Научная статья на тему 'Экспрессия маркеров плюрипотентности при репрограммировании фибробластов мыши с использованием системы транспозонов'

Экспрессия маркеров плюрипотентности при репрограммировании фибробластов мыши с использованием системы транспозонов Текст научной статьи по специальности «Биология»

CC BY
59
12
Поделиться
Журнал
Biotechnologia Acta
CAS
Область наук
Ключевые слова
іНДУКОВАНі ПЛЮРИПОТЕНТНі СТОВБУРОВі КЛіТИНИ / РЕПРОГРАМУВАННЯ / ФАКТОРИ ПЛЮРИПОТЕНТНОСТі / ИНДУЦИРОВАННЫЕ ПЛЮРИПОТЕНТНЫЕ СТВОЛОВЫЕ КЛЕТКИ / РЕПРОГРАММИРОВАНИЕ / МАРКЕРЫ ПЛЮРИПОТЕНТНОСТИ

Аннотация научной статьи по биологии, автор научной работы — Малышева С. В., Билько Н. М., Хешлер Ю.

Поиск эффективных и безопасных методов получения плюрипотентных стволовых клеток чрезвычайно актуален. В работе эмбриональные фибробласты мыши репрограммированы в пролиферирующие колонии с ти пичной морфологией индуцированных плюрипотентных стволовых клеток с помощью векторной системы транспозонов Sleeping beauty. В полученных клонах исследована экспрессия различных маркеров плюрипотентности — щелочной фосфатазы, генов Oct4 и Sox2; оценен уровень экспрессии поверхностного маркера плюрипотентности SSEA-1 в отдельных клонах клеточной линии. Пока за на также реактивация экспрессии эндогенных факторов плюрипотентности Nanog и Rex1. Полученные данные проанализированы и со поставлены с показателями исходной линии эмбриональных фибробластов и зарегистрированной линии плюрипотентных стволовых клеток. Пока за но, что с помощью системы транспозонов Sleeping beauty осуществляется репрограммирование соматических клеток в индуцированные плюрипотентные. Таким образом, эта система репрограммирования является новым перспективным инструментом в биотехнологии получения плюрипотентных клеток.

Похожие темы научных работ по биологии , автор научной работы — Малышева С. В., Билько Н. М., Хешлер Ю.,

EXPRESSION OF PLURIPOTENCY MARKERS IN MURINE FIBROBLASTS REPROGRAMMING BY TRANSPOSON SYSTEM

The search for effective and safe methods to generate induced pluripotent stem cells is especially urgent. In the paper murine embryonic fibro blasts were reprogrammed towards actively proliferating colonies with typical induced pluripotent stem cells morphology by means of Sleeping beauty transposon-based vector system. The obtained clones were checked for the expression of various pluripotency markers: alkaline phosphatase, Oct4 and Sox2 genes, SSEA-1 expression in various clones was evaluated. Also the reactivation of endogenous pluripotency factors Nanog and Rex1 was indicated. The data obtained is analyzed and compared to the established pluripotent stem cell line. It is shown that somatic cells are reprogrammed towards pluripotency by means of Sleeping beauty transposon system. Therefore, the system is a new perspective biotechnological tool to generate pluripotent cells.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Текст научной работы на тему «Экспрессия маркеров плюрипотентности при репрограммировании фибробластов мыши с использованием системы транспозонов»

УДК 576.32/36; 57.085.23

ЕКСПРЕСІЯ МАРКЕРІВ ПЛЮРИПОТЕНТНОСТІ ЗА РЕПРОГРАМУВАННЯ ФІБРОБЛАСТІВ МИШІ З ВИКОРИСТАННЯМ СИСТЕМИ ТРАНСПОЗОНІВ

С. В. Малишева1,2 Національний університет «Києво-Могилянська академія»,

Н. М. Білько1 Київ, Україна

Ю. Хешлер2 2Інститут нейрофізіології Кельнського університету, Кельн,

Німеччина

Е-mail: smalysheva@gmail.com

Отримано 05.11.2012

Пошук ефективного та безпечного методу одержання плюрипотентних стовбурових клітин є вкрай актуальним. У роботі ембріональні фібробласти миші репрограмовано в проліферувальні колонії з типовою морфологією індукованих плюрипотентних стовбурових клітин з використанням векторної системи Sleeping beauty. В одержаних клонах досліджено експресію різноманітних маркерів плюрипотентності — лужної фосфатази, генів Oct4 та Sox2; оцінено рівень експресії поверхневого маркера плюрипотентності SSEA-1 в окремих клонах клітинної лінії. Показано також реактивацію експресії ендогенних факторів плюрипотентності Nanog та Rex1. Одержані дані проаналізовано та зіставлено з характеристиками вихідної лінії ембріональних фібробластів і зареєстрованої лінії плю-рипотентних стовбурових клітин миші. Показано, що за допомогою системи транпозонів Sleeping beauty здійснюється репрограмування соматичних клітин в індуковані плюрипотентні. Отже, ця система репрограмування є новим перспективним інструментом у біотехнології одержання плюрипо-тентих клітин.

Ключові слова: індуковані плюрипотентні стовбурові клітини, репрограмування, фактори плюрипотентності.

Індуковані плюрипотентні стовбурові клітини (іПСК) одержують генетичним ре-програмуванням зрілих соматичних клітин. Репрограмування досягається ектопічною експресією необхідних для набуття (встановлення) та підтримання плюрипотентного стану генів — 0^4, 8ох2, с-Мус, КІЇ4, Nanog, Ьіп28. Перші іПСК отримано з ембріональних та дорослих фібробластів миші у 2006 р. Уашапака et аі. унаслідок стабільної інтеграції в геном цих клітин факторів плюрипотентості 0сЬ4, 8ох2, с-Мус та Кі£4 за допомогою ретровірусних векторів [1]. Ці репрограмовані клітинні лінії нагадували за ключовими характеристиками лінії ембріональних стовбурових клітин (ЕСК). Через рік ця сама група вчених успішно репрограмувала в іПСК соматичні клітини людини [2]. Одержання пацієнтспе-цифічних стовбурових клітин, їх спрямоване диференціювання у бажаний тип автоло-гічних клітин або генетична корекція відкривають нові можливості для клітинної терапії та регенеративної медицини [3, 4]. Адже технологія з використанням іПСК дає змогу уникнути необхідності використання отриманих з ембріонів людини стовбурових

клітин, а також обійти імунологічні проблеми, пов’язані з алогенною трансплантацією клітинного матеріалу. Клінічне застосування одержаних за допомогою вірусних векторів іПСК пов’язане з певним ризиком злоякісної трансформації внаслідок випадкової ретровірусної інтеграції [5]. Тому постає необхідність пошуку альтернативних методів досягнення ектопічної експресії репро-грамувальних факторів. Із цією метою було створено й успішно використано для репро-грамування інтегративні вектори на основі лентивірусів [6] та неінтегративні — на основі аденовірусів [7] чи епісом [8], а також для доставлення ключових репрограмуваль-них факторів у вигляді мРНК транскриптів [9] і навіть протеїнів [10]. Проте ефективність репрограмування за допомогою неінтегра-тивних методів істотно поступається ефективності, досягненій за допомогою вірусних векторів. Ідеальна система доставлення ре-програмувальних факторів має поєднати у собі високу ефективність вірусних векторів та безпечність невірусних конструкцій. Ключем до вирішення цього питання можуть стати вектори, засновані на мобільних генетичних елементах. Транспозони

є природним засобом мобілізації дискретних сегментів ДНК у геномі. Таке переміщення опосередковано ензимом транспозазою, яка специфічно розпізнає ці сегменти за інвертованими повторами, що їх фланкують. Цю природну властивість використано для розроблення відомих на сьогодні векторних систем: Sleeping beauty, Piggybac, Tol2 та ін. [11].

Система транспозонів Sleeping beauty як вектор доставлення генів має низку переваг: ефективність трансфекції (навіть для клітин, ефективність трансфекції яких є досить низькою в разі застосування існуючих методів), високий рівень стабільної експресії трансгена, здатність до мобілізації великих конструкцій — понад 10 тис. пар основ, безпечність — мобільні елементи цієї системи не мають тенденції до вбудовування у коду-вальні послідовності.

Метою роботи було репрограмування ембріональних фібробластів миші в іПСК за допомогою гастеми транспозонів Sleeping beauty та дослідження основних плюрипо-тентних характеристик отриманих клітин. Для репрограмування використано первинну культуру ембріональних фібробластів миші. Культура клітин миші, зокрема ембріональні фібробласти, — зручний об’єкт для первинної перевірки ефективності системи репрограмування. Аби довести плюри-потентність отриманих клонів, проведено первинний скринінг на експресію основних маркерів на рівні мРНК транскриптів та протеїну. Серед окремих клонів обрано три основні для подальшного вивчення та характеристики одержаної клітинної лінії.

Матеріали і методи

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Одержання та культивування ембріональних фібробластів миші

Первинну культуру ембріональних фібробластів миші отримано з ембріонів миші штаму c57Bl6N, вилучених на 13-ту добу гестації. Для одержання культури клітин використовували гомогенізовані механічно та ензиматично (за допомогою 0,05% Trypsin-EDTA) тулуби ембріонів без навколоплідних оболонок, голови та внутрішніх органів. Фібробласти культивували в середовищі DMEM із додаванням 10%-ї фетальної телячої сироватки (FBS), амінокислот (NEAA), 50 мкМ Р-меркаптоетанолу, 1%-го розчину антибіотиків пеніциліну-стрептоміцину (усі реактиви одержано від Gibco Invitrogen, Німеччина). Для репрогра-мування використовували культуру ембріональних фібробластів нульового пасажу без попереднього заморожування.

Плазміди системи Sleeping beauty

Систему Sleeping beauty надано її розробниками — Zoltan Ivics та Szuszanna Izsvac (Max-Delbruk Center for Molecular Medicine, Берлін, Німеччина). Ця система складається із пари плазмід. На першій закодовано транспозазу SB100x, що забезпечує стабільну інтеграцію генів інтересу в геном. Друга містить у собі власне гени інтересу — ре-програмувальну касету, фланковану інвертованими повторами для розпізнавання транспозазою SB100x. Репрограмувальна касета є мультицистронним вектором із генами Oct4, Sox2, Klf4, c-Myc (OSKM) або Oct4, Sox2, Klf4, c-Myc та Lin28 (OSKML) під спільним конститутивним CAG-промотором. Окремі гени у касеті розмежовано самопро-цесингувальними (self-cleaving) протеїнами 2A. Таке розмежування дає змогу закодованим під єдиним промотором факторам дисоціювати на окремі протеїнові компоненти за процесингу [12]. Репрограмувальна касета також фланкована сайтами гомологічної рекомбінації LoxP для подальшого видалення інтегрованої в геном послідовності та оснащена геном тимідинкінази. Наявність цього суїцидального гена забезпечує можливість негативної селекції за допомогою генцикло-віру (токсичного аналога тимідину) вільних від трансгена репрограмованих клітин [13].

Трансфекція мишачих ембріональних фібробластів (МЕФ)

Первинну культуру отриманих ембріональних фібробластів миші трансфекували плазмідами системи Sleeping beauty (без попередньої лінеаризації) за допомогою електропорації на Neon Transfection System (Invitrogen, USA). Для успішної трансфекції оптимізовано протокол, запропонований фірмою-виробником online із параметрами трансфеції для мишачих фібробластів. Для контролю ефективності трансфекції використано плазміду системи Sleeping beauty, що експресує флуоресцентний протеїн VENUS. Ефективність трансфекції визначали проточною цитофлуориметрією на FACScan (Becton Dickinson). Кількість VENUS-пози-тивних клітин визначали через 48 год після трансфекції, дані аналізувати за допомогою програмного забезпечення CellQuest.

Вилучення та культивування іПСК колоній

На другу добу після трансфекції ембріональних фібробластів репрограмувальними плазмідами системи Sleeping beauty змінювали умови їх культивування. Трансфековані

клітини пасажували на фідерний шар (мітотично інактивовані фібробласти миші, резистентні до неоміцину (MEFNeoR), на якому культивують відомі лінії ЕСК миші aPIG44. Також середовище для фібробластів (DMEM із 10% FBS) замінили на середовище для мишачих ЕСК/іПСК складу: DMEM, 15% FBS, 0,1 мМ NEAA, 50 мкМ Р-меркап-тоетанолу (Gibco, Німеччина), 1 000 од/мкл LIF (Leukemia inhibitory factor, Millipore, Німеччина). Для поліпшення репрограму-вання в середовище для ЕСК/іПСК додавали 50 млМ аскорбінової кислоти (Wako, Німеччина) та 0,1 мM вальпроєвої кислоти (Sigma, США). За появою перших колоній спостерігали за допомогою стереомікроско-па (Leica, Німеччина), окремі клони отримували за механічного відбору та пасажування індивідуальних колоній. Відбирали колонії голкою, під стереомікроскопом (Leica, Німеччина), у ламінарному боксі. Кожен клон пасажували як лінію ЕСК/іПСК за допомогою 0,05% Trypsin-EDTA, культивували в зазначеному вище середовищі (DMEM 15%), додаючи LIF (для підтримання у недиференційованому стані) на шарі фідерних клітин на 12-лунковому культуральному пластику. Із розростанням клони перевели на звичний для ЕСК/іПСК формат культуральної чашки Петрі (60 мм).

Визначення активності лужної фосфо-тази та імуногістохімія

Активність лужної фосфатази виявляли у фіксованих етанолом колоніях забарвленням розчину нафтолу (Naphtol AS-MX Phosphate, 200 мкг/мл Sigma, USA) у розчині 1 мг/мл Fast Red TR Salt (Sigma, США) в

0,1 М Tris/HCl, pH 9,2.

Для імуноцитохімії клітини фіксували 4%-м розчином параформальдегіду (PFA) та пермеабілізували 10 хв 0,5 М розчином хлориду амонію та 0,25% Triton X-100 в 0,1 М фосфатному буфері. З метою блокування неспецифічного зв’язування клітини обробляли протягом 60 хв 5%-м BSA. Для ідентифікації та локалізації експресії транскрипційного фактора Oct4 фіксовані клітини інкубували зі специфічним до мишачого Oct4 первинним антитілом (1:200) упродовж ночі при 4 °С та забарвлювали (1:1000) FITC-кон’югованим вторинним антитілом (Santa Cruz Biotechnology, США). Ядра клітин забарвлювали Hoechst 33342 1 мкг/мл (Invitrogen).

Визначення експресії SSEA-1 Рівень експресії SSEA-1 визначали прижиттєвим забарвленням. Колонії трипсині-зували за допомогою 0,05% Trypsin-EDTA на 48-му год культивування, промивали в 0,5% BSA у фосфатному буфері. Протягом 60 хв інкубували з первинними мишачими антитілами (1:200) SSEA-1 та IgM як ізоти-повим контролем. Забарвлювали вторинними FITC- та Alexafloor-555-кон’югованими антитілами (Santa Cruz Biotechnology, USA). Відсоток SSEA-1 — позитивних клітин обчислювали за допомогою проточного цитофлуориметра FACScan (Becton Dickinson) у діапазоні, що відповідав кожному з кон’югованих зі вторинними антитілами флуоресцентних барвників — FITC або Alexafloor-555. Отримані дані аналізували за допомогою програмного забезпечення CellQuest (Becton Dickinson).

Виділення РНК та зворотна транскрипція Загальну РНК ізолювали за допомогою тризолу (Invitrogen), якість та кількість ізольованого матеріалу оцінювати на Nanodrop (Thermo Scientific). Для одержання кДНК використовували 1 мкг РНК, реакцію здійснювали за допомогою SuperScript II RNase H-Reverse Transcriptase (Invitrogen), Random Primers (Sigma, США). ПЛР-амплі-фікацію проводили за допомогою GreenTaq MM, dNTP Mix (Invitrogen). Послідовності праймерів для ПЛР-ампліфікації гена інтересу наведено в табл. 1.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Таблиця 1. Послідовності праймерів для реакції зворотної транскрипції

Праймер Послідовність

hmGAPDH-F GGCTCATGACCACAGTCCAT

hmGAPDH-R ACCTTGCCCACAGCCTTG

hmOct4-F CATGTGTAAGCTGCGGCCC

hmOct4-R GCCCTTCTGGCGCCGGTTAC

hmSox2-F ACGGCTGGAGCAACGGCAGC

hmSox2-R GGAGTTGTACTGCAGGGCGC

mRex1-F TGAAAGCCCACATCCTAACG

mRex1-R CAAGCTATCCTCCTGCTTTGG

mNanog-F AGGGTCTGCTACTGAGATGTCCTG

mNanog-R CAACCACTGGTTTTTCTGCCACCG

Експериментальні дані обробляли статистично загальноприйнятими методами за допомогою пакетів прикладних програм Microsoft Office Excel для персонального комп’ютера.

Результати та обговорення

Вихідна лінія МЕФ, що її отримано від тварин дикого типу, не є генетично модифікованою. Касета з факторами репрограму-вання не містила жодних селективних маркерів, таких як флуоресцентний протеїн чи ген резистентності до антибіотика. Тому першими ознаками репрограмування в цьому експерименті є зміна морфології, а згодом і проліферативної активності клітин.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Перші ознаки репрограмування — коло-нієподібні структури на фідерному шарі інактивованих мітотично ембріональних фібробластів з’явилися на 8-му добу культивування (рис. 1).

ШР

f у

Рис. 1. Зображення колонієподібних структур, що з’являлись на 8-му добу репрограмування:

1 — колонії за збільшення x4; 2 — x10;

3 — контрольний варіант без колоній, x10

Загалом репрограмування соматичних клітин миші триває, за різними даними, від восьми діб репрограмування [14]. Колоніє-подібні структури не було виявлено в контрольному варіанті, в якому МЕФ трансфеко-вано парою плазмід системи Sleeping beauty, що кодують транспозазу та флуоресцентний протеїн VENUS. Таким чином показано, що соматичні клітини репрограмовано за допомогою трансфеції плазмід системи Sleeping beauty, що містить репрограмувальні фактори OSKM та OSKML.

Колонієподібні структури, що з’являлися з 8-ї доби репрограмування, культивували ще протягом 3-4 діб для збільшення роз-

міру та чіткішого оформлення колонії. На 11-ту добу репрограмування проводили відбір (pick-up) індивідуальних колоній. Для одержання різних клонів отриманої клітинної лінії окремі колонії відбирали механічно під мікроскопом, трипсинізували та пасажу-вали як звичайні лінії ЕСК та іПСК. На 7-му пасажі ефективність проліферації (табл. 2) та морфологія (рис. 2) не відрізнялись від зареєстрованої лінії ЕСК — aPIG44.

Колонієподібні структури, що виникли внаслідок репрограмування ембріональних фібробластів, мали лужно-фосфатазну активність, що видно неозброєним оком на

ж

*■ Аа' .

. jfc і

2

ИЖчі/І." -V Рис. 2. Морфологія деяких клонів репрограмованих мишачих фібробластів та контрольних клітинних ліній:

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

1 — клон 6; 2 — клон 7; 3 — клон 9;

4 — клон 13; 5 — клон 11, в — aPIG44 (об’єктив x10)

Таблиця 2. Проліферативні показники деяких клонів отриманої за репрограмування клітинної лінії

Номер клона / назва клітинної лінії Кількість пасивованих клітин на 60 мм чашку Петрі Кількість отриманих клітин на 48-му добу культивування

Клон 6 G,51G6 3,61G6

Клон 7 G,51G6 3,72-106

Клон 9 G,51G6 2,72-106

аРЮ44 G,51G6 3,4-1G6

культуральній чашці (рис. 3). На мікрофо-тографіях видно, що активність лужної фосфатази локалізується саме в колонієподіб-них структурах, однак її не виявлено у клітинах фідерного шару.

Із колонієподібних структур, що виникали за репрограмування починаючи з 8-ї доби, відібрали та культивували до 10-го пассажу 23 окремих клони. Плюрипотентність отриманих клонів оцінювали за допомогою аналізу експресії повехневого маркера плюрипотен-тності — стадієспецифічного ембріонального антигена 1 (Stage-Spesific Embryonic Antigen 1, SSEA-1). Цей антиген експре-сується на стадії ранньої бластоцисти, асоційований із плюрипотентністю, тому дані стосовно його якісної чи кількісної експресії оцінюють, створюючи нові лінії іПСК. Оскільки SSEA-1 експресується на поверхні клітин, рівень його експресії можна оцінити кількісно, порівняти за цим показником окремі клони між собою та контрольними клітинними лініями. Результати аналізу експресії SSEA-1 наведено в табл. 3.

Рис. 3. Експресія лужної фосфатази у клонах, що утворилися за репрограмування ембріональних фібробластів миші:

збільшення x2,5 та x10

Таблиця 3. Ескспресія SSEA-1 у клонах репрограмованих ембріональних фібробластів миші та контрольних клітинних лініях

Клон % SSEA-1- позитивних клітин Клон/ клітинна лінія % SSEA-1-позитивних клітин

Клон 5 91,36 Клон 13 82,09

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Клон 6* 8Т,84 Клон 1Т 94,00

Клон Ч Т1,56 Клон 2G* 59,5Т

Клон 8* 63,41 Клон 22 90,15

Клон 9 94,32

Клон 10* Т5,5Т aPIG44* 93,0Т

Клон 11 90,20 MЕФ 0,66

Клон 12* 66,38

Примітка: * — мічення Alexa fluor-555-кон’ю-гованими вторинними антитілами, решта — кон’югованими із FITC.

Експресію SSEA-1 не виявлено у вихідної лінії МЕФ — позитивних клітин менше 1%, що спричинило неспецифічне зв’язування вторинного антигена. Серед отриманих окремих клонів кількість SSEA-1-пози-тивних клітин варіювавала від 59,5Т% у клона 20 до 94,32% у клона 9. У середньому для 23 клонів цей показник становив 80,5% . У вивченої клітинної лінії aPIG44 цей показник становив 93,0Т%. Більше 40% досліджуваних клонів експресували SSEA-1 на рівні зареєстрованих клітинних ліній ЕСК/іПСК. Таким чином, показано реакти-вацію експресії цього антигена до рівня плюрипотентної клітинної лінії, що свідчить про репрограмування фібробластів та відповідність більшості отриманих клонів одному із ключових показників плюрипо-тентності.

Експресія транскрипційного фактора Oct4

Характеристика новоствореної клітинної лінії включає аналіз її численних показників як у недиференційованому стані, так і за виявлення диференційного потенціалу [1, 2, 6, 8, 10, 14, 15]. Для подальшої характеристики отриманої клітинної лінії доцільно обрати всього декілька різних клонів. З одержаної кількості культивованих кло-нів-кандидатів для подальшого дослідження відбирають вибірково, за морфологією, проліферативним потенціалом та деякими ключовими чи бажаними характеристиками. За цими критеріями для подальшого дослідження отриманої клітинної лінії обрано три клони — 6, Т і 9.

Oct4 — транскрипційний фактор, експресія якого асоціюється із плюрипотент-ністю [16]. Цей ген входить у стандартну четвірку репрограмувальної касети так званих «факторів Яманака». Способи репрогра-мування соматичних клітин без використання фактора Oct4 невідомі [15, 1Т-19]. Як маркерний для плюрипотентності транскрипційний фактор, Oct4 експресується в межах ядра плюрипотентних клітин і не експресується у соматичних клітинах, зокрема фідерного шару.

За допомогою флуоресцентно-мічених антитіл ідентифіковано експресію Oct4 на рівні протеїну. Виявлено, що цей макрер експресується у досліджуваних клонах 6, Т та 9 так само інтенсивно, як і в зареєстрованій лінії ЕСК миші aPIG44. Показано, що цей транскрипційниий фактор експре-сується в межах ядра, що має у плюрипотен-тних клітин більш компактну форму, ніж у диференційованих соматичних, і не екс-

пресується у мишачих ембріональних фібробластах фідерного шару (рис. 4).

Експресія 0^4 є вагомим свідченням плюрипотентності отриманих клітин. Проте оскільки цей фактор міститься у репрогра-мувальній касеті, неможливо встановити, є ця експресія ендогенною чи ектопічною. Тому для доведення плюрипотентості одержаних клонів ми провели дослідження для виявлення інших маркерів.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Рис. 4. Імуногістохімічне забарвлення експресії Oct4 у фіксованих колоніях (червоний колір):

ядра клітин забарвлено Hoechst 33342 (DAPI, синій колір), накладання зображень (MERGE, фіолетовий)

Експресія маркерів плюрипотентності на транскрипційному рівні

Свідченням репрограмування є не лише експресія класичних факторів плюрипотентості (відомих як «фактори Яманака»), що, як правило, містяться у репрограмувальній касеті [1, 2, 6]. Репрограмування є складним і недостатньо вивченим процесом, що супроводжується активацією ендогенних факторів, які підтримують плюрипотентність [20].

У трьох різних клонах — 6, Т і 9 — досліджено експресію маркерів плюрипотентності Oct4, Sox2, Nanog i Rex1 на транскрипційному рівні методом RT-PCR. Згідно з отриманими результатами гени Oct4 та Sox2 екс-пресуються однаково інтенсивно, як і ген «домашнього господарства» GAPDH, в усіх досліджуваних клонах і клітинних лініях. Проте варто зазначити, що ці гени входять до репрограмувальної касети, що, власне, індукувала репрограмування, тому за даними досліджень (як і попереднього імуноци-тохімічного забарвлення Oct4) неможливо встановити, чи експресуються гени із власного геному, чи з репрограмувальної екзогенної конструкції.

Оскільки репрограмування супроводжується зміною експресії генів, зокрема реак-тивацією експресії ендогенних факторів плюрипотентності [20], нами було досліджено експресію в отриманих клонах генів, що не входили до репрограмувальної конструкції — Nanog та Rex1. Nanog експресується виключно у недиференційованих клітинах [21]. В одержаних у цій роботі клонах виявлено реактивацію експресії Nanog, причому цей маркер експресується достатньо інтенсивно — на рівні Oct4 і Sox2 та контрольної лінії (рис. 5). Експресія іншого маркера — Rex1 в отриманих клонах порівняно із контрольними лініями дещо нижча. Однак Rex1 експресується менш інтенсивно і в контрольній лінії aPIG44 порівняно з реак-тивацією експресії Nanog. Низький рівень реактивації Rex1 може бути пов’язаний із неповним репрограмуванням, раннім пасажем та іншими особливостями одержаної клітинної лінії. Адже відомо, що спектр експресії генів є лінієспецифічним, тобто може варіювати в різних лініях іПСК.

Рис. 5. Експресія маркерів плюрипотентності в отриманих клонах та відомих лініях плюрипотентних стовбурових клітин на рівні мРНК

Таким чином, показано експресію ключових факторів плюрипотентості Oct34

і Sox 2 на рівні мРНК-транскриптів та протеїну, реактивацію експресії ендогенних факторів плюрипотентності — Rex1, Nanog

і SSEA-1. Рівень експресії останнього істотно варіював у різних клонах, однак у більшості досягав рівня, характерного для контрольної лінії ЕСК. Реактивація експресії ендогенни-их факторів плюрипотентності є свідченням

репрограмування ембріональних фібробластів на рівні експресії генів. Відповідність експресії досліжуваних показників контрольним лініям свідчить про плюрипотен-тність отриманих клітин. Одержані внаслідок репрограмування фібробластів клони потребують подальшого вивчення на предмет їх функціонального потенціалу. Однак згідно з отриманими результатами ці клони можна вважати потенційною лінією іПСК. З огляду на низку переваг цього методу система транспозонів Sleeping beauty є новим

перспективним способом одержання іПСК, що має значення для розвитку біотехнології стовбурових клітин.

Автори вдячні співробітникам Центру молекулярної медицини Макса-Дельбрука, м. Берлін (Німеччина), за люб’язно надану систему плазмід Sleeping beauty, а також Томо Саричу та Юргену Хешелеру (Інститут нейрофізіології університету м. Кельн, Німеччина), за надану можливість здійснення ключових етапів роботи.

ЛІТЕРАТУРА

1. Takahashi K, Yamanaka S. Induction of plu-ripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors // Cell. — 2006. — V. 126. — P. 663-676.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

2. Takahashi K., Tanabe K., Ohnuki M. et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors // Ibid. — 2007. — V. 131. — P. 861-872.

3. Ebben J. D., Zorniak M., Clark P. A. et al. Introduction to induced pluripotent stem cells: advancing the potential for personalized medicine // World Neurosurg. — 2011. — V. 76. — P. 270-275.

4. Vitalea A M., Wolvetangb E., Mackay-Sima A Induced pluripotent stem cells: A new technology to study human diseases // Int. J. Bio -chem. Cell Biol. — 2011. — V. 43. — P. 843-846.

5. Ohm J. E., Mali P., van Neste L. et al. Cancer-Related Epigenome Changes Associated with Reprogramming to Induced Pluripotent Stem Cells // Cancer Res. — 2010. — V. 70. — P. 7662-7673.

6. Sommer C. A., Stadtfeld M., Murphy G. J. et al. Induced pluripotent stem cell generation using a single lentiviral stem cell cassette // Stem Cells. — 2009. — V. 27. — P. 543-549.

7. Zhou W., Freed C. R. Adenoviral gene delivery can reprogram human fibroblasts to induced pluripotent stem cells // Ibid. — 2009. — V. 27. — P. 2667-2674.

8. Okita K., Matsumura Y., Sato Y. et al. A more efficient method to generate integration-free human iPS cells // Nat. Meth. — 2011. — V. 8. — P. 40-412.

9. Plews J. R., Li J., Jones M. et al. Activation of pluripotency genes in human fibroblast cells by a novel mRNA based approach // PLoS One. — 2010. — V. 5. — e14397. doi: 10.1371/ journal.pone.0014397 ...

10. Jin J., Kwon Y. W., Paek J. S. et al. Analysis of differential proteomes of induced pluripo-tent stem cells by protein-based reprogramming of fibroblasts // J. Proteome Res. —

2011. — V. 10. — P. 977-989.

11. Meir Y. J., Wu S. C. Transposon-based vector systems for gene therapy clinical trials: challenges and considerations // Chang Gung Med. J. — 2011. — V. 34. — P. 565-579.

12. Donnelly M. L., Hughes L. E., Luke G. et al.

The ‘cleavage’ activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring ‘2A-like’ sequences // J. Gen. Virol. — 2001. — V. 82. —

P. 1027-1041.

13. Naujok O., Kaldrack J., Taivankhuu T. et al. Selective removal of undifferentiated embryonic stem cells from differentiation cultures through HSV1 thymidine kinase and ganciclovir treatment // Stem Cell Rev. — 2010. — V. 6. — P. 450-461.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

14. Chen J., Liu J., Chen Y. et al. Rational optimization of reprogramming culture conditions for the generation of induced pluripo-tent stem cells with ultra-high efficiency and fast kinetics // Cell Res. — 2011. — V. 21. — P. 884-894.

15. Khodadadi K., Sumer H., Pashaiasl M. et al. Induction of pluripotency in adult equine fibroblasts without c-MYC // J. Stem Cells Int. — 2012. — V. 2012: 429160. doi: 10.1155/2012/429160.

16. Sterneckert J., Hoing S., Scholer H. R. Concise review: Oct4 and more: the reprogramming expressway // Stem Cells. —

2012. — V. 30. — P. 15-21.

17. Nemajerova A., Kim S. Y., Petrenko O. et al. Two-factor reprogramming of somatic cells to pluripotent stem cells reveals partial functional redundancy of Sox2 and Klf4 // Cell Death Differ. — 2012. — V. 19. — P. 1268-1276.

18. Wu T., Wang H., He J. et al. Reprogramming of trophoblast stem cells into pluripotent stem cells // Stem Cells. — 2011. — V. 29. — P. 755-763.

19. Yuan X., Wan H., Zhao X. et al. Combined chemical treatment enables Oct4-induced reprogramming from mouse embryonic fib-

roblasts // Ibid. — 2011. — V. 29(3) — P. 549-553.

20. Page R. L., Ambady S., Holmes W. F. et al. Induction of stem cell gene expression in adult human fibroblasts without transgenes // Ibid. — 2009. — V. 11. — P. 417-426.

21. Hatano S. Y., Tada M., Kimura H. et al. Pluripotential competence of cells associated with Nanog activity // Mech. Dev. — 2005. — V. 122. — P. 67-79.

ЭКСПРЕССИЯ МАРКЕРОВ ПЛЮРИПОТЕНТНОСТИ ПРИ РЕПРОГРАММИРОВАНИИ ФИБРОБЛАСТОВ МЫШИ С ИСПОЛЬЗОВАНИЕМ СИСТЕМЫ ТРАНСПОЗОНОВ

С. В. Малышева1- 2 Н. М. Билько1 Ю. Хешлер2

Национальный университет «Киево-Могилянская академия», Киев, Украина

2Институт нейрофизиологии Кельнского университета, Кельн, Германия

E-mail: smalysheva@gmail.com

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Поиск эффективных и безопасных методов получения плюрипотентных стволовых клеток чрезвычайно актуален. В работе эмбриональные фибробласты мыши репрограммиро-ваны в пролиферирующие колонии с типичной морфологией индуцированных плю-рипотентных стволовых клеток с помощью векторной системы транспозонов Sleeping beauty. В полученных клонах исследована экспрессия различных маркеров плюрипотен-тности — щелочной фосфатазы, генов Oct4 и Sox2; оценен уровень экспрессии поверхностного маркера плюрипотентности SSEA-1 в отдельных клонах клеточной линии. Показана также реактивация экспрессии эндогенных факторов плюрипотентности Nanog и Rex1. Полученные данные проанализированы и сопоставлены с показателями исходной линии эмбриональных фибробластов и зарегистрированной линии плюрипотентных стволовых клеток. Показано, что с помощью системы транспозонов Sleeping beauty осуществляется репрограммирование соматических клеток в индуцированные плюрипотентные. Таким образом, эта система репрограммирования является новым перспективным инструментом в биотехнологии получения плюрипотен-тных клеток.

Ключевые слова: индуцированные плюрипо-тентные стволовые клетки, репрограммирование, маркеры плюрипотентности.

EXPRESSION OF PLURIPOTENCY MARKERS IN MURINE FIBROBLASTS REPROGRAMMING BY TRANSPOSON SYSTEM

S. V. Malysheva1' 2 N. M. Bilko1 J. Hescheler2

1National University of «Kyiv-Mohylanska Academy», Kyiv, Ukraine

2Institute of Neurophysiology' University of Cologne, Cologne, Germany

E-mail: smalysheva@gmail.com

The search for effective and safe methods to generate induced pluripotent stem cells is especially urgent. In the paper murine embryonic fibroblasts were reprogrammed towards actively proliferating colonies with typical induced pluri-potent stem cells morphology by means of Sleeping beauty transposon-based vector system. The obtained clones were checked for the expression of various pluripotency markers: alkaline phosphatase, Oct4 and Sox2 genes, SSEA-1 expression in various clones was evaluated. Also the reactivation of endogenous pluripo-tency factors Nanog and Rex1 was indicated. The data obtained is analyzed and compared to the established pluripotent stem cell line. It is shown that somatic cells are reprogrammed towards pluripotency by means of Sleeping beauty transposon system. Therefore, the system is a new perspective biotechnological tool to generate pluripotent cells.

Key words: induced pluripotent stem cells, reprogramming, pluripotency markers.