Научная статья на тему 'Indel-типирование штаммов Vibrio cholerae'

Indel-типирование штаммов Vibrio cholerae Текст научной статьи по специальности «Медицина и здравоохранение»

CC BY
31
6
Поделиться
Ключевые слова
ХОЛЕРА / CHOLERA / VIBRIO CHOLERAE / INDEL / ГЕНОТИПИРОВАНИЕ / GENOTYPING

Аннотация научной статьи по медицине и здравоохранению, автор научной работы — Водопьянов Алексей Сергеевич, Водопьянов Сергей Олегович, Олейников Игорь Павлович, Мишанькин Борис Николаевич

Цель исследования состояла в INDEL-типировании штаммов холерного вибриона по 9 локусам. Мы идентифицировали 26 генотипов среди 223 изученных штаммов. На основе кластерного анализа все генотипы сгруппированы в 8 кластеров. При этом токсигенные штаммы, которые имели генотипы, отличающиеся от генотипов атоксигенных штаммов, сформировали отдельный кластер. Все штаммы V. cholerae O1 Eltor, выделенные в 1929-2014 гг., имели идентичный генотип, отличающийся как от штаммов классического биовара, так и от штаммов серогруппы О139. Показано, что утрата гена холерного токсина не приводит к смене INDEL-генотипа. Это позволяет рекомендовать данный метод генотипирования для выявления штаммов, имевших в прошлом ген холерного токсина. Установлено, что при ежегодном выделении штаммов из объектов окружающей среды их популяция характеризуется высоким уровнем генетического разнообразия. Это позволяет предложить использование индекса разнообразия в качестве одного из критериев оценки эпидемиологического риска.

Похожие темы научных работ по медицине и здравоохранению , автор научной работы — Водопьянов Алексей Сергеевич, Водопьянов Сергей Олегович, Олейников Игорь Павлович, Мишанькин Борис Николаевич,

INDEL-GENOTYPING OF VIBRIO CHOLERAE STRAINS

The aim of this work was to genotype Vibrio cholerae strains, based on 9 INDEL-markers. We identified 26 genotypes in 223 strains studied. Based on the cluster analysis, all genotypes were grouped into 8 clusters. A geographic attachment to specific regions was characteristic for some of the clusters. Toxigenic strains formed a separate cluster and have genotypes different from atoxigenic strains. All strains V cholerae O1 Eltor, isolated from 1929 to 2014, had an identical genotype, different from the genotypes of V. cholerae O1 classical and V. cholerae O139. A loss of cholera toxin gene was shown to fail to give rise in the alteration of INDEL-genotype. This allows us recommend this genotyping method for the identification strains that had a cholera toxin gene in the past. Under annual isolation of strains of V. cholerae from environmental objects, their population was established to be particular due to a high level of genetic diversity. This makes it possible to propose the use of the diversity index as one of the criteria for the assessment of epidemiological risk.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Текст научной работы на тему «Indel-типирование штаммов Vibrio cholerae»

ORIGINAL ARTICLE

© КОЛЛЕКТИВ АВТОРОВ, 2017 УДК 579.843.1:579.253].083.1

Водопьянов А.С., Водопьянов С.О., ОлейниковИ.П., Мишанькин Б.Н.

INDEL-ТИПИРОВАНИЕ ШТАММОВ VIBRIO CHOLERAE

ФКУЗ «Ростовский-на-Дону противочумный институт» Роспотребнадзора, 344002, г. Ростов-на-Дону, Россия, ул. М. Горького, д. 117

Цель исследования состояла в INDEL-типировании штаммов холерного вибриона по 9 локусам. Мы идентифицировали 26 генотипов среди 223 изученных штаммов. На основе кластерного анализа все генотипы сгруппированы в 8 кластеров. При этом токсигенные штаммы, которые имели генотипы, отличающиеся от генотипов атоксигенных штаммов, сформировали отдельный кластер. Все штаммы V. cholerae O1 Eltor, выделенные в 1929-2014 гг., имели идентичный генотип, отличающийся как от штаммов классического биовара, так и от штаммов серогруппы О139. Показано, что утрата гена холерного токсина не приводит к смене INDEL-генотипа. Это позволяет рекомендовать данный метод генотипирования для выявления штаммов, имевших в прошлом ген холерного токсина. Установлено, что при ежегодном выделении штаммов из объектов окружающей среды их популяция характеризуется высоким уровнем генетического разнообразия. Это позволяет предложить использование индекса разнообразия в качестве одного из критериев оценки эпидемиологического риска. Ключевые слова: холера; Vibrio cholerae; INDEL; генотипирование.

Для цитирования: Водопьянов А.С., Водопьянов С.О., Олейников И.П., Мишанькин Б.Н. INDEL-типирование штаммов Vibrio cholerae. Эпидемиология и инфекционные болезни. 2017; 22 (4): 195-200. DOI: http://dx.doi.org/10.18821/1560-9529-2017-22-4-195-200 Vodop'yanovA.S., Vodop'yanovS.O., OleynikovI.P., Mishan'kinB.N. INDEL-GENOTYPING OF VIBRIO CHOLERAE STRAINS

Rostov-on-Don Anti-Plague Institute, Federal Service for Consumer Rights Protection and Human Welfare Supervision, 117, Gorky Street, Rostov-on-Don, 344002, Russian Federation

The aim of this work was to genotype Vibrio cholerae strains, based on 9 INDEL-markers. We identified 26 genotypes in 223 strains studied. Based on the cluster analysis, all genotypes were grouped into 8 clusters. A geographic attachment to specific regions was characteristic for some of the clusters. Toxigenic strains formed a separate cluster and have genotypes different from atoxigenic strains. All strains V cholerae O1 Eltor, isolated from 1929 to 2014, had an identical genotype, different from the genotypes of V. cholerae O1 classical and V. cholerae O139. A loss of cholera toxin gene was shown to fail to give rise in the alteration of INDEL-genotype. This allows us recommend this genotyping method for the identification strains that had a cholera toxin gene in the past. Under annual isolation of strains of V. cholerae from environmental objects, their population was established to be particular due to a high level ofgenetic diversity. This makes it possible to propose the use of the diversity index as one of the criteria for the assessment of epidemiological risk.

Keywords: cholera; Vibrio cholerae; INDEL; genotyping.

For citation: Vodop'yanov A.S., Vodop'yanov S.O., Oleynikov I.P., Mishan'kin B.N. Indel-genotyping of Vibrio cholerae strains. Epidemiologiya i Infektsionnye Bolezni. Epidemiology and infectious diseases (Russian Journal). 2017; 22 (4): 195-200. (In Russ.). DOI: http://dx.doi.org/10.1882/1560-9529-2017-22-4-195-200

For correspondence: Aleksey S. Vodop'yanov, MD, PhD, head of the virology group of the Rostov-on-Don Anti-Plague Institute, Federal Service for Consumer Rights Protection and Human Welfare Supervision, 117, Gorky Street, Rostov-on-Don, 344002, Russian Federation. E-mail: alexvod@gmail.com

Conflict of interest. The authors declare no conflict of interest.

Acknowledgement. The study had no sponsorship.

Received 19.04.2017 Accepted 20.07.2017

Выявление различных генетических маркеров у штаммов холерных вибрионов является полезным приемом при проведении эпидемиологических расследований, дающим возможность выявлять связи между различными изолятами, что в свою очередь позволяет делать выводы об источниках завозов возбудителя на конкретную территорию [1]. При этом в последнее десятилетие определение кратности 5 локусов вариабельных тандемных

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Для корреспонденции: Водопьянов Алексей Сергеевич, канд. мед. наук, руководитель группы вирусологии ФКУЗ «Ростовский-на-Дону противочумный институт» Роспотребнадзора, e-mail: alexvod@gmail.com

повторов стало фактически стандартом генотипирования штаммов Vibrio cholerae [2—4]. Вместе с тем при VNTR-типировании ряда других возбудителей особо опасных инфекций используется более широкий набор локусов. Так, для геноти-пирования возбудителя туляремии используется определение кратности 25 [5], а для возбудителя чумы - 42 VNTR-локуса [6], что делает актуальными работы по поиску новых генетических маркеров, пригодных для проведения быстрого анализа штаммов возбудителя холеры.

Одним из перспективных способов генотипирования является метод INDEL-типирования, основанный на определении вставок-делеций (IN-

Эпидемиология и инфекционные болезни. 2017; 22(4)

DOI: http://dx.doi.org/10.18821/1560-9529-2017-22-4-195-200

оригинальная статья

sertion-DELetion) в различных генах, что позволяет выявлять индивидуальные различия между штаммами. Ранее уже была показана возможность использования INDEL-типирования для изучения штаммов холерного вибриона, выделенных из объектов окружающей среды, что позволило осуществить географическую привязку ряда генотипов [7]. Однако это исследование проводилось с использованием всего лишь 4 INDEL-локусов и включало только атоксигенные (ctxAB-) штаммы холерного вибриона. В связи с этим цель настоящего исследования состояла в сравнительном INDEL-типировании по 9 локусам представительной коллекции штаммов холерного вибриона, включающей как музейные токсигенные штаммы холерного вибриона сероваров О1 и О139, так и штаммы, выделенные из объектов окружающей среды на территории Российской Федерации в последние годы.

Материалы и методы

В работе использовали 14 ctx+tcp+ штаммов классического биовара, выделенных с 1927 г., и 22 ctx+tcp+ штамма биовара Эльтор, выделенных в 1981-2014 гг., шесть ctx+tcp+ штаммов серова-ра О139, а также 181 штамм серовара О1, выделенных в 2014-2016 гг. на территории Российской Федерации из объектов внешней среды при проведении мониторинга холеры.

Для проведения INDEL-типирования удалось отобрать 9 INDEL-локусов, к которым были сконструированы специфические праймеры (табл. 1). Постановку полимеразной цепной реакции (ПЦР) и учет результатов проводили, как описано ранее [7].

Вариабельность оценивали с помощью индекса разнообразия Симпсона (diversity index, DI), рассчитываемого по формуле [8]:

DI = 1 - X (частота аллели2).

Кластерный анализ и построение дендрограм-мы проводили с использованием авторского программного обеспечения по методу UPGMA. Для построения дендрограммы использовали программу MEGA 5 [9].

В работе использованы данные полногеномного секвенирования штаммов Vibrio cholerae Эльтор O1 № 18899 и P18899-D, полученные из системы GenBank. Анализ данных полногеномного секвенирования проводили с помощью программы Virtual PC [10].

Результаты и обсуждение

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Проведение генотипирования по 9 INDEL-локусам позволило выявить среди включенных в исследование 223 штаммов 31 уникальный генотип. На основе кластерного анализа все генотипы были сгруппированы в 9 кластеров, обозначенных буквами латинского алфавита с «А» по «I» (см. ри-

Таблица 1

INDEL-локусы, специфические праймеры и размер INDEL-аллелей Vibrio cholerae

№ Обозначение Структура праймеров 3'-5' Размер ампликона п. о.

1 CoA catcatttacagcattgccagt cttcaccaatcggcttaatcg 98/83

2 OmpU aacaagactctgattgctcttgc ctttcagagataggcgagcttc 166/133

3 hutG aaaatggtggatttgattaaacg tttcagggtttagcacaacattt 171/159

4 2456 gattatgggccattcctttagaa acacaaagttaacgctgacagaaa 87/78

5 122 caatattttcaacgcaccatttt ttcgacgatagcactcgatatgt 79/65

6 704 gtgccaaaatcatcagcagtgt atcaccggtgcaatcagtaac 77/71

7 3186 agttggagtgccgtcaaca gcagggtgatagacggtgat 74/67

8 CheA acttcgcgagattcatcagaa ctgtttctagtgatgcgaaagc 193/169

9 p1070 tagctggccccatcagtaag catgatattggatgggaatgc 80/67

сунок). Обращает на себя внимание, что все токси-генные штаммы серовара О1 классического биовара были представлены одним INDEL-генотипом А5, в то время как все токсигенные штаммы О1

,-Г A1 _Л- A2

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

П-Г A3

A4

— A5

B1 B2 B3 B4 B5 C1 C2 C3

^-г B-р- B;

E1

D2

D3 D4 D5

Й- F1 ■ F2

F3

F2 F3

^-Г G1

гт- G2

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

I1

G3 G4 G5 H1 H2 H3

Дендрограмма, построенная на основе кластерного анализа распределения алеллей INDEL-локусов у 223 штаммов холерного вибриона.

ORIGINAL ARTICLE

Таблица 2

INDEL-генотипы токсигенных штаммов Vibrio cholerae

Серогруппа и биовар, токси-генность (число штаммов) INDEL-аллель по локусам

CoA OmpU hutG 2456 122 704 3186 CheA p1070

О1, classical, ctx+tcp+ (14) 98 166 159 87 79 77 67 169 80

О1, Eltor, ctx+ tcp+ (22) 98 166 159 78 79 77 67 169 67

O139, ctx+ tcp+ (6) 98 166 159 78 79 77 67 169 67

Эльтор и О139 представлены другим INDEL-генотипом - А1 (табл. 2). При этом различия между генотипами А5 и А1 обусловлены изменениями в двух INDEL-локусах - 2456 и р1070, что указывает на относительную генетическую близость штаммов О1 Эльтор и О139. Учитывая, что для токсигенных штаммов вибрионов, выделенных в сравнительно короткий период, характерно наличие множества VNTR-генотипов (Онищенко Г.Г., 2016), стабильный INDEL-генотип у всех изученных токсигенных штаммов, изолированных с разрывом в десятки лет, свидетельствует о высоком генетическом консерватизме выбранных INDEL-локусов по сравнению с VNTR-локусами. На наш взгляд, этот факт делает нецелесообразным INDEL-типирование ctx+tcp+ вибрионов.

Кроме того, в состав кластера А вошли 8 ctx-tcp+ штаммов, выделенных на территории РФ в 2015-2016 гг., которые сформировали три INDEL-генотипа: А2-А4. Нахождение в одном кластере штаммов ctx+tcp+ и ctx-tcp+ может свидетельствовать в пользу общности их происхождения и отличия от ctx-tcp- штаммов. Поскольку используемые нами INDEL-маркеры не входят в состав острова патогенности VPI-1, кодирующего продукцию токсин-корегулируемых пилей, выявленный факт позволяет предположить, что ^4срА+ штаммы холерного вибриона составляют обособленную популяцию, существенно отличающуюся от tcpA-штаммов. Это предположение также подтверждается обнаружением вариабельного тандемного повтора VcB только у tcpA+ штаммов [11]. Таким образом, по результатам INDEL-типирования можно судить о наличии у изученного штамма генов ctx и tcp.

Вместе с тем выявленный консерватизм INDEL-локусов представляется весьма важным в свете возможности утраты штаммами холерного вибриона профага CTX [12, 13]. Очевидно, что поскольку изучаемые локусы не затрагивают область генома, содержащую гены холерного токсина (профаг CTX), то их утрата не повлечет за собой изменение INDEL-генотипа. Для проверки этого предположения нами изучены данные полногеномного секвенирования токсигенного штамма V. cholerae № 18899 и штамма V. cholerae P18899-D, представляющего собой его изогенный мутант,

спонтанно утративший ген холерного токсина [13]. При этом оба изолята имели идентичный генотип, характерный для токсигенных штаммов. Это позволяет рекомендовать метод INDEL-типирования для выявления атоксигенных штаммов холерного вибриона, имевших в прошлом профаг СТХ. На наш взгляд, выделение таких штаммов из объектов внешней среды позволяет предположить одновременную циркуляцию и «исходного» (токсиген-ного) изолята, что требует проведения большего объема проводимых противоэпидемических мероприятий. Небезынтересно отметить, что при изучении коллекции атоксигенных штаммов, выделенных за последние 3 года на территории России, не удалось выявить ни одного подобного изолята, утратившего ген холерного токсина. Также нам не удалось найти упоминания о подобном феномене в зарубежной литературе, что позволяет сделать вывод о редкости этого явления.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

При анализе 173 С:х4ср- штаммов, выделенных в 2014-2016 гг. на территории Российской Федерации из объектов внешней среды, выявлено 26 INDEL-генотипов, сформировавших 8 кластеров, обозначенных буквами латинского алфавита с «В» по «I» (табл. 3, рисунок). Анализ пространственного распределения выявленных INDEL-кластеров обнаружил довольно интересные закономерности.

Кластер В был представлен в основном штаммами из Ростовской области и Республики Калмыкия. Исключение составил один штамм, выделенный в Челябинской области в 2016 г. При этом нужно обратить внимание на выделение штаммов одних и тех же генотипов в разные годы. Так, штаммы генотипа В4 выделялись в 2014 и 2016 гг. как в Ростовской области, так и в Республике Калмыкия.

Небольшой кластер С образован штаммами из Республики Калмыкия и одним штаммом из Крыма. Небезынтересно отметить, что в Республике Крым циркулировали штаммы из двух разных кластеров (С1 и F2), причем места их выделения находятся на значительном удалении друг от друга и не имеют единого водного сообщения (данные не представлены).

Штаммы кластера О выделяли в 10 регионах из 16. Удивительно, но к данному кластеру относятся

Эпидемиология и инфекционные болезни. 2017; 22(4)

РРк http://dx.doi.org/10.18821/1560-9529-2017-22-4-195-200

оригинальная статья

Таблица 3

INDEL-генотипы и индекс разнообразия штаммов холерного вибриона, выделенных в различных регионах Российской Федерации в 2014-2016 гг.

Регион Годы выделения вибрионов Индекс разнообразия

Забайкальский край 2014, 2015, 2016 0,18

Иркутская область 2014, 2015 0,44

Калининградская область 2014 0

Краснодарский край 2015 0

Приморский край 2014, 2016 0,62

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Псковская область 2014 0

Республика Бурятия 2016 0

Республика Калмыкия 2014, 2015, 2016 0,9

Республика Коми 2016 0

Республика Крым 2014, 2016 0,37

Ростовская область 2014, 2015, 2016 0,72

Рязанская область 2014 0

Свердловская область 2016 0

Республика Татарстан 2016 0

Хабаровский край 2016 0

Челябинская область 2015, 2016 0,5

все штаммы, выделенные в Забайкальском крае, Иркутской, Калининградской, Псковской, Рязанской областях, Республиках Татарстан и Бурятия. К этому же кластеру относятся 3 из 4 штаммов, выделенных в Приморском крае.

Кластер Е был представлен лишь одним штаммом, изолированным из реки Дон (Ростовская область) в 2015 г.

80 штаммов, выделенных из реки Агура (Краснодарский край) в 2015 г., имели идентичный INDEL-генотип F1. Интересно, что к этому же генотипу относился штамм холерного вибриона, выделенный в Челябинской области в 2015 г. В кластер F попали также штаммы, выделенные в Республике Крым в 2014 г., и один штамм из Приморского края (2014 г).

Кластер G образован штаммами, изолированными в Республике Калмыкия (генотипы 01, G2, G4 и 05) и Свердловской области (генотип 03). Кластеры Н и I образованы исключительно штаммами из Республики Калмыкия.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Не меньший интерес представляет изучение генетической вариабельности выделяемых штаммов холерного вибриона. Так, индекс разнообразия Симпсона, рассчитанный для изученной коллекции штаммов, составил 0,76, что может свидетельствовать о высокой степени гетерогенности популяции. Интересные результаты получены при изучении вариабельности штаммов по каждому региону в отдельности (см. табл. 3). Так, для ряда регионов индекс разнообразия равен нулю (генети-

ческое разнообразие отсутствует). На наш взгляд, отсутствие генетического разнообразия среди выявляемых вибрионов может свидетельствовать о том, что попадание вибрионов в водные объекты является случайным событием, что подтверждается отсутствием выделения штаммов в предыдущие и последующие годы. И наоборот, для регионов с ежегодным выделением штаммов характерен более высокий индекс разнообразия популяции.

Необходимо отметить, что связь между внутривидовым разнообразием и эпидемиологической опасностью уже установлена на примере ряда других возбудителей. Так, внутривидовая изменчивость возбудителя чумы в естественных условиях коррелирует со стадиями эпизоотического процесса, когда наибольшее количество измененных форм выявляется в фазу острой эпизоотии [14]. Аналогичные данные получены при изучении генетического разнообразия шигелл Зонне - увеличение гетерогенности их популяции четко коррелирует с подъемом заболеваемости [15]. При этом некоторыми авторами генетическое разнообразие популяции возбудителя рассматривается как приспособительный признак, обеспечивающий адаптацию к условиям окружающей среды [16]. Вышеизложенное позволяет рекомендовать использование индекса разнообразия в качестве одного из критериев для оценки эпидемиологического риска.

Заключение

Таким образом, в ходе проведенного исследования установлено, что INDEL-типирование является полезным инструментом для изучения молекулярной эпидемиологии, позволяющим выявлять особенности территориального распределения различных генотипов штаммов холерного вибриона. При этом токсигенные штаммы холерного вибриона имеют генотипы, отличающиеся от генотипов атоксигенных штаммов. Показано, что INDEL-типирование позволяет выявлять атокси-генные штаммы, имевшие в прошлом гены холерного токсина. Подтверждено высказанное ранее предположение о территориальной приуроченности ряда генотипов.

Установлено, что при ежегодном выделении штаммов холерного вибриона из одних и тех же объектов окружающей среды их популяция отличается высоким уровнем генетического разнообразия даже при небольшом количестве выделяемых штаммов, что позволяет предложить использование индекса разнообразия в качестве одного из критериев для оценки эпидемиологического риска.

Финансирование. Исследование не имело спонсорской поддержки.

Конфликт интересов. Авторы заявляют об отсутствии конфликта интересов.

ORIGINAL ARTICLE

ЛИТЕРАТУРА

1. Онищенко Г.Г., Москвитина Э.А., Водопьянов А.С., Монахова Е.В., Писанов Р.В., Водопьянов С.О. и др. Ретроспективный молекулярно-эпидемиологический анализ эпидемии холеры в Республике Дагестан в 1994. Пробл. особо опасных инф. 2016; 4: 33-41. DOI: 10.21055/0370-1069-2016-4-33

2. Титова С.В., Кругликов В.Д., Ежова М.И., Водопьянов А.С., Архангельская И.В., Водопьянов С.О., Москвитина Э.А. Анализ динамики выделения и биологических свойств штаммов V. cholerae O1 El-Tor, изолированных из водных объектов на территории Ростовской области с 2003-2014 гг. Здоровье населения и среда обитания. 2015; 2 (263): 39-41.

3. Смирнова Н.И., Кульшань Т.А., Краснов Я.М. MLVA-типирование клинических штаммов Vibrio cholerae, изолированных в разные периоды текущей пандемии холеры. Молекулярная генетика, микробиология и вирусология. 2015; 1: 15-22.

4. Мишанькин Б.Н., Водопьянов А.С., Ломов Ю.М., Романова Л.В., Водопьянов С.О., Сучков И.Ю. и др. Ретроспективный VNTR-анализ генотипов штаммов Vibrio cholerae O1, выделенных на территории ростовской области в годы VII пандемии холеры. Молекулярная генетика, микробиология и вирусология. 2004; 4: 28.

5. Тимофеев В.С., Кудрявцева Т.Ю., Мокриевич А.Н., Павлов В.М., Дятлов И.А. Молекулярное типирование штаммов Francisella tularensis методом мультилокусного анализа вариабельности числа тандемных повторов. Молекулярная генетика, микробиология и вирусология. 2014; 1: 8-15.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

6. Платонов М.Е., Евсеева В.В., Дентовская С.В., Анисимов А.П. Молекулярное типирование Yersinia pestis. Молекулярная генетика, микробиология и вирусология. 2013; 2: 3-12.

7. Водопьянов А.С., Водопьянов С.О., Олейников И.П., Мишанькин Б.Н., Кругликов В.Д., Архангельская И.В. и др. INDEL- и VNTR-типирование штаммов Vibrio cholerae, выделенных в 2013 году из объектов окружающей среды на территории Российской Федерации. Здоровье населения и среда обитания. 2015; 5 (266): 41-4.

8. Simpson E.H. Measurement of diversity. Nature (London). 1949; Vol. 163, No 4148.

9. Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution. 2011; 28: 2731-9.

10. Водопьянов А.С., Водопьянов С.О., Мишанькин Б.Н., Олейников И.П. Алгоритм компьютерного VNTR-типирования на основе неполных сиквенсов ДНК-штаммов Vibrio cholerae, выделенных на Гаити в 2010 г. Здоровье населения и среда обитания. 2013; 3 (240): 28-30.

11. Водопьянов А.С., Водопьянов С.О., Мишанькин Б.Н., Олейников И.П. Корреляция области вариабельного тандемного повтора VcB (VNTR VcB) и гена токсин-корегулируемых пилей (tcpA) у возбудителя холеры: компьютерный анализ. Здоровье населения и среда обитания. 2014; 4 (253): 14-6.

12. Кульшань Т.А., Топорков А.В., Смирнова Н.И. Генетические изменения вирулентных штаммов холерных вибрионов биовара Эльтор при их обитании в водной среде. Пробл. особо опасных инф. 2006; 1 (91): 41-4.

13. Щелканова Е.Ю., Кульшань Т.А., Заднова С.П., Агафонов Д.А., Смирнова Н.И. Конструирование штамма-продуцента В-субъединицы холерного токсина на модели атоксигенного геноварианта Vibrio cholerae. Холера и патогенные для человека вибрионы. В кн.: Материалы проблемной комиссии (48.04) Координационного научного совета по санитарно-эпидемиологической охране территории Российской Федерации. Ростов-на-Дону: Дониздат; 2015, Вып. 28: 144-6.

14. Анисимов А.П. Внутривидовое разнообразие Yersinia pestis. Успехи современного естествознания. 2003; 10: 50-2.

15. Маркова Ю.А., Савилов Е.Д. Использование показателей разнообразия возбудителя для оценки состояния эпидемического процесса. Журн. инфекционной патологии. 1999; 2-3: 10-5.

16. Беляков В.Д. Введение в эпидемиологию инфекционных и неинфекционных болезней. М.: Медицина; 1989.

REFERENCES

1. Onishchenko G.G., Moskvitina E.A., Vodop'yanov A.S., Monak-hova E.V., Pisanov R.V., Vodop'yanov S.O. et al. Retrospective Molecular-Epidemiological Analysis of Cholera Epidemic in the Republic of Dagestan in 1994. Probl. osobo opasnykh inf. 2016; 4: 33-41. DOI: 10.21055/0370-1069-2016-4-33. (in Russian)

2. Titova S.V., Kruglikov V.D., Ezhova M.I., Vodop'yanov A.S., Arkhangel'skaya I.V., Vodop'yanov S.O., Moskvitina E.A. Analysis of isolation dynamics and biological properties of V. cholerae o1 el tor strains from water objects on the territory of Rostov region in 2003-2014. Zdorov'e naseleniya i sreda obitaniya. 2015; 2 (263): 39-41. (in Russian)

3. Smirnova N.I., Kul'shan' T.A., Krasnov Ya.M. MLVA typing of clinical Vibrio cholerae strains isolated during different periods of the current cholera pandemic. Molekulyarnaya genetika, mik-robiologiya i virusologiya. 2015; 1: 15-22. (in Russian)

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

4. Mishan'kin B.H., Vodop'yanov A.S., Lomov Yu.M., Romanova L.V., Vodop'yanov S.O., Suchkov I.Yu. et al. Retrospective VN-TR-analysis of genotypes of Vibrio cholerae O1 strains isolated, during the 7th cholera pandemic in Rostov region. Molekulyar-naya genetika, mikrobiologiya i virusologiya. 2004; 4: 28. (in Russian)

5. Timofeev V.S., Kudryavtseva T.Yu., Mokrievich A.N., Pavlov V.M., Dyatlov I.A. Molecular typing of Francisella tularensis using multiple-locus variable-number tandem-repeat analysis. Molekulyarnaya genetika, mikrobiologiya i virusologiya. 2014; 1: 8-15. (in Russian)

6. Platonov M.E., Evseeva V.V., Dentovskaya S.V., Anisimov A.P. Molecular typing of Yersinia pestis. Molekulyarnaya genetika, mikrobiologiya i virusologiya. 2013; 2: 3-12. (in Russian)

7. Vodop'yanov A.S., Vodop'yanov S.O., Oleynikov I.P., Mishan'kin B.N., Kruglikov V.D., Arkhangel'skaya I.V. et al. INDEL- и VN-TR-typing Vibrio cholerae strains, isolated in 2013 from the environment objects in the Russian Federation. Zdorov 'e naseleniya i sreda obitaniya. 2015; 5 (266): 41-4. (in Russian)

8. Simpson E.H. Measurement of diversity. Nature (London). 1949; Vol. 163, No 4148.

9. Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution. 2011; 28: 2731-9.

10. Vodop'yanov A.S., Vodop'yanov S.O., Mishan'kin B.N., Ol-eynikov I.P. Computer VNTR-genotyping algorithm based on the partial sequence data of Vibrio cholerae strains from Haitian outbreak (2010). Zdorov'e naseleniya i sreda obitaniya. 2013; 3 (240): 28-30. (in Russian)

11. Vodop'yanov A.S., Vodop'yanov S.O., Mishan'kin B.N., Ol-eynikov I.P. Correlation between variable tandem repeat region vcb (VNTR VcB) and gene toxin co-regulated pilin (tcpA) in Vibrio cholerae: a computer analysis. Zdorov'e naseleniya i sreda obitaniya. 2014; 4 (253): 14-6. (in Russian)

12. Kul'shan' T.A., Toporkov A.V., Smirnova N.I. Genetic Changes of Virulent Vibrio cholerae El Tor Biovar Strains Living in Water Environment. Probl. osobo opasnykh inf. 2006; 1 (91): 41-4. (in Russian)

13. Shchelkanova E.Yu., Kul'shan' T.A., Zadnova S.P., Agafonov D.A., Smirnova N.I. The construction of the producer strain in the a-subunit of the cholera toxin on the model atoxigenic geno-variants of Vibrio Cholerae. Cholera and pathogenic for human. In: [Materialy problemnoy komissii (48.04) Koordinatsionnogo nauchnogo soveta po sanitarno-epidemiologicheskoy okhrane territorii Rossiyskoy Federatsii]. Rostov-na-Donu: Donizdat; 2015; Vyp. 28: 144-6. (in Russian)

14. Anisimov A.P. Intraspecific diversity of Yersinia pestis. Uspekhi sovremennogo estestvoznaniya. 2003; 10: 50-2. (in Russian)

15. Markova Yu.A., Savilov E.D. The use of indicators of diversity of the pathogen to assess the state of the epidemic process. Zhurn. infetstsionnoy patologii. 1999; 2-3: 10-5. (in Russian)

16. Belyakov V.D. The Use of Indicators of Diversity of the Pathogen to Assess the State of the Epidemic Process. [Vvedenie v epide-miologiyu infektsionnykh i neinfektsionnykh bolezney]. Moscow: Meditsina; 1989. (in Russian)

Поступила 19.04.2017 Принята в печать 20.07.2017

Эпидемиология и инфекционные болезни. 2017; 22(4)

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

DOI: http://dx.doi.org/10.18821/1560-9529-2017-22-4-200-207

обзор

Сведения об авторах:

Водопьянов Сергей Олегович, доктор мед. наук, зав. лаб. биохимии микробов ФКУЗ «Ростовский-на-Дону противочумный институт» Роспотребнадзора; Олейников Игорь Павлович, науч. сотр. лаб. биохимии микробов ФКУЗ

«Ростовский-на-Дону противочумный институт» Роспотребнадзора; Мишанькин Борис Николаевич, доктор мед. наук, вед. науч. сотр. лаб. диагностики особо опасных инфекций ФКУЗ «Ростовский-на-Дону противочумный институт» Ро-спотребнадзора.

ОБЗОРЫ

© КОЛЛЕКТИВ АВТОРОВ, 2017 УДК 616.98:579.881.13]-036.1

Малов В.А.1, Горобченко АН.1, Гюлазян Н.М.2, Немилостива Е.А.1, Каншина Н.Н.1, Нехаев С.Г.3, Свиридова М.Б.1

"НЕЯСНАЯ ЛИХОРАДКА"1: ВОСЕМЬДЕСЯТ ЛЕТ СПУСТЯ

1ФГАОУ ВО «Первый Московский государственный медицинский университет им. И.М. Сеченова» Минздрава России, 119991, Москва, Россия, ул. Трубецкая, д. 8, стр. 1;

2Ереванский государственный медицинский университет им. М. Гераци Министерства образования и науки, 0025, Ереван, Армения; ул. Корюна;

ФГБОУ ВО «Тульский государственный университет», 300012, г. Тула, Россия, пр. Ленина, д. 92

В обзорной статье рассматриваются современные сведения об этиологии, эпидемиологии Q-лихорадки, патогенетические механизмы, обеспечивающие уклонение коксиелл от защитных систем макроорганизма и способствующие развитию хронического течения заболевания. Подробно рассматриваются клинические проявления Q-лихорадки при острой и хронических формах, обсуждаются проблемы ранней диагностики и лечебная тактика.

Ключевые слова: Q-лихорадка; Q fever; Ку-лихорадка; коксиеллез; заболевание; вызванное Coxiella burnetii. Для цитирования: Малов В.А., Горобченко А.Н., Гюлазян Н.М., Немилостива Е.А., Каншина Н.Н., Нехаев С.Г., Свиридова М.Б. «Неясная лихорадка»: восемьдесят лет спустя. Эпидемиология и инфекционные болезни. 2017; 22 (4): 200-207. DOI: http://dx.doi.org/10.18821/1560-9529-2017-22-4-200-207

Malov V.A.1, GorobchenkoA.N.1, GyulazyanN.M.2, NemilostivaE.A.1, KanshinaN.N.1, NekhaevS.G.3, SviridovaM.B.1 «QUERY FEVER»: DOWN THE LINE EIGHTY YEARS

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

1I.M. Sechenov First Moscow State Medical University, 2-4, Bolshaya Pirogovskaya str., 119991 Moscow, Russian Federation; 2Mkhitar Heratsi Yerevan State Medical University, 2, Koryun str., Yerevan, 0025, Armenia; 3Tula State University, 12, Lenina str., Tula, 923000, Tula, Russian Federation

The review article coniders modern information on etiology, epidemiology of Q-fever, pathogenetic mechanisms promoting Coxiella burnetii bacteria to wear down the protective systems of the macroorganism and contribute to the development of the chronic course of the disease. Clinical manifestations of Q-fever in acute and chronic forms are considered in detail, problems of early diagnosis and treatment tactics are discussed. Keywords: Q fever; Coxiellosis; disease caused by Coxiella burnetii

For citation: Malov V.A., Gorobchenko A.N., Gyulazyan N.M., Nemilostiva E.A., Kanshina N.N., Nekhaev S.G., Sviridova M.B. "Query fever": down the line eighty years. Epidemiologiya i infektsionnye bolezni (Epidemiology and Infectious Diseases, Russian journal). 2017; 22 (4): 200-207. (In Russ.). DOI: http://dx.doi.org/10.18821/1560-9529-2017-22-4-200-207 For correspondence: Valery A. Malov, Sechenov First Moscow State Medical University, Department of Infectious Diseases, professor, e-mail: valmalov@list.ru Information about autors: Malov V.A., http://orcid.org/0000-0002-6157-1654

Conflict of interest. The authors declare no conflict of interest.

Acknowledgement. The study had no sponsorship.

Received 01.06.2017 Accepted 20.07.2017

1 В 1937 г. австралийский исследователь E.H. Derrick, расследуя спорадические и групповые случаи лихорадочных состояний у ра-

ботников скотобоен в Брисбене (Австралия), не смог установить природу заболевания, что и предопределило использование им термина "Q fever" (от слова "query" - неясный).

Для корреспонденции: Малов Валерий Анатольевич, доктор мед. наук, проф. каф. инфекционных болезней ФГАОУ ВО Первый МГМУ им. И.М. Сеченова Минздрава России (Сеченовский Университет), e-mail: valmalov@list.ru