Научная статья на тему 'Влияние куркумина и кверцетина на показатели защитного потенциала крыс при их раздельном и совместном действии'

Влияние куркумина и кверцетина на показатели защитного потенциала крыс при их раздельном и совместном действии Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
590
464
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Вопросы питания
Scopus
ВАК
PubMed
Ключевые слова
КУРКУМИН / КВЕРЦЕТИН / NRF2/ARE / AHR/XRE / ФЕРМЕНТЫ МЕТАБОЛИЗМА КСЕНОБИОТИКОВ / ФЕРМЕНТЫ АНТИОКСИДАНТНОЙ ЗАЩИТЫ / CURCUMIN / QUERCETIN / NRF2/A RE / XENOBIOTIC METABOLIZING ENZYMES / ANTIOXIDANT ENZYMES

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Балакина Анастасия Станиславовна, Аксенов Илья Владимирович, Трусов Никита Вячеславович, Гусева Галина Владимировна, Авреньева Людмила Ивановна

Целью работы являлось изучение влияния куркумина (КУР) и кверцетина (КВ) при их раздельном и совместном включении в рацион крыс на активность и экспрессию генов прототипичных Nrf2/AREи AhR/XRE-регулируемых ферментов. Исследование проведено на крысах-самцахлинии Вистар с исходной массой тела 230-235 г, которые в течение 14 дней получали стандартный полусинтетичес-кий рацион с раздельным и совместным включением КУР и КВ в дозе 200 мг на 1 кг массы тела каждого. В печени крыс определяли экспрессию генов и активность Nrf2/ARE-регулируемых ферментов гемоксигеназы-1 (ГО-1), NAD(Р)H-хинон-оксидоредуктазы (ХР), AhR/XRE-регулируемых CYP1A1, CYP1A2 и уровень матричной рибонуклеиновой кислоты транскрипционных факторов Nrf2 и AhR. В печени изучали также экспрессию гена CYP3A1 и активность CYP3A, активность UDP-глюкуронозилтрансферазы и глутатионтрансферазы. Наряду с этим в плазме крови и печени определяли общую антиоксидантную активность (АОА), уровень малонового диальдегида и гидроперекисей липидов. В печени изучали содержание восстановленного и окисленного глутатиона, общую и неседиментируемую активность лизосомальных ферментов. КВ, особенно в сочетании с КУР, повышал АОА плазмы крови и снижал содержание в ней гидроперекисей липидов. КУР и КВ не влияли на активность ХР, но при совместном поступлении вызывали возрастание активности ГО-1, не влияя существенно на экспрессию гена фермента (Hmox1) и гена Nrf2. КУР и в меньшей степени КВ оказывали сильное индуцирующее действие на активность CYP1A1, CYP1A2 и CYP3A, но только активация CYP1A1 сопровождалась индукцией гена CYP1A1. Индуцирующее влияние КУР и КВ на активность цитохромов значительно усиливалось при их совместном действии. Мембраностабилизирующее действие КУР и КВ также было сильнее выражено при их совместном включении в рацион. Таким образом, можно заключить, что КУР и КВ, особенно в комбинации, способствуют повышению защитно-адаптационного потенциала организма.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Балакина Анастасия Станиславовна, Аксенов Илья Владимирович, Трусов Никита Вячеславович, Гусева Галина Владимировна, Авреньева Людмила Ивановна

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

The influence of separate and combined supplementation with curcumin and quercetin on the protective capacity in rats

The purpose of the study was to determine the effects of curcumin (CUR) and quercetin (QUER) on the expression of genes and activity of prototypical Nrf2/AREand AhR/ XRE-regulated enzymes. Investigation was carried out on male Wistar rats with initial body weight (230-235 g b.w.) that received for 14 days CUR (200 mg/kg b.w.) and QUER (200 mg/kg b.w.) separately or in combination within the standard semi-synthetic diet. The expression of genes and activity of Nrf2/ARE regulated enzymes heme oxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO1), AhR/XRE-regulated CYP1A1, CYP1A2 enzymes and the mRNA level of transcription factors Nrf2 and AhR were determined in rats liver. Also the expression of gene CYP3A1 and activity of CYP3A, UDP-glucuronosyltransferase, glutathione transferase were studied in rats liver. Along with this the total antioxidant activity (AOA), malondialdehyde and lipid hydroperoxides levels were determined in blood plasma and liver. The reduced and oxidized glutathione level, total and unsedimentable activity of lysosomal enzymes were investigated in rats’ liver. QUER, especially in combination with CUR, increased the AOA of blood plasma and reduced the content of lipid hydroperoxides in it. CUR and QUER did not affect NQO1 activity, but the combined action caused an increase in the HO-1 activity without affecting the expression of the corresponding gene (Hmox1) and Nrf2 gene. CUR and, to a lesser extent QUER, had a strong inducing effect on CYP1A1, CYP1A2, CYP3A activity, but only the CYP1A1 activation was accompanied by the induction of CYP1A1 gene. The inducing effect of CUR and QUER on the activity of CYP450 enzymes greatly enhanced by their combined action. Membrane stabilizing action of CUR and QUER was also strongly expressed under its combined intake. Thus, we can conclude that CUR and QUER, especially in combination, contribute to the protective and adaptive capacity.

Текст научной работы на тему «Влияние куркумина и кверцетина на показатели защитного потенциала крыс при их раздельном и совместном действии»

Для корреспонденции

Балакина Анастасия Станиславовна - младший научный сотрудник ФГБУН «ФИЦ питания и биотехнологии» Адрес: 109240, г. Москва, Устьинский проезд, д. 2/14 Телефон: (495) 698-53-65 Е-таИ: balakina.a.s@yandex.ru

Балакина А.С., Аксенов И.В., Трусов Н.В., Гусева Г.В., Авреньева Л.И., Кравченко Л.В., Тутельян В.А.

Влияние куркумина и кверцетина на показатели защитного потенциала крыс при их раздельном и совместном действии

The influence of separate and combined supplementation with curcumin and quercetin on the protective capacity in rats

Balakina A.S., Aksenov I.V.,

Trusov N.V., Guseva G.V., Avrenyeva L.I.,

Kravchenko L.V., Tutelyan V.A.

ФГБУН «ФИЦ питания и биотехнологии», Москва

Federal Research Centre of Nutrition, Biotechnology and Food Safety,

Moscow

Целью работы являлось изучение влияния куркумина (КУР) и кверцетина (КВ) при их раздельном и совместном включении в рацион крыс на активность и экспрессию генов прототипичных Ыт/2/ЛКЕ- и ЛНК/ХКЕ-регулируемых ферментов. Исследование проведено на крысах-самцах линии Вистар с исходной массой тела 230-235 г, которые в течение 14 дней получали стандартный полусинтетический рацион с раздельным и совместным включением КУР и КВ в дозе 200мг на 1 кг массы тела каждого. В печени крыс определяли экспрессию генов и активность Ыт/2/ЛКЕ-регулируемых ферментов - гемоксигеназы-1 (ГО-1), ЫЛБ(Р)Н-хинон-оксидоредуктазы (ХР), ЛНК/ХКЕ-регулируемых СУР1Л1, СУР1Л2 и уровень матричной рибонуклеиновой кислоты транскрипционных факторов Ыт/2 и ЛНК. В печени изучали также экспрессию гена СУР3Л1 и активность СУР3Л, активность иБР-глюкуронозилтрансферазы и глутатионтрансферазы. Наряду с этим в плазме крови и печени определяли общую антиоксидантную активность (АОА), уровень малонового диальдегида и гидроперекисей липидов. В печени изучали содержание восстановленного и окисленного глутатиона, общую и неседиментируемую активность лизосомальных ферментов. КВ, особенно в сочетании с КУР, повышал АОА плазмы крови и снижал содержание в ней гидроперекисей липидов. КУР и КВ не влияли на активность ХР, но при совместном поступлении вызывали возрастание активности ГО-1, не влияя существенно на экспрессию гена фермента (Нтох1) и гена Ыт/2. КУР и в меньшей степени КВ оказывали сильное индуцирующее действие на активность СУР1Л1, СУР1Л2 и СУР3А, но только активация СУР1Л1 сопровождалась индукцией гена СУР1Л1. Индуцирующее влияние КУР и КВ на активность цитохромов значительно усиливалось при их совместном действии. Мембраностабилизирующее действие

Для цитирования: Балакина А.С., Аксенов И.В., Трусов Н.В., Гусева Г.В., Авреньева Л.И., Кравченко Л.В. и др. Влияние куркумина и кверцетина на показатели защитного потенциала крыс при их раздельном и совместном действии // Вопр. питания. 2017. Т. 86. № 2. С. 14-22.

Статья поступила в редакцию 01.12.2016. Принята в печать 27.02.2017.

For citation: Balakina A.S., Aksenov I.V., Trusov N.V., Guseva G.V., Avrenyeva L.I., Kravchenko L.V., et al. The influence of separate and combined supplementation with curcumin and quercetin on the protective capacity in rats. Voprosy pitaniia [Problems of Nutrition]. 2017; 86 (2): 14-22. (in Russian)

Received 01.12.2016. Accepted for publication 27.02.2017.

КУР и КВ также было сильнее выражено при их совместном включении в рацион. Таким образом, можно заключить, что КУР и КВ, особенно в комбинации, способствуют повышению защитно-адаптационного потенциала организма. Ключевые слова: куркумин, кверцетин, Ыт/2/ЛКЕ, ЛНЕ/ХЕБ, ферменты метаболизма ксенобиотиков, ферменты антиоксидантной защиты

The purpose of the study was to determine the effects of curcumin (CUR) and quercetin (QUER) on the expression of genes and activity of prototypical Nrf2/ARE- and AhR/ XRE-regulated enzymes. Investigation was carried out on male Wistar rats with initial body weight (230-235 g b.w.) that received for 14 days CUR (200 mg/kg b.w.) and QUER (200 mg/kg b.w.) separately or in combination within the standard semi-synthetic diet. The expression of genes and activity of Nrf2/ARE - regulated enzymes - heme oxy-genase-1(HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO1), AhR/XRE-regulated CYP1A1, CYP1A2 enzymes and the mRNA level of transcription factors Nrf2 and AhR were determined in rats liver. Also the expression of gene CYP3A1 and activity of CYP3A, UDP-glucuronosyltransferase, glutathione transferase were studied in rats liver. Along with this the total antioxidant activity (AOA), malondialdehyde and lipid hydroperoxides levels were determined in blood plasma and liver. The reduced and oxidized glutathione level, total and unsedimentable activity of lysosomal enzymes were investigated in rats' liver. QUER, especially in combination with CUR, increased the AOA of blood plasma and reduced the content of lipid hydroperoxides in it. CUR and QUER did not affect NQO1 activity, but the combined action caused an increase in the HO-1 activity without affecting the expression of the corresponding gene (Hmoxl) and Nrf2 gene. CUR and, to a lesser extent QUER, had a strong inducing effect on CYP1A1, CYP1A2, CYP3A activity, but only the CYP1A1 activation was accompanied by the induction of CYP1A1 gene. The inducing effect of CUR and QUER on the activity of CYP450 enzymes greatly enhanced by their combined action. Membrane stabilizing action of CUR and QUER was also strongly expressed under its combined intake. Thus, we can conclude that CUR and QUER, especially in combination, contribute to the protective and adaptive capacity. Keywords: curcumin, quercetin, Nrf2/ARE, AhR/XRE, xenobiotic metabolizing enzymes, antioxidant enzymes

В настоящее время полагают, что основная физиологическая функция биологически активных веществ пищи полифенольной природы заключается в сохранении здоровья и снижении риска заболеваний, главным патогенетическим звеном которых является окислительный стресс. К основным механизмам, обеспечивающим защитные эффекты полифенолов, наряду с их высокой антирадикальной активностью, относят их способность взаимодействовать с двумя сигнальными системами клетки - Nrf2/ARE и AhR/ XRE [1-3]. Транскрипционный фактор Nrf2 регулирует экспрессию ARE- (антиоксидант-респонсивный элемент) содержащих генов, к которым относятся гены большинства антиоксидантных ферментов и гены многих ферментов II фазы метаболизма ксенобиотиков, имеющих важное значение для антиоксидантной защиты клетки - NAD(P)H-хиноноксидоредуктазы (ХР), гемоксигеназы-1 (ГО-1), глутатионтансфераз (ГТ), UDP-глюкуронозилтрансфераз (UDP-ГТ). Фактор AhR инициирует экспрессию генов, содержащих XRE (ксе-нобиотик-респонсивный элемент), в первую очередь генов цитохромов Р450 (CYP) семейства 1 - CYP1A1, 1А2, 1В1, а также генов ключевых ферментов II фазы метаболизма ксенобиотиков - ГТ и UDP-ГТ и генов ХР (NQO1) и ГО-1 (Hmox1).

Куркумин (КУР) - диферулоилметан, выделен из корней куркумы как ее основной биологически активный компонент. Куркума c незапамятных времен используется во многих странах Юго-Восточной Азии не только как традиционная приправа к пище, но и как лекарственное средство при лечении различных заболеваний и патологических состояний. Установление структуры и интенсивное изучение свойств КУР показали, что он обладает антиоксидантной, противовоспалительной и антиканцерогенной активностью [4, 5]. Антирадикальная активность КУР в отношении О2^-, НО^, ROO^ и NO^ сравнима с активностью кверцетина (КВ), который является одним из наиболее распространенных флаво-ноидов в растительном мире и основной составляющей суточного потребления флавоноидов человеком [6]. В условиях окислительного стресса оба полифенола проявляли способность активировать антиоксидантные ферменты и ферменты II фазы метаболизма ксенобиотиков [5, 7-9]. В исследованиях in vitro получены доказательства связи индуцирующего действия КУР и КВ на активность ферментов с их влиянием на сигнальную систему Nrf2/ARE [7, 10, 11].

В последнее время опубликованы результаты изучения комбинированного действия КУР и КВ, свидетельствующие о том, что их совместное потребление может

влиять на их фармакокинетику и усиливать их биологическую активность. Так, синергизм антиоксидантных и противовоспалительных эффектов КУР и КВ наблюдали у крыс с индуцированным каррагинаном воспалением [12]. У мышей КУР и КВ как по отдельности, так и вместе уменьшали проявления окислительного стресса, сопровождающего токсическое действие бен-запирена, причем антиоксидантная эффективность была более выражена у животных, получавших оба полифенола [9]. В экспериментах на крысах показано, что в сочетании с КВ антидиабетический потенциал КУР резко возрастал [13]. Усиление защитных эффектов КУР и КВ при их совместном поступлении наблюдали и в исследованиях in vitro на клетках карциномы желудка человека MGC-803 [14]. В то же время данные о молекулярных механизмах их комбинированного действия практически отсутствуют.

Следует отметить, что биологическая активность КУР и КВ может быть тесно связана с их способностью взаимодействовать с биологическими мембранами [15]. В исследованиях с использованием искусственных мембран и некоторых линий клеток показано, что КВ и КУР уменьшают текучесть мембран, усиливают их стабильность и защищают от окислительного стресса не только за счет антирадикального действия, но и препятствуя проникновению и взаимодействию оксидантов с липид-ным бислоем. Изменение физических свойств мембран вследствие их взаимодействия с полифенолами может сопровождаться изменением многих функций мембран, в том числе активности связанных с ними ферментов.

Цель данной работы - изучение влияния КУР и КВ при их раздельном и совместном включении в рацион крыс на активность и экспрессию генов прототипичных Nrf2/ARE- и AhR/XRE-регулируемых ферментов. В качестве показателя влияния КУР и КВ на стабильность мембран определяли неседиментируемую активность ферментов лизосом печени и резистентность микросом печени ex vivo к индуцированному перекисному окислению липидов (ПОЛ).

Материал и методы

Исследование проведено на крысах-самцах линии Вистар с исходной массой тела 230-235 г. Крысы были разделены на 4 группы по 8 животных в каждой и содержались по 2-3 особи в клетке («Techniplast», Италия). В работе придерживались нормативов содержания лабораторных животных в соответствии с Европейской конвенцией по защите позвоночных животных, используемых для экспериментальных или в иных научных целях (Страсбург, 1986 г.).

Крысы 1-й (контрольной) группы в течение 14 дней получали стандартный полусинтетический рацион,

2-й группы - тот же рацион с включением КУР (АО «ЭКО РЕСУРС», Россия) в дозе 200 мг на 1 кг массы тела,

3-й группы - рацион с включением КВ («Sigma-Aldrich», США) в той же дозе, 4-й опытной группы - рацион, содержащий КУР и КВ в дозе 200 мг на 1 кг массы тела каждого. Животные получали питьевую воду без ограничений и корм ежедневно в одно и то же время в режиме свободного доступа из расчета 15 г сухого корма на крысу. Контроль за поедаемостью корма и состоянием животных проводили ежедневно, контроль массы тела - через день.

В гомогенатах печени и плазме крови определяли содержание малонового диальдегида (МДА), гидроперекисей липидов, восстановленного и окисленного глутатиона и общую антиоксидантную активность (АОА), в микросомальной и цитозольной фракциях, выделенных из печени, определяли, соответственно, активность ГО-1 и ХР, как указано в [16]. В микросомах печени определяли активность ферментов I фазы метаболизма ксенобиотиков - этоксирезоруфинде-алкилазную (ЭРОД) активность CYP1A1, метоксире-зоруфиндеалкилазную (МРОД) активность CYP1A2 и бр-тестостеронгидроксилазную (бр-ТГ) активность CYP3A [17]. Кроме того, определяли активность ключевых ферментов II фазы: в микросомах - UDP-ГТ с п-нитрофенилом в качестве субстрата, в цитозоле -общую активность ГТ с субстратом 1-хлор-2,4-динит-робензолом [17].

Стабильность лизосомальных мембран оценивали по изменению неседиментируемой активности лизо-сомальных ферментов - арилсульфатаз, р-глюкуро-нидазы и р-галактозидазы. Общую активность ферментов лизосом определяли в гомогенатах печени, неседиментируемую - во фракции цитозоля печени и выражали в процентах от общей [18]. Для изучения влияния КУР и КВ ex vivo на резистентность микро-сом к индуцированному NADPH-Fe2+ ПОЛ использовали микросомы, выделенные из печени животных 1-4-й групп. Окислительную модификацию липидов оценивали по накоплению ТБК-реактивных продуктов ПОЛ (МДА).

Полимеразную цепную реакцию (ПЦР) с обратной транскрипцией (ОТ) в режиме реального времени проводили, как описано [19]. Последовательность праймеров представлена в табл. 1.

Таблица 1. Последовательности праймеров

Ген Нуклеотидная последовательность праймеров

Actb F CGTTGACATCCGTAAAGACCTC R TAGGAGCCAGGGCAGTAATCT

Nrf2 F GACCTAAAGCACAGCCAACACAT R CTCAATCGGCTTGAATGTTTGTC

NQO1 F GTGAGAAGAGCCCTGATTGT R CCTGTGATGTCGTTTCTGGA

Hmoxl F ACCCCACCAAGTTCAAACAG R GAGCAGGAAGGCGGTCTTAG

CYP1A1 F CCAAACGAGTTCCGGCCT R TGCCCAAACCAAAGAGAATGA

AhR F TCACTGCGCAGAATCCCACATCC R TCGCGTCCTTCTTCATCCTTAGC

CYP1A2 F CTGCAGAAAACAGTCCAGGA R GAGGGATGAGACCACCGTTG

CYP3A1 F CTGCTTTCAGCTCTCACACT R CACTCGATGCTTCTGCAC

Таблица 2. Антиоксидантная активность и маркеры окислительного стресса у крыс, получавших куркумин (КУР) и кверцетин (КВ)

Показатель Группа животных, рацион

1-я (контрольная) 2-я, +КУР 3-я, +КВ 4-я, +КУР+КВ

Плазма крови

АОА, мМ Fe^-экв. 0,39±0,01a 0,41 ±0,02a 0,66±0,02b 0,74±0,01 c

МДА, нмоль/мл 4,26±0,39 3,63±0,30 3,43±0,11 3,44±0,17

Гидроперекиси липидов, нмоль/мл 7,52±0,89a 4,91±1,33ab 6,08±1,69a 2,14±0,16b

Печень

АОА, мМ Fe2+-экв. 11,4±0,3a 11,7±0,6ab 12,5±0,3b 12,1±0,4ab

МДА, нмоль/г ткани 77,1±5,1a 76,3±2,8a 83,1 ±6,3a 60,4±3,4b

Гидроперекиси липидов, нмоль на 1 г ткани 491 ±6 477±9 477±4 455±16

Глутатион восстановленный мкмоль на 1 г ткани 5,33±0,27 5,27±0,19 5,37±0,22 5,48±0,24

Глутатион окисленный (GSSG), мкмоль на 1 г ткани 0,43±0,02 0,40±0,01 0,41 ±0,02 0,40±0,01

GSH/GSSG 12,7±1,0 13,1 ±0,6 13,3±0,9 13,9±0,7

П р и м е ч а н и е. Здесь и в табл. 3-7 различия между значениями, обозначенными разными буквами (а, Ь, с), статистически значимы (р<0,05). Расшифровку аббревиатур см. в тексте.

Таблица 3. Активность гемоксигеназы-1 и NAD(P)H-хиноноксидоредуктазы в печени крыс, получавших куркумин (КУР) и кверцетин (КВ)

Показатель Группа животных, рацион

1-я (контрольная) 2-я, +КУР 3-я, +КВ 4-я, +КУР+КВ

ГО-1, мкмоль/минхмг белка 9,35±0,37a 9,20±0,64a 10,28±0,41a 12,47±0,47b

ХР, мкмоль/минхмг белка 0,30±0,05 0,31±0,03 0,41 ±0,05 0,28±0,05

Уровни экспрессии изучаемых генов нормализовали относительно уровня экспрессии гена сравнения в-актина (Actb) и рассчитывали по значению порогового цикла (Ct - cycle threshold) с использованием программы «Relative expression software tool» (REST) v.2.0.13 (Qiagen, Германия). Данные представляли в виде средних значений (n=6), амплификацию для каждого значения проводили в 3 повторах.

Статистическую обработку результатов проводили с использованием программы IBM SPSS Statistics Ver. 20 («SPSS Inc.», США). Данные представляли в виде среднего арифметического (M) и стандартной ошибки среднего (m): M±m. Для выявления статистически значимых (р<0,05) различий между группами применяли однофакторный дисперсионный анализ с использованием в качестве апостериорного критерия LSD-теста.

Результаты и обсуждение

Включение в рацион КУР и КВ как по отдельности, так и вместе не оказывало никакого влияния на общее состояние, массу тела и относительную массу печени животных. Для оценки возможного проокси-дантного действия использованных доз КУР и КВ в плазме крови и в печени определяли АОА и уровень некоторых маркеров окислительного стресса. Как видно из данных, представленных в табл. 2, введение КУР (2-я группа) не оказывало существенного влияния на АОА плазмы крови и содержание в ней МДА, но приводило к снижению (на 35%, р>0,05) уровня гид-

роперекисей липидов. При этом не выявлено влияния КУР на такие показатели в печени, как АОА, уровни МДА и гидроперекисей липидов, на содержание восстановленного и окисленного глутатиона и их соотношение.

В отличие от КУР, в плазме крови крыс, получавших КВ (3-я группа), АОА возрастала на 70% относительно контроля (1-я группа) при одновременном уменьшении содержания гидроперекисей липидов и МДА на 19-20% (р>0,05). Введение в рацион животных КВ вызывало небольшое (на 13%, р<0,05) увеличение АОА печени и не оказывало влияние на остальные изученные показатели.

При совместном действии КУР и КВ (4-я группа) АОА плазмы крови превышала уровень контроля на 90% и была статистически значимо выше, чем АОА у животных, получавших только КУР или только КВ. Содержание гидроперекисей липидов в плазме крови крыс 4-й группы было резко снижено (до 30% от уровня контроля) и составляло 46 и 38% от уровня у крыс 2-й и 3-й групп соответственно. Совместное действие КУР и КВ в отличие от их действия по отдельности приводило к умеренному снижению в печени крыс содержания МДА (на 22%, р<0,05), но не вызывало существенных изменений остальных изученных показателей.

Как свидетельствуют результаты изучения активности ГО-1 и ХР (табл. 3), включение в рацион КУР (2-я группа) не влияло существенно на активность обоих ферментов. У крыс, получавших рацион с КВ, активность ГО-1 и ХР превышала контрольный уровень на 10 и 37% соответственно (р>0,05). При совместном введении КУР и КВ активность ГО-1 возрастала на 30% (р<0,05)

по сравнению с контролем и была выше активности у крыс 2-й группы (на 36%) и 3-й группы (на 21%). В то же время активность ХР у крыс 4-й группы не отличалась от контрольного уровня и от уровня активности у крыс 2-й группы, а отличие от активности в 3-й группе (снижение на 32%) не было статистически значимым. По данным ПЦР (рис. 1), КУР и КВ как по отдельности, так и вместе не оказывали значительного влияния на экспрессию генов Нтох1, N001 и N^2.

150 н

100-

50-

1 (К) 2 3 Hmox1

1 (К) 2 3 4 NQO1

1 (К) 2 3 4 Nrf2

Рис. 1. Относительный уровень матричной рибонуклеиновой кислоты Hmox1, матричной рибонуклеиновой кислоты NQO1, матричной рибонуклеиновой кислоты N^2 в печени крыс, получавших куркумин и кверцетин

Здесь и на рис. 2 и 3: * - статистически значимые отличия (р<0,05) от показателя 1-й (контрольной) группы (К); Д - 2-й группы; 5 - 3-й группы.

400 п 3501 300-g 250° 200150-Е 10050-

0

1 (К) 2 3 4 1 (К) 2 3 4 1 (К) 2 3 4

Рис. 2. Относительный уровень матричной рибонуклеиновой кислоты CYP1A1, матричной рибонуклеиновой кислоты CYP1A2, матричной рибонуклеиновой кислоты AhR в печени крыс, получавших куркумин и кверцетин

200 п

150-

100-

3

CL

>

О

^ 50

0

*Д8

Рис. 3. Относительный уровень матричной рибонуклеиновой кислоты CYP3A1 в печени крыс, получавших куркумин и кверцетин

Данные, представленные в табл. 4, свидетельствуют о том, что КУР обладает значительным индуцирующим действием на активность изученных изоформ цитохрома Р450. Так, активность ЭРОД превышала уровень контроля на 77% (р<0,05), активность МРОД - на 62% (р<0,05), активность 6р-ТГ - на 47% (р<0,05). В меньшей степени были выражены изменения, вызванные КВ, -активность ЭРОД возрастала на 27%, МРОД - на 49% и 6р-ТГ - на 18% (во всех случаях р<0,05). Комбинированное действие КУР и КВ (4-я группа) характеризовалось значительным усилением их индуцирующего действия. Так, активность ЭРОД возрастала на 135% относительно контроля и значительно превышала активность фермента у крыс 2-й и 3-й групп. Активность МРОД превышала уровень контроля на 140% и статистически значимо превышала активность у крыс 2-й и 3-й групп. Активность бр-ТГ у животных 4-й группы достигала 162% от контроля и также превышала активность у крыс 2-й и 3-й групп.

По данным ПЦР (рис. 2 и 3), КУР и КВ значительно индуцировали экспрессию гена CYP1A1 - в 1,8; 3,7 и 3,5 раза в печени крыс соответственно 2, 3 и 4-й групп. Несмотря на значительные изменения активности МРОД и бр-ТГ, при введении КУР и КВ по отдельности или вместе экспрессия генов этих цитохро-мов Р450 не различалась существенно между группами. Не обнаружено влияния КУР и КВ на уровень мРНК транскрипционного фактор AhR.

Что касается ключевых ферментов II фазы метаболизма ксенобиотиков - UDP-ГТ и ГТ, их активность согласно данным, представленным в табл. 4, проявляла значительно меньшую чувствительность к действию КУР и КВ. Так, активность UDP-ГТ при введении КУР и КВ возрастала на 35% (р<0,05) у крыс 2-й группы, на 23% (р>0,05) - у крыс 3-й группы и на 40% (р<0,05) - у крыс 4-й группы. Не обнаружено существенной разницы в общей активности ГТ между группами.

Следует отметить, что включение в рацион КУР и в большей степени КВ оказывало стабилизирующее действие на мембраны лизосом, что проявлялось в снижении неседиментируемой активности ферментов лизосом (табл. 5). Этот эффект КУР и КВ усиливался при их комбинированном действии. Так, неседименти-руемая активность арилсульфатаз снижалась у крыс 2, 3 и 4-й групп соответственно на 10 (р>0,05), 28 (р<0,05) и 67% (р<0,05); активность р-галактозидазы - на 25, 38 и 54% (р<0,05); активность p-глюкуронидазы - на 32, 28 и 62% (р<0,05).

Результаты изучения влияния введения в рацион КУР и КВ ex vivo на NADPH-Fe2+-индуцированное ПОЛ микросом, выделенных из печени экспериментальных животных, также подтверждают мембранопротекторное действие КУР и КВ, которое усиливалось при их совместном действии (табл. 6). Образование МДА в результате индукции ПОЛ снижалось в микросомах печени крыс 2, 3 и 4-й групп соответственно на 22, 24 (р<0,05) и 33% (р<0,05).

0

4

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

А

Таблица 4. Активность ферментов метаболизма ксенобиотиков в печени крыс, получавших куркумин (КУР) и кверцетин (КВ)

Показатель Группа животных, рацион

1-я (контрольная) 2-я, +КУР 3-я, +КВ 4-я, +КУР+КВ

ЭРОД ^Р1А1), пмоль/минхмг белка 2,75±0,36a 4,87±0,66bc 3,48±0,36ab 6,45±0,75c

МРОД ^Р1А2), пмоль/минхмг белка 29,2±2,6a 47,2±6,5b 43,5±6,6ab 70,2±3,2c

6р-ТГ ^Р3А), нмоль/минхмг белка 0,34±0,04a 0,50±0,05b 0,40±0,06ab 0,55±0,07b

UDP-ГТ, нмоль/минхмг белка 9,4±0,8a 12,7±0,6b 11,6±1,3ab 13,2±1,0b

ГТ, мкмоль/минхмг белка 0,75±0,03 0,81 ±0,04 0,86±0,04 0,80±0,003

Таблица 5. Неседиментируемая активность лизосомальных ферментов в печени крыс, получавших куркумин (КУР) и кверцетин (КВ) в составе рациона, % от общей активности

Показатель Группа животных, рацион

1-я (контрольная) 2-я, +КУР 3-я, +КВ 4-я, +КУР+КВ

Арилсульфатазы А и В 7,92±0,62a 7,08±0,57a 5,68±0,25b 5,29±0,29b

р-Галактозидаза 10,20±0,50a 7,60±0,79b 6,25±0,80ьс 5,50±0,50с

Р-Глюкуронидаза 6,64±0,17a 4,49±0,38b 4,77±0,15b 4,11±0,37b

Таким образом, полученные результаты показали, что при включении в рацион крыс даже в больших количествах КУР и КВ не проявляли прооксидантные свойства. При этом в использованной дозе КВ приводил к значительному возрастанию АОА плазмы крови и уменьшению в ней количества гидроперекисей ли-пидов, что, вероятнее всего, связано с возрастанием в крови уровня метаболитов КВ, обладающих высокой антиоксидантной активностью [20, 21]. Важно отметить, что антиоксидантные эффекты КВ и КУР усиливались при их совместном действии. Эти результаты хорошо согласуются с данными литературы об усилении и синергизме антиоксидантной и противовоспалительной активности КУР и КВ при воспалении, инициированном каррагинаном у крыс, и при окислительном стрессе, индуцированном бензапиреном у мышей [9, 12]. Усиление защитного действия КУР и КВ при их совместном введении наблюдали и в исследованиях in vitro [14].

Как уже отмечалось, защитные эффекты полифенолов в значительной степени связывают с их способностью активировать систему Nrf2/ARE, играющую центральную роль в адаптивных ответах клетки на окислительный стресс и цитотоксические воздействия. Изучение активности и экспрессии генов руемых ферментов показало, что только при комбинированном действии КУР и КВ умеренно возрастала активность ГО-1. В ряде исследований было показано, что в условиях окислительного стресса антиоксидантное и противовоспалительное действие КУР и КВ связано непосредственно с их способностью индуцировать активность ГО-1 [12, 22, 23]. Многие авторы отмечают, что активность ГО-1 является одним из самых чувствительных индикаторов клеточного повреждения и индукция ее приводит к усилению защитных функций клетки, тем самым определяя степень способности последней к выживанию [2, 3].

Результаты изучения молекулярных механизмов индуцирующего действия КУР и КВ на активность ГО-1,

Таблица 6. Влияние куркумина (КУР) и кверцетина (КВ) ex vivo на NADPH-Fe^-индуцированное перекисное окисление липидов микросом

Группа животных, рацион МДА, нмоль/мг белка за 10 мин

1-я (контрольная) 11, 5±1,1 a

2-я, +КУР 9,0±1,0a

3-я, +КВ 8,7±0,8b

4-я, +КУР+КВ 7,7±0,7b

полученные в исследованиях in vitro, свидетельствуют о том, что оно опосредовано главным образом их активирующим влиянием на транскрипционный фактор Nrf2 [24, 25]. В отличие от данных, полученных в исследованиях in vitro, наши исследования, проведенные на здоровых интактных крысах, не выявили существенного влияния КУР и КВ как по отдельности, так и совместно на экспрессию мРНК Hmoxl и мРНК Nrf2.

Отдельного внимания заслуживают полученные в настоящей работе данные о выраженном индуцирующем влиянии КУР и в меньшей степени КВ на активность цитохромов Р450 подсемейств 1А и 3А. Основные функции CYP1A, отличающихся широкой субстратной специфичностью и экспрессией во многих органах и тканях, - биотрансформация и детоксикация ксенобиотиков и метаболизм небольшого числа лекарственных средств (ЛС). Индуцибельность CYP1A является их важнейшим свойством, которое в значительной степени определяет способность организма к адаптации при воздействии чужеродных соединений. Главный механизм индукции CYP1A - транскрипционный, связанный с лиганд-зависимой активацией рецептора Ah (AhR), хотя для CYP1A2 характерны и посттранскрипционные механизмы (например, стабилизация мРНК и ферментного белка) [26, 27].

В наших исследованиях введение в рацион КУР и КВ существенно индуцировало ЭРОД-активность CYP1A1

и МРОД-активность CYP1A2, и эта индукция значительно усиливалась при совместном включении КУР и КВ. Многократное увеличение при этом экспрессии гена CYP1A1 свидетельствует о транскрипционном механизме индуцирующего действия КУР и КВ на активность CYP1A1. Активация МРОД не сопровождалась значительными изменениями экспрессии гена CYP1A2, что, возможно, указывает на посттранскрипционный механизм активирующего влияния КУР и КВ на CYP1A2. Наши данные хорошо согласуются с результатами, полученными в исследованиях in vitro. Так, в культуре клеток адено-карциномы молочной железы человека MCF-7 КУР и КВ активировали фактор AhR, индуцировали экспрессию мРНК CYP1A1 и активность ЭРОД. Также в исследованиях in vitro получены доказательства наличия у КВ и КУР свойств лигандов AhR [28-30].

В суперсемействе CYP450 особое положение занимает подсемейство CYP3A, на долю которого приходится 30-40% от всех изоформ цитохрома Р450 в печени и 80% - в кишечнике. Установлено, что CYP3A участвуют в метаболизме 50-60% ЛС и, таким образом, являются одним из факторов, определяющих действие ЛС, лекарственные взаимодействия и взаимодействия ЛС и пищевых веществ [31].

Так же как активность ЭРОД и МРОД активность 6р-ТГ (CYP3A) возрастала почти в 1,5 раза в печени крыс, получавших КУР, и еще в большей степени у крыс, по-

лучавших КУР совместно с КВ. Индуцирующее влияние КУР и КВ на активность CYP3A показано в исследованиях как in vivo, так и in vitro [32, 33]. По данным [34], КУР индуцирует активность CYP3A на транскрипционном уровне, активируя фактор PXR, занимающий ключевое место в сигнальной системе регуляции CYP3A. В наших исследованиях не обнаружено значительного влияния КУР и КВ на экспрессию гена CYP3A, за исключением небольшого увеличения уровня мРНК CYP3A у крыс при совместном включении в рацион полифенолов.

И наконец, получены данные, подтверждающие мем-браностабилизирующие свойства КУР и КВ, усиливающиеся при их совместном действии. Стабилизирующее действие КВ и КУР на мембраны лизосом показано в наших предыдущих исследованиях и в единичных сообщениях других авторов [35-37].

Таким образом, можно заключить, что большие, но безопасные дозы КУР и КВ в составе рациона крыс в существенной степени индуцируют активность ключевых ферментов I и II фазы метаболизма ксенобиотиков и проявляют мембранопротекторные свойства, способствуя повышению защитно-адаптационного потенциала организма. Настоящая работа - одна из первых, показавших возможность усиления индуцирующего влияния КУР и КВ на активность ферментов метаболизма ксенобиотиков и потенцирования их антиоксидантных и мембранных эффектов при совместном воздействии.

Сведения об авторах

ФГБУН «ФИЦ питания и биотехнологии» (Москва):

Балакина Анастасия Станиславовна - младший научный сотрудник лаборатории энзимологии питания E-mail: balakina.a.s@yandex.ru

Аксенов Илья Владимирович - кандидат медицинских наук, старший научный сотрудник лаборатории энзимологии питания

E-mail: aksenov@ion.ru

Трусов Никита Вячеславович - научный сотрудник лаборатории энзимологии питания E-mail: nikkitosu@yandex.ru

Гусева Галина Владимировна - кандидат биологических наук, научный сотрудник лаборатории энзимологии питания E-mail: mailbox@ion.ru

Авреньева Людмила Ивановна - кандидат медицинских наук, старший научный сотрудник лаборатории энзимо-

логии питания

E-mail: avrenyeva@ion.ru

КравченкоЛидия Васильевна - кандидат медицинских наук, ведущий научный сотрудник лаборатории энзимологии питания

E-mail: kravchenko@ion.ru

Тутельян Виктор Александрович - академик РАН, доктор медицинских наук, профессор, заведующий лабораторией энзимологии питания, научный руководитель E-mail: tutelyan@ion.ru

Литература

действия ксенобиотиков и элктрофильных соединений // Биохимия. 2013. Т. 78, № 2. С. 147-166. Furfaro A.L., Traverso N., Domenicotti C. et al. The Nrf2/HO axis in cancer cell growth and chemoresistance // Oxid. Med. Cell. Lon-gev. 2016. Article ID 1958174. 14 p.

1. Kohle C., Bock K.W. Coordinate regulation of Phase I and II xenobi-otic metabolisms by the Ah receptor and Nrf2 // Biochem. Pharmacol. 2007. Vol. 73, N 12. P. 1853-1862. 3.

2. Турпаев К.Т. Сигнальная система Keap1-Nrf2. Механизм регуляции и значение для защиты клеток от токсического

4. Schaffer M., Schaffer P.M., Bar-Sela G. An update on Curcuma as a functional food in the control of cancer and inflammation // Curr. Opin. Clin. Nutr. Metab. Care. 2015. Vol. 18, N 6. P. 605-611.

5. Casas-Grajales S., Muriel P. Antioxidants in liver health // World J. Gastrointest. Pharmacol. Ther. 2015. Vol. 6, N 3. P. 59-72.

6. Тутельян В.А., Лашнева Н.В. Биологически активные вещества растительного происхождения. Флавонолы и флавоны: распространенность, пищевые источники, потребление // Вопр. питания. 2013. Т. 82, № 1. С. 4-22.

7. Das L., Vinayak M. Long term effect of curcumin in restoration of tumour suppressor p53 and phase-II antioxidant enzymes via activation of Nrf2 signalling and modulation of inflammation in prevention of cancer // PLoS One. 2015. Vol. 10, N 4. Article ID e0124000.

8. Ali F., Rahul, Jyoti S. et al. Protective role of curcumin against N-nitrosodiethylamine (NDEA)-induced toxicity in rats // Sci. Pharm. 2016. Vol. 84, N 2. P. 361-377.

9. Liu Y., Wu Y.M., Zhang P.Y. Protective effects of curcumin and quercetin during benzo(a)pyrene induced lung carcinogenesis in mice // Eur. Rev. Med. Pharmacol. Sci. 2015. Vol. 19, N 9. P. 17361743.

10. Lee Y.J., Lee D.M., Lee S.H. Nrf2 expression and apoptosis in quercetin-treated malignant mesothelioma cells // Mol. Cells. 2015. Vol. 38, N 5. P. 416-425.

11. Dai C., Li B., Zhou Y. et al. Curcumin attenuates quinocetone induced apoptosis and inflammation via the opposite modulation of Nrf2/HO-1 and NF-kB pathway in human hepatocyte L02 cells // Food Chem. Toxicol. 2016. Vol. 95. P. 52-63.

12. Heeba G.H., Mahmoud M.E., El Hanafy A.A. Anti-inflammatory potential of curcumin and quercetin in rats: role of oxidative stress, heme oxygenase-1 and TNF-a // Toxicol. Ind. Health. 2014. Vol. 30, N 6. P. 551-560.

13. Kaur G., Invally M., Chintamaneni M. Influence of piperine and quer-cetin on antidiabetic potential of curcumin // J. Complement. Integr. Med. 2016. Vol. 13, N 1. P. 247-255.

14. Zhang J.Y., Lin M.T., Zhou M.J. et al. Combinational treatment of curcumin and quercetin against gastric cancer MGC-803 cells in vitro // Molecules. 2015. Vol. 20, N 6. P. 11 524-11 534.

15. Margina D., Gradinaru D., Manda G., et al. Membranar effects exerted in vitro by polyphenols - quercetin, epigallocate-chin gallate and curcumin - on HUVEC and Jurkat cells, relevant for diabetes mellitus // Food Chem. Toxicol. 2013. Vol. 61. P. 86-93.

16. Балакина А.С., Трусов Н.В., Авреньева Л.И. и др. Влияние рутина и гесперидина на экспрессию гена Nrf2 и активность гемоксигеназы-1 и NAD(P)H-хиноноксидоредуктазы при их раздельном и совместном действии // Вопр. питания. 2016. Т. 85, № 3. С. 18-26.

17. Кравченко Л.В., Аксенов И.В., Трусов Н.В. и др. Влияние жира в рационе на активность ферментов метаболизма ксенобиотиков и антиоксидантной защиты у крыс // Вопр. питания. 2012. Т. 81, № 1. С. 24-29.

18. Дингл Дж. Лизосомы. Методы исследования. М. : Мир, 1980. 342 с.

19. Балакина А.С., Трусов Н.В., Аксенов И.В. и др. Влияние рутина и гесперидина на экспрессию гена Nrf2- и AhR- контролируемых генов и гена CYP3A1 у крыс при остром токсическом действии четыреххлористого углерода // Вопр. питания. 2016. Т. 85, № 6. С. 28-35.

20. Egert S., Wolffram S., Bose-Westphal A. et al. Daily quercetin supplementation dose-dependently increases plasma quercetin concentrations in healthy humans // J. Nutr. 2008. Vol. 138, N 9. P. 1615-1621.

21. Ishizawa K., Yoshizumi M., Kawai Y. et al. Pharmacology in health food: metabolism of quercetin in vivo and its protective effect against arteriosclerosis // J. Pharmacol. Sci. 2011. Vol. 115, N 4. P. 466-470.

22. Farombi E.O., Shrotriya S., Na H.K., et al. Curcumin attenuates dimethylnitrosamine-induced liver injury in rats through Nrf2-medi-ated induction of heme oxygenase-1 // Food Chem. Toxicol. 2008. Vol. 46. P. 1279-1287.

23. Liu C.M., Ma J.Q., Xie W.R. et al. Quercetin protects mouse liver against nickel-induced DNA methylation and inflammation associated with the Nrf2/HO-1 and p38/STAT1/NF-KB pathway // Food Chem. Toxicol. 2015. Vol. 82. P. 19-26.

24. Ji L.L., Sheng Y.C., Zheng Z.Y. et al. The involvement of p62-Keap1-Nrf2 antioxidative signaling pathway and JNK in the protection of natural flavonoid quercetin against hepatotoxicity // Free Radic. Biol. Med. 2015. Vol. 85. P. 12-23.

25. Balogun E., Hoque M., Gong P. et al. Curcumin activates the haem oxygenase-1 gene via regulation of Nrf2 and the antioxidant-respon-sive element // Biochem. J. 2003. Vol. 371. P. 887-895.

26. Михайлова О.Н., Филипенко М.Л., Тимофеева О.А. и др. Уровень мРНК и активность цитохромов Р450 1А в печени мышей линии C57BL при индукции различными ксенобиотиками. // Биомед. химия. 2003. Т. 49, № 4. С. 388-393.

27. Nebert D.W., Dalton T.P., Okey A.B., Gonzalez F.J. Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer // J. Biol. Chem. 2004. Vol. 279, N 23. P. 23 847-23 850.

28. Ciolino H.P., Daschner P.J., Wang T.T., Yeh G.C. Effect of curcumin on the aryl hydrocarbon receptor and cytochrome P450 1A1 in MCF-7 human breast carcinoma cells // Biochem. Pharmacol. 1998. Vol. 56, N 2. P. 197-206.

29. Ciolino H.P., Daschner P.J., Yeh G.C. Dietary flavonols quercetin and kaempferol are ligands of the aryl hydrocarbon receptor that affect CYP1A1 transcription differentially // Biochem. J. 1999. Vol. 340, N 3. P. 715-722.

30. Vrba J., Kren V., Vacek J. et al. Quercetin, quercetin glycosides and taxifolin differ in their ability to induce AhR activation and CYP1A1 expression in HepG2 cells // Phytother. Res. 2012. Vol. 26, N 11. P. 1746-1752.

31. Basheer L., Kerem Z. Interactions between CYP3A4 and Dietary Polyphenols // Oxid. Med. Cell. Longev. 2015. doi: 10.1155/2015/854015.

32. Hsieh Y.W., Huang C.Y., Yang S.Y. et al. Oral intake of curcumin markedly activated CYP 3A4: in vivo and ex-vivo studies // Sci. Rep. 2014. Vol. 4, N 6587. doi: 10.1038/srep06587.

33. Yu C.P., Wu P.P., Hou Y.C. et al. Quercetin and rutin reduced the bioavailability of cyclosporine from Neoral, an immunosuppressant, through activating P-glycoprotein and CYP 3A4 // J. Agric. Food Chem. 2011. Vol. 59, N 9. P. 4644-4648.

34. Kluth D., Banning A., Paur I. et al. Modulation of pregnane X receptor- and electrophile responsive element-mediated gene expression by dietary polyphenolic compounds // Free Radic. Biol. Med. 2007. Vol. 42, N 3. P. 315-325.

35. Кравченко Л.В., Авреньева Л.И., Аксенов И.В и др. Изучение влияния рутина на защитный потенциал крыс // Вопр. питания. 2015. Т. 84. № 3. С. 22-30.

36. Nirmala C., Puvanakrishnan R. Protective role of curcumin against isoproterenol induced myocardial infarction in rats // Mol. Cell. Bio-chem. 1996. Vol. 159, N 2. P. 85-93.

37. Stanely Mainzen Prince P., Priva S. Preventive effects of rutin on lysosomal enzymes in isoproterenol induced cardio toxic rats: biochemical, histological and in vitro evidences // Eur. J. Pharmacol. 2010. Vol. 649, N 1-3. P. 229-235.

References

1. Kohle C., Bock K.W. Coordinate regulation of Phase I and II xenobi-otic metabolisms by the Ah receptor and Nrf2. Biochem Pharmacol. 2007; 73 (12): 1853-62.

Turpaev K.T. Keapl-Nrf2 signaling pathway: mechanisms of regulation and role in protection of cells against toxicity caused by xeno-biotics and electrophiles. Biokhimiya [Biochemistry]. 2013; 78 (2): 147-66. (in Russian)

2.

3. Furfaro A.L., Traverso N., Domenicotti C., et al. The Nrf2/HO axis in cancer cell growth and chemoresistance. Oxid Med Cell Longev. 2016: 14 p. Article ID 1958174.

4. Schaffer M., Schaffer P.M., Bar-Sela G. An update on Curcuma as a functional food in the control of cancer and inflammation. Curr Opin Clin Nutr Metab Care. 2015; 18 (6): 605-11.

5. Casas-Grajales S., Muriel P. Antioxidants in liver health. World J Gastrointest Pharmacol Ther. 2015; 6 (3): 59-72.

6. Tutel'ian V.A., Lashneva N.V. Biological active substances of plant origin. Flavanones: dietary sources, biovailability, the influence on xenobiotic metabolizing enzymes. Voprosy pitaniia [Problems of Nutrition]. 2011; 80 (5): 4-22. (in Russian)

7. Das L., Vinayak M. Long term effect of curcumin in restoration of tumour suppressor p53 and phase-II antioxidant enzymes via activation of Nrf2 signalling and modulation of inflammation in prevention of cancer. PLoS One. 2015; 10 (4): e0124000.

8. Ali F., Rahul, Jyoti S., et al. Protective role of curcumin against N-nitrosodiethylamine (NDEA)-induced toxicity in rats. Sci Pharm. 2016; 84 (2): 361-77.

9. Liu Y., Wu Y.M., Zhang P.Y. Protective effects of curcumin and quer-cetin during benzo(a)pyrene induced lung carcinogenesis in mice. Eur Rev Med Pharmacol Sci. 2015; 19 (9): 1736-43.

10. Lee Y.J., Lee D.M., Lee S.H. Nrf2 expression and apoptosis in quer-cetin-treated malignant mesothelioma cells. Mol Cells. 2015; 38 (5): 416-25.

11. Dai C., Li B., Zhou Y., et al. Curcumin attenuates quinocetone induced apoptosis and inflammation via the opposite modulation of Nrf2/HO-1 and NF-kB pathway in human hepatocyte L02 cells. Food Chem Toxicol. 2016; 95: 52-63.

12. Heeba G.H., Mahmoud M.E., El Hanafy A.A. Anti-inflammatory potential of curcumin and quercetin in rats: role of oxidative stress, heme oxygenase-1 and TNF-a. Toxicol Ind Health. 2014; 30 (6): 551-60.

13. Kaur G., Invally M., Chintamaneni M. Influence of piperine and quer-cetin on antidiabetic potential of curcumin. J Complement Integr Med. 2016; 13 (1): 247-55.

14. Zhang J.Y., Lin M.T., Zhou M.J., et al. Combinational treatment of curcumin and quercetin against gastric cancer MGC-803 cells in vitro. Molecules. 2015; 20 (6): 11 524-34.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

15. Margina D., Gradinaru D., Manda G., et al. Membranar effects exerted in vitro by polyphenols - quercetin, epigallocatechin gallate and curcumin - on HUVEC and Jurkat cells, relevant for diabetes mellitus. Food Chem Toxicol. 2013; 61: 86-3.

16. Balakina A.S., Trusov N.V., Avreneva L.I., et al. Effect of rutin and hesperidin on the expression of Nrf2 gene and the activity of heme oxygenase-1 and NAD(P)H-quinone oxidoreductase at their separate and combined action. Voprosy pitaniia [Problems of Nutrition]. 2016; 85 (3): 18-26. (in Russian)

17. Kravchenko L.V., Aksenov I.V., Trusov N.V., et al. Effects of dietary fat level on the xenobiotic metabolizing enzymes and antioxidant enzymes in rats. Voprosy pitaniia [Problems of Nutrition]. 2012; 81 (1): 24-9. (in Russian)

18. Dingle J.T. Lysosomes: a laboratory handbook. Amsterdam: North-Holland Publ., 1977: 342 p.

19. Balakina A.S., Trusov N.V., Aksenov I.V., et al. The effect of rutin and hesperidin on the expression of Nrf2- and AhR- regulated genes and CYP3A1 gene in rats intoxicated with carbon tetrachloride. Voprosy pitaniia [Problems of Nutrition]. 2016; 85 (5): 28-35. (in Russian)

20. Egert S., Wolffram S., Bose-Westphal A., et al. Daily quercetin supplementation dose-dependently increases plasma quercetin concentrations in healthy humans. J Nutr. 2008; 138 (9): 1615-21.

21. Ishizawa K., Yoshizumi M., Kawai Y., et al. Pharmacology in health food: metabolism of quercetin in vivo and its protective effect against arteriosclerosis. J Pharmacol Sci. 2011; 115 (4): 466-70.

22. Farombi E.O., Shrotriya S., Na H.K., et al. Curcumin attenuates dimethylnitrosamine-induced liver injury in rats through Nrf2-medi-ated induction of heme oxygenase-1. Food Chem Toxicol. 2008; 46: 1279-87.

23. Liu C.M., Ma J.Q., Xie W.R., et al. Quercetin protects mouse liver against nickel-induced DNA methylation and inflammation associated with the Nrf2/HO-1 and p38/STAT1/NF-KB pathway. Food Chem Toxicol. 2015; 82: 19-26.

24. Ji L.L., Sheng Y.C., Zheng Z.Y., et al. The involvement of p62-Keap1-Nrf2 antioxidative signaling pathway and JNK in the protection of natural flavonoid quercetin against hepatotoxicity. Free Radic Biol Med. 2015; 85: 12-23.

25. Balogun E., Hoque M., Gong P., et al. Curcumin activates the haem oxygenase-1 gene via regulation of Nrf2 and the antioxidant-respon-sive element. Biochem J. 2003; 371: 887-95.

26. Mikhailova O.N., Filipenko M.L., Timofeeva O.A., et al. The mRNA level and the activity of the cytochrome P450 1A in liver of C57BL mice during induction with different xenobiotics. Biomeditsins-kaya khimiya [Biomedical Chemistry]. 2003; 49 (4): 388-93. (in Russian)

27. Nebert D.W., Dalton T.P., Okey A.B., Gonzalez F.J. Role of aryl hydrocarbon receptor-mediated induction of the CYP1 enzymes in environmental toxicity and cancer. J Biol Chem. 2004; 279 (23): 23 847-50.

28. Ciolino H.P., Daschner P.J., Wang T.T., Yeh G.C. Effect of curcumin on the aryl hydrocarbon receptor and cytochrome P450 1A1 in MCF-7 human breast carcinoma cells. Biochem Pharmacol. 1998; 56 (2): 197-206.

29. Ciolino H.P., Daschner P.J., Yeh G.C. Dietary flavonols quercetin and kaempferol are ligands of the aryl hydrocarbon receptor that affect CYP1A1 transcription differentially. Biochem J. 1999; 340 (3): 715-22.

30. Vrba J., Kren V., Vacek J., et al. Quercetin, quercetin glycosides and taxifolin differ in their ability to induce AhR activation and CYP1A1 expression in HepG2 cells. Phytother Res. 2012; 26 (11): 1746-52.

31. Basheer L., Kerem Z. Interactions between CYP3A4 and Dietary Polyphenols. Oxid Med Cell Longev. 2015. doi: 10.1155/2015/854015.

32. Hsieh Y.W., Huang C.Y., Yang S.Y., et al. Oral intake of curcumin markedly activated CYP 3A4: in vivo and ex-vivo studies. Sci Rep. 2014; 4 (6587). doi: 10.1038/srep06587.

33. Yu C.P., Wu P.P., Hou Y.C., et al. Quercetin and rutin reduced the bioavailability of cyclosporine from Neoral, an immunosuppressant, through activating P-glycoprotein and CYP 3A4. J Agric Food Chem. 2011; 59 (9): 4644-8.

34. Kluth D., Banning A., Paur I., et al.. Modulation of pregnane X receptor- and electrophile responsive element-mediated gene expression by dietary polyphenolic compounds. Free Radic Biol Med. 2007; 42 (3): 315-25.

35. Kravchenko L.V., Avren'eva L.I., Aksenov I.V., et al. Effects of rutin on protective capacity in rats. Voprosy pitaniia [Problems of Nutrition]. 2015; 84 (3): 22-30. (in Russian)

36. Nirmala C., Puvanakrishnan R. Protective role of curcumin against isoproterenol induced myocardial infarction in rats. Mol Cell Bio-chem. 1996; 159 (2): 85-93.

37. Stanely Mainzen Prince P., Priva S. Preventive effects of rutin on lysosomal enzymes in isoproterenol induced cardio toxic rats: biochemical, histological and in vitro evidences. Eur J Pharmacol. 2010; 649 (1-3): 229-35.

i Надоели баннеры? Вы всегда можете отключить рекламу.