихлорметилпе-роксильного СС13ОО*.

Цель настоящей работы - изучение влияния рутина (Р) и гесперидина (Гес), основных представителей двух наиболее изученных подклассов флавоноидов - фла-вонолов и флаванонов, на экспрессию прототипичных Nrf2- и AhR- регулируемых генов, а также гена CYP3A1 в печени крыс в условиях токсического действия CCl4.

Материал и методы

Исследования проводили на 5 группах крыс-самцов линии Вистар с исходной массой тела 180-200 г, по 8 животных в каждой. В работе придерживались нормативов содержания лабораторных животных в соответствии с Европейской конвенцией по защите позвоночных животных, используемых для экспериментальных или иных научных целей (Страсбург, 1986 г.).

Крысы контрольной и 1-й опытной групп в течение 14 дней получали полусинтетический (базовый) рацион, крысы 2-й опытной - тот же рацион с включением Р («Sigma-Aldrich», США) в количестве 400 мг на 1 кг массы тела, животные 3-й опытной группы получали рацион с включением Гес («Sigma-Aldrich», США) в том же количестве, 4-й опытной группы - рацион, содержащий Р и Гес в количестве 400 мг на 1 кг массы тела. Животным опытных групп за 24 ч до окончания эксперимента вводили внутрибрюшинно однократно CCl4 в дозе 0,5 мл на 1 кг массы тела в виде 25% раствора в оливковом масле, крысам контрольной группы - равное количество оливкового масла (2 мл на 1 кг массы тела). Животные получали воду без ограничений и корм в режиме свободного доступа из расчета 15 г сухой смеси на крысу в сутки. Контроль за поедаемостью корма и состоянием животных проводили ежедневно, определение массы тела - через день.

Полимеразная цепная реакция с обратной транскрипцией в режиме реального времени

При подготовке к проведению обратной транскрипции (ОТ) выделяли из печени общую рибонуклеиновую кислоту (РНК) по методу [16] с помощью реагента TRI REAGENT («Sigma-Aldrich», США). Концентрацию РНК определяли на спектрофотометре NanoDrop 1000 («Thermo Scientific», США).

Для проведения ОТ готовили смесь общим объемом 25 мкл, состоящую из 5 мкл 5-кратного буфера для M-MuLV обратной транскриптазы («СибЭнзим», Россия), 5 мкл смеси дезоксинуклеотид-трифосфатов (2,5 мМ каждый) («СибЭнзим», Россия), 4 мкл 83 мкМ oligo(dT)-праймера («Литех», Россия), 4,57 мкл DEPC-воды («Thermo Scientific», США), 0,63 мкл (25Е) ингибитора РНКаз RiboLock («Thermo Scientific», США), 0,8 мкл (160Е) M-MuLV обратной транскриптазы («СибЭнзим», Россия) и 5 мкл РНК (0,4 мкг/мкл). Реакцию ОТ прово-

дили на приборе CFX 96 («Bio-Rad», США) при 37 °С в течение 1 ч. Полученную в реакции ОТ комплементарную ДНК (кДНК) использовали для оценки экспрессии генов NQO1, Hmoxl, Nrf2, AhR, CYP1A1, CYP1A2, CYP3A1 и ß-актина (Actb) методом ПЦР в режиме реального времени. Реакционная смесь для ПЦР общим объемом 25 мкл содержала 12,5 мкл 2-кратного iQ SYBR Green Supermix («Bio-Rad», США) (100 мМ KCl, 40 мМ Трис-HCl pH 8,4, 0,4 мМ дезоксинуклеотид-трифосфаты, 50 ед/мл iTaq ДНК-полимераза, 6 мМ MgCl2, интеркалирующий краситель SYBR Green I, 20 нМ флюоресцеин и стабилизаторы), по 2,5 мкл прямого и обратного праймеров к исследуемому гену (концентрация праймеров 1 ОЕ/мл) («Литех», Россия), 5 мкл воды без нуклеаз («Thermo Scientific», США) и 2,5 мкл кДНК в разведении 1:10. Последовательность праймеров представлена в таблице.

Последовательность праймеров

Ген Нуклеотидная последовательность праймеров

Actb FCGTTGACATCCGTAAAGACCTC RTAGGAGCCAGGGCAGTAATCT

Nrf2 FGACCTAAAGCACAGCCAACACAT RCTCAATCGGCTTGAATGTTTGTC

NQO1 FGTGAGAAGAGCCCTGATTGT RCCTGTGATGTCGTTTCTGGA

Hmoxl FACCCCACCAAGTTCAAACAG RGAGCAGGAAGGCGGTCTTAG

CYP1A1 FCCAAACGAGTTCCGGCCT RTGCCCAAACCAAAGAGAATGA

AhR FTCACTGCGCAGAATCCCACATCC RTCGCGTCCTTCTTCATCCTTAGC

CYP1A2 FCTGCAGAAAACAGTCCAGGA RGAGGGATGAGACCACCGTTG

CYP3A1 FCTGCTTTCAGCTCTCACACT RCACTCGATGCTTCTGCAC

Амплификацию проводили на приборе CFX 96 («BioRad», США). Полимеразную цепную реакцию (ПЦР) для всех изучаемых генов осуществляли по следующей схеме: активация iTaq ДНК-полимеразы при 95 °С в течение 3 мин; 40 циклов (45 для CYP1A1), каждый из них состоял из денатурации при 95 °С в течение 15 с для Actb и Nrf2; 20 с - NQO1, CYP1A1, AhR, 30 c - CYP1A2 и CYP3A1 и 5 с - Hmoxl, отжига праймеров при 58 °С, 15 с для Actb; 58 °С, 20 с - Nrf2; 60 °С, 30 с - NQO1, Hmoxl, AhR, CYP1A1, CYP1A2 и CYP3A1 и синтеза продукта при 72 °С в течение 45 с - для Actb, 27 с - Nrf2; 30 с - NQO1, AhR, CYP1A1, CYP1A2 и CYP3A1 и 10 с - Hmoxl; после окончания циклов проводили контроль специфичности праймеров с помощью анализа кривой плавления (melt curve) в диапазоне 50-95 °С (шаг - 0,5 °С по 10 с каждый).

Уровни экспрессии изучаемых генов нормализовали относительно уровня экспрессии гена сравнения Actb и рассчитывали по значению порогового цикла (Ct -cycle threshold) с использованием программы «Relative expression software tool» (REST) v.2.0.13 («Qiagen», Германия). Данные представляли в виде средних значений (n=6), амплификацию для каждого значения проводили в трех повторах.

Результаты и обсуждение

Эффекты CCl4

Как показали результаты ПЦР-анализа, однократное внутрибрюшинное введение CCl4 не оказывало влияния на уровень мРНК Nrf2, но приводило к возрастанию в 1,5 раза (р<0,05) экспрессии мРНК Hmox1 и к значительному подавлению (на 40%, р<0,05) экспрессии мРНК NQO1 (рис. 1). В то же время CCl4 снижал более чем в 2 раза (р<0,05) количество мРНК AhR, что коррелировало с достоверным уменьшением уровня мРНК CYP1A2 до 36% от контроля (рис. 2). При этом уровень экспрессии мРНК CYP1A1 не изменялся. Высокая чувствительность к действию CCl4 на уровне транскрипции обнаружена у гена СYP3A1, экспрессия мРНК которого снижалась более чем в 3 раза (р<0,05) (рис. 3).

Эти результаты хорошо согласуются с нашими ранее полученными данными, которые показали, что индуцированный CCl4 окислительный стресс вызывает достоверное возрастание в печени крыс активности и экспрессии белка ГО-1, но снижает более чем вдвое активность ХР [14, 15]. Возрастание экспрессии мРНК Hmox1 и усиление транслокации Nrf2 в ядро наблюдали на ранних сроках после введения CCl4 у мышей CD-1 [17]. Исследования [18] также показали, что у крыс при токсическом действии CCl4 индуцируется экспрессия гена и белка ГО-1. Полагают, что индукция ГО-1 может быть связана с быстрым увеличением концентрации свободного гема в результате повреждающего действия метаболитов CCl4 на цитохромы Р450 [18].

Преимущественное подавление синтеза белков мик-росомальной фракции печени и снижение активности микросомальных ферментов уже в первые часы после введения крысам CCl4 показано в исследованиях разных лет. Так, по данным [19], через 15 мин после введения CCl4 в количестве 1 мл на 1 кг массы тела содержание микросомального цитохрома Р450 и активность некоторых цитохром Р450-зависимых моно-оксигеназ в печени были снижены более чем в 2 раза и продолжали снижаться на более поздних сроках. При введении CCl4 внутрь в дозе 0,5 мл на 1 кг массы тела через 24 ч в печени крыс активность ряда изоформ цитохрома Р450, в том числе CYP1A2 и CYP3A, снижалась на 70-75% [20]. Аналогичные результаты были получены в эксперименте на крысах, получавших CCl4 в дозе 1 мл на 1 кг массы тела: снижение активности CYP1A2 и CYP3A2 сопровождалось значительным снижением экспрессии белка ферментов [21]. Эти же авторы показали, что СС14 in vitro в клетках HepG2 подавляет экспрессию мРНК СYP3A4. Эти данные полностью совпадают с результатами наших исследований. Обнаруженное резкое снижение экспрессии мРНК AhR в результате окислительного воздействия радикалов СС14 [22], возможно, является одной из причин нарушения регуляции синтеза AhR-зависимых ферментов, в том числе CYP1A и ХР.

250 200 150 ^ 100 50 0

*АО+

Nrf2

Hmox-1

*А _ *+

А+

1

NQ01

К 1 2 3 4 К 1 2 3 4

CCl4 - + + + + - + + + +

P-- + -+ - - + - +

Гес — — — + + - -- + +

К 1 2 - + +

- - +

3 4

+ +

- +

+ +

Рис. 1. Влияние рутина и гесперидина при их раздельном и сочетанном действии на экспрессию матричной рибонуклеиновой кислоты N^2, матричной рибонуклеиновой кислоты Нтох1 и матричной рибонуклеиновой кислоты N001 в печени крыс после введения СС14 (п=6)

Здесь и на рис. 2 и 3: * - статистически значимые отличия (р<0,05) от показателя контрольной группы (К); Д - 1-й опытной группы; О - 2-й опытной группы; + - 3-й опытной группы.

140-

тс 120-

о

80-

^

О 60-

40-

П!

CL 2 20-

0-

CCl4

P

Гес

AhR

CYP1A1

CYP1A2

*АО+

I

*АО+

I

3 4 + +

- + ++

К 1 2 3 4

- + + + +

- - + - +

- - - + +

К 1 2 3 4

- + + + +

- - + - +

- - - + +

Рис. 2. Влияние рутина и гесперидина при их раздельном и сочетанном действии на экспрессию матричной рибонуклеиновой кислоты AhR, матричной рибонуклеиновой кислоты CYP1A1 и матричной рибонуклеиновой кислоты CYP1A2 в печени крыс после введения CCl4 (n=6)

250-

200-

150-

о 100 4

50-

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

*АО+

К

CCl4 -

P-Гес -

1 2 + +

- +

3 4 + +

- + ++

Рис. 3. Влияние рутина и гесперидина при их раздельном и соче-танном действии на экспрессию матричной рибонуклеиновой кислоты СУР3Л1 в печени крыс после введения СС14 (п=6)

*

А

*

А

0

Эффекты рутина + CCl4

Как видно из рис. 1, включение Р в рацион крыс и последующее введение им CCl4 не оказывало влияния на уровень мРНК Nrf2, но приводило к достоверному увеличению экспрессии мРНК Hmox1 на 80% относительно контроля и на 25% относительно уровня у крыс, получавших только CCl4. Уровень экспрессии мРНК NQO1 в этой группе не только восстанавливался до контрольного уровня, но и превышал его на 60% (р<0,05) и отличался почти в 3 раза от экспрессии гена фермента при введении CCl4 на фоне базового рациона. Обогащение рациона Р не влияло на степень вызванного CCl4 подавления экспрессии мРНК AhR и CYP1A2 (см. рис. 2). В то же время уровень экспрессии гена CYP3A1 у крыс, получавших CCl4 и Р, восстанавливался до контрольного и в 4 раза (р<0,05) превышал экспрессию гена фермента у крыс, получавших только CCl4 (см. рис. 3).

В ряде исследований показано гепатопротекторное действие Р на модели индуцированного CCl4 окислительного стресса, которое связывают со способностью Р активировать антиоксидантные ферменты [23-25]. Так, в исследованиях на мышах защитное действие Р и кверцетина коррелировало с индуцирующим действием Р на экспрессию мРНК Nrf2 и Hmoxl при вызванном CCl4 повреждении печени [25]. Способность квер-цетина индуцировать активность и экспрессию гена и белка ХР и ГО-1 также показана in vitro на культурах клеток [6, 26]. При этом получены доказательства связи активации ферментов с усилением экспрессии гена и белка фактора Nrf2. Результаты настоящей работы показали отсутствие изменений экспрессии гена Nrf2 у крыс всех опытных групп, несмотря на значительные изменения экспрессии Nrf2-контролируемых генов Hmoxl и NQO1. Это может объясняться тем, что активность фактора Nrf2 регулируется, как установлено, не на транскрипционном уровне, а главным образом за счет изменения стабильности его белка [27].

Следует отметить, что пока мало изучены регуля-торные эффекты Р и других гепатопротекторов на экспрессию генов ферментов, выполняющих защитные функции, в условиях токсического действия CCl4. Ранее нами была показана способность Р избирательно индуцировать активность и транскрипцию генов цитохромов Р450 подсемейства 1А [28]. В других работах также обнаруживали возрастание активности и экспрессии белка CYP1A1 и CYP1A2 в печени крыс Вистар, получавших Р [29]. Интересно отметить, что в исследованиях in vitro получены доказательства наличия у агликона Р кверцетина, свойств лиганда (с низким сродством) рецептора AhR и способность индуцировать активность ферментов и экспрессию генов CYP1A [30, 31].

В настоящей работе не обнаружено влияния Р на сниженный под действием СС14 уровень экспрессии мРНК AhR, CYP1A1 и CYP1A2 по сравнению с показателями крыс, получавших СС14 на фоне базового рациона. Обсуждая наблюдаемое при этом восстановление экспрессии мРНК CYP3A1 до контрольного уровня, необходимо отметить, что в ряде исследований показана

способность Р и его агликона, кверцетина, индуцировать активность и экспрессию гена CYP3A как in vivo у крыс [32], так и в первичной культуре гепатоцитов человека [33]. В клинических испытаниях также установлено индуцирующее действие кверцетина (источник зверобой) на активность CYP3A4 [34].

Эффекты гесперидина + CCl4

По сравнению с введением CCl4 на фоне базового рациона обогащение рациона Гес CCl4 вызывало небольшое (на 30%) статистически достоверное уменьшение уровня мРНК Nrf2, но не влияло на экспрессию генов NQO1 и Hmoxl (см. рис. 1). Включение Гес в рацион также не влияло на уровень вызванного CCl4 подавления экспрессии генов AhR, CYP1A1, CYP1A2 и CYP3A1 (см. рис. 2 и 3). Имеются единичные работы, в которых сообщается о гепатопротекторном и ней-ропротекторном эффекте Гес при остром токсическом действии CCl4 [35, 36] и относительно мало данных о его взаимодействии с Nrf2- и AhR-сигнальными путями. Следует отметить, что и у интактных крыс Гес в той же дозе 400 мг на 1 кг массы тела несущественно, на 20% (р<0,05), уменьшал количество мРНК Nrf2 и практически не влиял на экспрессию генов Hmox1 и NQO1 [37]. И в других экспериментах на крысах не обнаруживали влияния Гес на активность ферментов системы цитохро-ма Р450, хотя in vitro Гес проявлял свойства как агониста, так и антагониста AhR [38].

Эффекты рутина и гесперидина + CCl4

При совместном включении Р и Гес в рацион введение CCl4 крысам вызывало небольшое достоверное увеличение количества мРНК Nrf2 по сравнению с группами, получавшими CCl4 и базовый рацион или CCl4 и Гес (см. рис. 1). Уровень мРНК Hmox1 при этом превышал контрольный уровень в 1,7 раза (p<0,05) и не отличался от уровня у крыс, получавших Р и CCl4 или только CCl4, но был достоверно выше (на 31%) экспрессии мРНК Hmox1 у животных, получавших CCl4 и рацион с Гес. Обогащение рациона крыс одновременно Р и Гес не только восстанавливало до контрольного уровня сниженную CCl4 экспрессию гена NQO1, но и индуцировало ее до уровня, в 2,4 раза превышающего контрольный, у крыс, получавших только CCl4 или Гес и CCl4, в 4 раза и у крыс, получавших Р и CCl4, - в 1,5 раза.

У животных, получавших рацион с двумя флавоно-идами, после введения CCl4 экспрессия мРНК AhR, хотя и достоверно, но малосущественно превышала экспрессию гена у крыс, получавших только CCl4 (на 20%), CCl4 и Р (на 33%) или CCl4 и Гес (на 45%) (см. рис. 2). Аналогично в этой группе экспрессия мРНК CYP1A2 оставалась ниже контрольного уровня, но превышала (p<0,05) уровень экспрессии гена у крыс, получавших только CCl4, на 64%, у получавших CCl4 и Р, - в 2 раза и на 60% у крыс, получавших CCl4 и Гес. Экспрессия мРНК CYP1A1 при введении CCl4 на фоне рациона с Р и Гес превышала уровень контроля на 40%, уровень экспрессии гена у крыс, получавших только

СС14, на 70% и не отличалась практически от значений у крыс, получавших СС14 и Р. Выявленные изменения были статистически незначимы.

В то же время введение СС14 крысам, получавшим рацион с Р и Гес, сопровождалось значительной индукцией экспрессии мРНК ОУР3А1 в 2,2 раза относительно контроля, в 7,5 раза относительно уровня у крыс, получавших базовый рацион, в 1,8 раза относительно уровня экспрессии у крыс, получавших рацион с Р, и в 7,2 раза - относительно экспрессии гена ОУР3А1 при включении Гес в рацион (см. рис. 3). Учитывая ключевую роль ОУР3А в метаболизме большинства лекарственных средств, эти данные заслуживают особого внимания.

Таким образом, полученные результаты показали, что при остром токсическом действии СС14 обогащение рациона крыс Р, но не Гес приводило к достоверному

возрастанию экспрессии генов Нтох1, N001 и ОУР3А1. При совместном включении Р и Гес в рацион отмечались аддитивность их действия на экспрессию гена Нтох1 и синергизм - в действии на экспрессию генов N001 и ОУР3А1. При этом выявлено умеренное статистически значимое усиление экспрессии генов АЬЙ и ОУР1А2 относительно уровня их экспрессии у крыс, получавших только СС14, СС14 и Р или СС14 и Гес. В заключение следует подчеркнуть, что в условиях про-оксидантного действия СС14 Р усиливал адаптационный потенциал крыс, индуцируя экспрессию генов ферментов антиоксидантной защиты и метаболизма ксенобиотиков. Впервые на модели окислительного стресса у крыс получены данные, демонстрирующие синергизм действия на уровне экспрессии генов 2 флавоноидов -Р и Гес, широко представленных в ежедневном рационе человека.

Сведения об авторах

ФГБУН «ФИЦ питания и биотехнологии» (Москва): Балакина Анастасия Станиславовна - аспирант Е-таИ: balakina.a.s@yandex.ru

Трусов Никита Вячеславович - научный сотрудник лаборатории энзимологии питания Е-тшИ: nikkitosu@yandex.ru

Аксенов Илья Владимирович - кандидат медицинских наук, старший научный сотрудник лаборатории энзимологии питания

Е-тшИ: aksenov@ion.ru

Гусева Галина Владимировна - кандидат биологических наук, научный сотрудник лаборатории энзимологии питания

Е-тшИ: mailbox@ion.ru

Кравченко Лидия Васильевна - кандидат медицинских наук, ведущий научный сотрудник лаборатории энзимологии питания

Е-тшИ: kravchenko@ion.ru

Тутельян Виктор Александрович - академик РАН, доктор медицинских наук, профессор, заведующий лабораторией энзимологии питания, научный руководитель Е-тшИ: tutelyan@ion.ru

Литература

Турпаев К.Т. Сигнальная система Кеар1 -Nrf2. Механизм регуляции и значение для защиты клеток от токсического действия ксенобиотиков и элктрофильных соединений // Биохимия. 2013. Т. 78, № 2. С. 147-166.

Тутельян В.А., Гаппаров М.М., Телегин Л.Ю. и др. Флавоноиды и резвератрол как регуляторы активности Ah-рецептора: защита от токсичности диоксина // Бюл. экспер. биол. 2003. Т. 136, № 12. С. 604-611.

Nebert D.W., Dalton T.P., Okey A.B., Gonzalez F.J. Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer // J. Biol. Chem. 2004. Vol. 279, N 23. P. 23 847-23 850.

Ляхович В.В., Вавилин В.А., Зенков Н.К., Меньщикова Е.Б. Активная защита при окислительном стрессе. Антиоксидант-респон-сивный элемент // Биохимия. 2006. Т. 71, № 9. С. 1183-1197. Dinkova-Kostova A.T., Talalay P. NAD(P)H:quinone acceptor oxidore-ductase 1 (NQO1), a multifunctional antioxidant enzyme and exceptionally versatile cytoprotector // Arch. Biochem. Biophys. 2010. Vol. 501, N 1. P. 116-123.

10.

Liu S., Hou W., Yao P. et al. Heme oxygenase-1 mediates the protective role of quercetin against ethanol-induced rat hepatocytes oxidative damage // Toxicol. in Vitro. 2012. Vol. 26, N 1. P. 74-80. Ma Q., He X. Molecular basis of electrophilic and oxidative defense: promises and perils of Nrf2 // Pharmacol. Rev. 2012. Vol. 64, N 4. P. 1055-1081.

Buendia I., Michalska P., Navarro E. et al. Nrf2-ARE pathway: An emerging target against oxidative stress and neuroinflammation in neurodegenerative diseases // Pharmacol. Ther. 2016. Vol. 157. P. 84-104.

Moon Y.J., Wang X., Morris M.E. Dietary flavonoids: effects on xeno-biotic and carcinogen metabolism // Toxicol. in Vitro. 2006. Vol. 20. P. 187-210.

Kohle C., Bock K.W. Coordinate regulation of Phase I and II xenobi-otic metabolisms by the Ah receptor and Nrf2 // Biochem. Pharmacol. 2007. Vol. 73, N 12. P. 1853-1862.

Miao W., Hu L., Scrivens P.J., Batist G. Transcriptional regulation of NF-E2 p45-related factor (NRF2) expression by the aryl hydrocarbon receptor-xenobiotic response element signaling pathway: direct

6

7

2.

8

9.

5

cross-talk between phase I and II drug-metabolizing enzymes // J. Biol. Chem. 2005. Vol. 280, N 21. P. 20 340-20 348.

12. Basheer L., Kerem Z. Interactions between CYP3A4 and Dietary Polyphenols // Oxid. Med. Cell. Longev. 2015. doi: 10.1155/2015/854015.

13. Тутельян В.А., Белоусов Ю.Б., Гуревич. К.Г. Безопасность и эффективность биологически активных веществ растительного происхождения. Новосибирск : Экор-книга, 2007. 316 с.

14. Кравченко Л.В., Трусов Н.В., Ускова М.А. и др. Характеристика острого токсического действия четыреххлористого углерода как модели окислительного стресса // Токсикол. вестн. 2009. № 1. С. 12-18.

15. Ускова М.А., Васильева М.А., Трусов Н.В. и др. Оценка антиок-сидантных и гепатопротекторных свойств штамма Lactobacillus casei 114001 на модели индуцированного CCl4 токсического поражения печени // Вопр. питания. 2009. Т. 78, № 5. С. 24-30.

16. Chomczynski P., Sacchi N. Single-step of RNA isolation by aced gua-nidinium thiocyanate-phenol-chloroform extraction // Anal. Biochem. 1987. Vol. 162. P. 156-159.

17. Randle L.E., Goldring C.E., Benson C.A. Investigation of the effect of a panel of model hepatotoxins on the Nrf2-Keap1 defence response pathway in CD-1 mice // Toxicology. 2008. Vol. 243, N 3. P. 249-260.

18. Nakahira K., Takahashi T., Shimizu H. et al. Protective role of heme oxygenase-1 induction in carbon tetrachloride-induced hepatotoxic-ity // Biochem. Pharmacol. 2003. Vol. 66, N 3. P. 1091-1105.

19. Matsubara T., Mori S., Touchi A. et al. Carbon tetrachloride-induced hepatotoxicity in rats: evidence for different susceptibilities of rat liver lobes // Jpn. J. Pharmacol. 1983. Vol. 33, N 2. P. 435-445.

20. Yokogawa K., Watanabe M., Takeshita H. et al. Serum aminotrans-ferase activity as a predictor of clearance of drugs metabolized by CYP isoforms in rats with acute hepatic failure induced by carbon tetrachloride // Int. J. Pharm. 2004. Vol. 269, N 2. P. 479-489.

21. Xie Y., Hao H., Wang H. et al. Reversing effects of lignans on CCl4-induced hepatic CYP450 down regulation by attenuating oxidative stress // J. Ethnopharmacol. 2014. Vol. 155, N 1. P. 213-221.

22. Barouki R., Morel Y. Repression of cytochrome P450 1A1 gene expression by oxidative stress: mechanisms and biological implications // Biochem. Pharmacol. 2001. Vol. 61, N 5. P. 511-516.

23. Khan R.A., Khan M.R., Sahreen S. CCl4-induced hepatotoxicity: protective effect of rutin on p53, CYP2E1 and the antioxidative status in rat // BMC Complement. Altern. Med. 2012. doi: 10.1186/1472-688212-178.

24. Khan R.A., Khan M.R., Sahreen S. Attenuation of CCl4-induced hepatic oxidative stress in rat by Launaea procumbens // Exp. Toxi-col. Pathol. 2013. Vol. 65, N 3. P. 319-326.

25. Domitrovic R., Jakovac H., Vasiljev Marchesi V. et al. Differential hepatoprotective mechanisms of rutin and quercetin in CCl4-intoxi-

cated BALB/cN mice // Acta Pharmacol. Sinica. 2012. Vol. 33, N 10. P. 1260-1270.

26. Tanigawa S., Fujii M., Hou D.X. Action of Nrf2 and Keap1 in ARE-mediated NQO1 expression by quercetin // Free Radic. Biol. Med. 2007. Vol. 42, N 11. P. 1690-1703.

27. Baird L., Dinkova-Kostova A.T. The cytoprotective role of the Keap1-Nrf2 pathway // Arch. Toxicol. 2011. Vol. 85, N 4. P. 241-272.

28. Кравченко Л.В., Авреньева Л.И., Аксенов И.В и др. Изучение влияния рутина на защитный потенциал крыс // Вопр. питания.

2015. Т. 84, № 3. С. 22-30.

29. Krizkova J., Burdova K., Stiborova M. et al. The effects of selected flavonoids on cytochromes P450 in rat liver and small intestine // Interdiscip. Toxicol. 2009. Vol. 2, N 3. P. 201-204.

30. Vrba J., Kren V., Vacek J. et al. Quercetin, quercetin glycosides and taxifolin differ in their ability to induce AhR activation and CYP1A1 expression in HepG2 cells // Phytother. Res. 2012. Vol. 26, N 11. P. 1746-1752.

31. Ciolino H.P., Daschner P.J., Yeh G.C. Dietary flavonols quercetin and kaempferol are ligands of the aryl hydrocarbon receptor that affect CYP1A1 transcription differentially // Biochem. J. 1999. Vol. 340, N 3. P. 715-722.

32. Yu C.P., Wu P.P., Hou Y.C. et al. Quercetin and rutin reduced the bioavailability of cyclosporine from Neoral, an immunosuppressant, through activating P-glycoprotein and CYP 3A4 // J. Agric. Food Chem. 2011. Vol. 59, N 9. P. 4644-4648.

33. Raucy J. L. Regulation of CYP3A4 expression in human hepatocytes by pharmaceuticals and natural products // Drug Metab. Dispos. 2003. Vol. 31, N 5. P. 533-539.

34. Sprouse A.A., Breemen R.B. Pharmacokinetic interactions between drugs and botanical dietary supplements // Drug Metab. Dispos.

2016. Vol. 44, N 2. P. 162-171.

35. Naseem M., Parvez S. Hesperidin restores experimentally induced neurotoxicity in Wistar rats // Toxicol. Mech. Methods. 2014. Vol. 24, N 7. P. 512-519.

36. Tirkey N., Pilkhwal S., Kuhad A., Chopra K. Hesperidin, a citrus bioflavonoid, decreases the oxidative stress produced by carbon tetrachloride in rat liver and kidney // BMC Pharmacol. 2005. Vol. 5. doi: 10.1186/1471-2210-5-2.

37. Балакина.А.С., Трусов Н.В., Авренева Л.И. и др. Влияние рутина и геспередина на экспрессию гена Nrf2 и активность гемоксигеназы-1 и NAD(P)H-хининоксидоредуктазы при их раздельном и совместном действии // Вопр. питания. 2016. Т. 85, № 3. С. 18-26.

38. Тутельян В.А., Лашнева Н.В. Биологически активные вещества растительного происхождения. Флаваноны: пищевые источники, биодоступность, влияние на ферменты метаболизма ксенобиотиков // Вопр. питания. 2011. Т. 80, № 5. С. 4-23.

References

1. Turpaev K.T. Keap1-Nrf2 signaling pathway: mechanisms of regulation and role in protection of cells against toxicity caused by xenobi-otics and electrophiles. Biokhimiia [Biochemistry]. 2013; Vol. 78 (2): 147-66. (in Russian)

2. Tutelyan V.A., Gapparov M.M., Telegin L.Y., et al. Flavonoids and res-veratrol as regulators of Ah-receptor activity: protection from dioxin toxicity. Byulleten' eksperimental'noy biologii i meditsiny [Bulletin of Experimental Biology and Medicine]. 2003; Vol. 136 (6): 533-9.

3. Nebert D.W., Dalton T.P., Okey A.B., Gonzalez F.J. Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer. J Biol Chem. 2004; Vol. 279 (23): 23 847-50.

4. Lyakhovich V.V., Vavilin V.A., Zenkov N.K., Menshchikova E.B. Active defense under oxidative stress. The antioxidant responsive element. Biokhimiia [Biochemistry]. 2006; Vol. 71 (9): 962-74. (in Russian)

5. Dinkova-Kostova A.T., Talalay P. NAD(P)H:quinone acceptor oxi-doreductase 1 (NQO1), a multifunctional antioxidant enzyme and exceptionally versatile cytoprotector. Arch Biochem Biophys. 2010; Vol. 501 (1): 116-23.

6. Liu S., Hou W., Yao P., et al. Heme oxygenase-1 mediates the protective role of quercetin against ethanol-induced rat hepatocytes oxidative damage. Toxicol In Vitro. 2012; Vol. 26 (1): 74-80.

7. Ma Q., He X. Molecular basis of electrophilic and oxidative defense: promises and perils of Nrf2. Pharmacol Rev. 2012; Vol. 64 (4): 1055-81.

8. Buendia I., Michalska P., Navarro E., et al. Nrf2-ARE pathway: An emerging target against oxidative stress and neuroinflammation in neurodegenerative diseases. Pharmacol Ther. 2016; Vol. 157: 84-104.

9. Moon Y.J., Wang X., Morris M.E. Dietary flavonoids: effects on xenobiotic and carcinogen metabolism. Toxicol in Vitro. 2006; Vol. 20: 187-210.

10. Kohle C., Bock K.W. Coordinate regulation of Phase I and II xenobi-otic metabolisms by the Ah receptor and Nrf2. Biochem Pharmacol. 2007; Vol. 73 (12): 1853-62.

11. Miao W., Hu L., Scrivens P.J., Batist G. Transcriptional regulation of NF-E2 p45-related factor (NRF2) expression by the aryl hydrocarbon receptor-xenobiotic response element signaling pathway: direct

cross-talk between phase I and II drug-metabolizing enzymes. J Biol Chem. 2005; Vol. 280 (21): 20 340-8.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

12. Basheer L., Kerem Z. Interactions between CYP3A4 and Dietary Polyphenols. Oxid Med Cell Longev. 2015. doi: 10.1155/2015/854015.

13. Tutelyan V.A., Belousov Y.B., Gurevich. K.G. Safety and efficacy of biologically active substances of plant origin. Novosibirsk, 2007: 316 p. (in Russian)

14. Kravchenko L.V., Trusov N.V., Uscova M.A. Characterization of carbon tetrachloride acute toxicity as a model of oxidative stress. Toksikologicheskiy vestnik [Toxicological Review]. 2009; Vol. 1: 12-8. (in Russian)

15. Uskova M.A., Vasilyeva M.A., Trusov N.V., et al. Evaluation of anti-oxidant and hepatoprotective properties of stain Lactobacillus casei 114001 in carbon tetrachloride-induced liver toxicity model. Voprosy pitaniia [Problems of Nutrition]. 2009; Vol. 78 (5): 24-30. (in Russian)

16. Chomczynski P., Sacchi N. Single-step of RNA isolation by aced gua-nidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987; Vol. 162: 156-9.

17. Randle L.E., Goldring C.E., Benson C.A. Investigation of the effect of a panel of model hepatotoxins on the Nrf2-Keap1 defence response pathway in CD-1 mice. Toxicology. 2008; Vol. 243 (3): 249-60.

18. Nakahira K., Takahashi T., Shimizu H., et al. Protective role of heme oxygenase-1 induction in carbon tetrachloride-induced hepatotoxic-ity. Biochem Pharmacol. 2003; Vol. 66 (3): 1091-105.

19. Matsubara T., Mori S., Touchi A., et al. Carbon tetrachloride-induced hepatotoxicity in rats: evidence for different susceptibilities of rat liver lobes. Jpn J Pharmacol. 1983; Vol. 33 (2): 435-45.

20. Yokogawa K., Watanabe M., Takeshita H., et al. Serum aminotrans-ferase activity as a predictor of clearance of drugs metabolized by CYP isoforms in rats with acute hepatic failure induced by carbon tetrachloride. Int J Pharm. 2004; Vol. 269 (2): 479-89.

21. Xie Y., Hao H., Wang H., et al. Reversing effects of lignans on CCl4-induced hepatic CYP450 down regulation by attenuating oxidative stress. J Ethnopharmacol. 2014; Vol. 155 (1): 213-21.

22. Barouki R., Morel Y. Repression of cytochrome P450 1A1 gene expression by oxidative stress: mechanisms and biological implications. Biochem Pharmacol. 2001; Vol. 61 (5): 511-6.

23. Khan R.A., Khan M.R., Sahreen S. CCl4-induced hepatotoxicity: protective effect of rutin on p53, CYP2E1 and the antioxidative status in rat. BMC Complement Altern Med. 2012. doi: 10.1186/1472-688212-178.

24. Khan R.A., Khan M.R., Sahreen S. Attenuation of CCl4-induced hepatic oxidative stress in rat by Launaea procumbens. Exp Toxicol Pathol. 2013; Vol. 65 (3): 319-26.

25. Domitrovic R., Jakovac H., Vasiljev Marchesi V., et al. Differential hepatoprotective mechanisms of rutin and quercetin in CCl4-intoxi-

cated BALB/cN mice. Acta Pharmacol Sinica. 2012; Vol. 33 (10): 1260-70.

26. Tanigawa S., Fujii M., Hou D.X. Action of Nrf2 and Keap1 in ARE-mediated NQO1 expression by quercetin. Free Radic Biol Med. 2007; Vol. 42 (11): 1690-703.

27. Baird L., Dinkova-Kostova A.T. The cytoprotective role of the Keap1-Nrf2 pathway. Arch Toxicol. 2011; Vol. 85 (4): 241-72.

28. Kravchenko L.V., Avreneva L.I., Aksenov I.V., et al. Effects of rutin on protective capacity in rats. Voprosy pitaniia [Problems of Nutrition]. 2015; Vol. 84 (3): 22-30. (in Russian)

29. Krizkova J., Burdova K., Stiborova M., et al. The effects of selected flavonoids on cytochromes P450 in rat liver and small intestine. Interdiscip Toxicol. 2009; Vol. 2 (3): 201-4.

30. Vrba J., Kren V., Vacek J., et al. Quercetin, quercetin glycosides and taxifolin differ in their ability to induce AhR activation and CYP1A1 expression in HepG2 cells. Phytother Res. 2012; Vol. 26 (11): 1746-52.

31. Ciolino H.P., Daschner P.J., Yeh G.C. Dietary flavonols quercetin and kaempferol are ligands of the aryl hydrocarbon receptor that affect CYP1A1 transcription differentially. Biochem J. 1999; Vol. 340 (3): 715-22.

32. Yu C.P., Wu P.P., Hou Y.C., et al. Quercetin and rutin reduced the bioavailability of cyclosporine from Neoral, an immunosuppressant, through activating P-glycoprotein and CYP 3A4. J Agric Food Chem. 2011; Vol. 59 (9): 4644-8.

33. Raucy J. L. Regulation of CYP3A4 expression in human hepatocytes by pharmaceuticals and natural products. Drug Metab Dispos. 2003; Vol. 31 (5): 533-9.

34. Sprouse A.A., Breemen R.B. Pharmacokinetic interactions between drugs and botanical dietary supplements. Drug Metab Dispos. 2016; Vol. 44 (2): 162-71.

35. Naseem M., Parvez S. Hesperidin restores experimentally induced neurotoxicity in Wistar rats. Toxicol Mech Methods. 2014; Vol. 24 (7): 512-9.

36. Tirkey N., Pilkhwal S., Kuhad A., Chopra K. Hesperidin, a citrus bioflavonoid, decreases the oxidative stress produced by carbon tetrachloride in rat liver and kidney. BMC Pharmacol. 2005; Vol. 5. doi: 10.1186/1471-2210-5-2.

37. Balakina A.S., Trusov N.V., Avrenieva L.I., et al. Effect of rutin and hesperidin on the expression of Nrf2 gene and the activity of hemox-ygenase-1 and NAD(P)H-quinone oxidoreductase at their separate and combined action. Voprosy pitaniia [Problems of Nutrition]. 2016; Vol. 85 (3): 18-26. (in Russian)

38. Tutelyan V.A., Lashneva N.V. Biological active substances of plant origin. Flavanones: dietary sources, biovailability, the influence on xenobiotic metabolizing enzymes. Voprosy pitaniia [Problems of Nutrition]. 2011; Vol. 80 (5): 4-23. (in Russian)

i Надоели баннеры? Вы всегда можете отключить рекламу.