Научная статья на тему 'Прогностическое значение мутаций гена ТР53 при программном лечении больных острыми лейкозами'

Прогностическое значение мутаций гена ТР53 при программном лечении больных острыми лейкозами Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
873
112
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
ГЕН ТР53 / МУТАЦИЯ / ОСТРЫЙ МИЕЛОИДНЫЙ ЛЕЙКОЗ / ОСТРЫЙ ЛИМФОБЛАСТНЫЙ ЛЕЙКОЗ / СЕКВЕНИРОВАНИЕ / GENE TP53 / MUTATION / ACUTE MYELOID LEUKEMIA / ACUTE LYMPHOBLASTIC LEUKEMIA / SEQUENCING

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Виноградов Александр Владимирович, Резайкин Алексей Васильевич, Сергеев Александр Григорьевич

Проанализированы частота, структурные особенности и прогностическое значение мутаций гена ТР53 при острых миелоидных и лимфобластных лейкозах. Детекцию мутаций осуществляли с использованием метода прямого автоматического секвенирования. Установлено, что средняя частота мутаций TР53 при остром миелобластном лейкозе составляет 9,7% и различается в зависимости от цитогенетического варианта и наличия других генетических аномалий. Максимальная частота мутаций TР53 (60%) выявлена при остром миелобластном лейкозе с комплексными хромосомными аберрациями. При остром миелобластном лейкозе с экспрессией специфических химерных генов и/или мутациями генов FLT3, NPM1, KIT, N-RAS, WT повреждения экзонов 4—11 ТР53 не определялись. Частота мутаций ТР53 при остром лимфобластном лейкозе составила 21,1%, при этом во всех случаях определялся диплоидный кариотип. В одном наблюдении выявлена кооперация трансверсии с.250G>T экзона 4 гена ТР53 с повреждениями экзона 2 гена CDKN2A/ARF. Прогноз программного лечения острых лейкозов с мутациями ТР53 был крайне неблагоприятным: медиана общей продолжительности жизни пациентов не превышала 3 мес.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Виноградов Александр Владимирович, Резайкин Алексей Васильевич, Сергеев Александр Григорьевич

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

PROGNOSTIC IMPACT OF TP53 MUTATIONS IN THE TREATMENT OF ACUTE LEUKEMIA

The paper analyzes frequency, structural features and prognostic impact of TP53 mutations in acute myeloid and lymphoblastic leukemias. The mutations were detected by direct automatic sequencing. Average frequency of TP53 mutations in acute myeloblastic leukemia was 9.7% and varied in different cytogenetic disease types and in the presence of other genetic abnormalities. Frequency of TP53 mutations reached maximum (60%) in acute myeloblastic leukemia with complex chromosomal aberrations. There was no damage in TP53 exons 4 to 11 in acute myeloblastic leukemia with expression of specific chimeric genes and/or mutations of FLT3, NPM1, KIT, N-RAS, WT. Frequency of TP53 mutations in acute lymphoblastic leukemia was 21.1% and all these cases belonged to diploid karyotype. Cooperation of c.250G>T transversion of TP53 exon 4 with damage in exon 2 of CDKN2A/ARF was detected in one case. Acute leukemias with TP53 mutations had very poor prognosis with median survival not exceeding than 3 months.

Текст научной работы на тему «Прогностическое значение мутаций гена ТР53 при программном лечении больных острыми лейкозами»

Александр Владимирович Виноградов', Алексей Васильевич Резайкин2, Александр Григорьевич Сергеев3

ПРОГНОСТИЧЕСКОЕ ЗНАЧЕНИЕ МУТАЦИЙ ГЕНА ТР53 ПРИ ПРОГРАММНОМ ЛЕЧЕНИИ БОЛЬНЫХ ОСТРЫМИ ЛЕЙКОЗАМИ

' К. м. н., научный сотрудник, центральная научно-исследовательская лаборатория ГБОУ ВПО Уральская государственная медицинская академия Минздрава России (620028, РФ, г. Екатеринбург, ул. Репина, д. 3) 2 Ассистент, кафедра микробиологии, вирусологии и иммунологии ГБОУ ВПО Уральская государственная медицинская академия Минздрава России (620028, РФ, г. Екатеринбург, ул. Репина, д. 3) 3 Д. м. н., профессор, заведующий, кафедра микробиологии, вирусологии и иммунологии; научный руководитель, лаборатория молекулярной диагностики ГБОУ ВПО Уральская государственная медицинская академия Минздрава России (620028, РФ, г. Екатеринбург, ул. Репина, д. 3)

Адрес для переписки: 620028, РФ, г. Екатеринбург, ул. Репина, д. 3, УГМА, ЦНИЛ, Виноградов Александр Владимирович; e-mail: vinogradov-av@russia.ru

Проанализированы частота, структурные особенности и прогностическое значение мутаций гена ТР53 при острых миелоидных и лимфобластных лейкозах. Детекцию мутаций осуществляли с использованием метода прямого автоматического секвенирования. Установлено, что средняя частота мутаций ТР53 при остром миелобластном лейкозе составляет 9,7% и различается в зависимости от цитоге-нетического варианта и наличия других генетических аномалий. Максимальная частота мутаций ТР53 (60%) выявлена при остром миелобластном лейкозе с комплексными хромосомными аберрациями. При остром миелобластном лейкозе с экспрессией специфических химерных генов и/или мутациями генов FLT3, NPM', KIT, N-RAS, WT повреждения экзонов 4—11 ТР53 не определялись. Частота мутаций ТР53 при остром лимфобластном лейкозе составила 21,1%, при этом во всех случаях определялся диплоидный кариотип. В одном наблюдении выявлена кооперация трансверсии ^250G>T экзона 4 гена ТР53 с повреждениями экзона 2 гена CDKN2A/ARF. Прогноз программного лечения острых лейкозов с мутациями ТР53 был крайне неблагоприятным: медиана общей продолжительности жизни пациентов не превышала 3 мес.

Ключевые слова: ген ТР53, мутация, острый миелоидный лейкоз, острый лимфобластный лейкоз, секвенирование.

Ген ТР53, кодирующий опухолевый супрессор, расположен на коротком плече 17-й хромосомы (район 17р13.1), состоит из 11 экзонов и имеет протяженность 19144 нуклеотидных пар. Основной мРНК-транскрипт гена длиной 2586 нуклеотидов включает 5'-нетрансли-руемый регион, соответствующий экзонам 1 и 2, 3'-не-транслируемый регион, соответствующий экзону 11, и кодирующую последовательность, считывающуюся с экзонов 2—11 и транслируемую в белковый продукт, содержащий 393 аминокислотных остатка. Кодируемый геном белок р53 экспрессируется во всех тканях организма и формирует связывающиеся с ДНК гомотетрамеры. Период полураспада белка составляет около 20 мин, так как в нормальных условиях он подвергается зависимой от MDM2 и опосредованной убиквитином протеасомной деградации. Стабилизация белкового продукта достигается при определенных условиях за счет посттрансляционных модификаций полипептида — фосфорилирова-

© Виноградов А. В., Резайкин А. В., Сергеев А. Г., 2013 УДК 616-006.446-037:575.24/.25

ния, ацетилирования, метилирования, SUMOилирования и NEDDилирования [1—4].

Белок р53 является транскрипционным фактором и вызывает опухолевую супрессию посредством регуляции экспрессии генов, приводящих либо к остановке клеточного цикла в сверочных точках G1/S и S/G2, либо к программируемой гибели клетки (апоптозу). В структуре полипептида р53 выделяют домены: трансактивацион-ный (аминокислотные остатки 1—64), пролиновый (63— 97) и ДНК-связывающий (94—292), — а также сигнал ядерной локализации (305—322) и олигомеризационный (319—359) и основной/репрессорный домены (360—393). Связывание гомотетрамеров р53 с ДНК происходит в участках, содержащих палиндромную последовательность

PuPuPuC(A/T)(A/T)GPyPyPy-(Nn)-PuPuPuC(A/T)(A/T)GPyPyPy, где Pu — пурины, а Py — пиримидины [1—4].

Мутациями гена ТР53 сопровождаются более 50% злокачественных новообразований, в том числе лейкозы и лимфомы. Мутации в основном представлены несинони-

мичными нуклеотидными заменами, приводящими к нарушению связывания белка с ДНК [4; 5]. Тем не менее до недавнего времени роль гена ТР53 в патогенезе острых лейкозов (ОЛ) представлялась неопределенной. Ее связывали главным образом с развитием вторичных опухолей, плохо поддающихся программной полихимиотерапии. Патогенез первичных острых миелоидных лейкозов (ОМЛ) объясняла двухшаговая модель, отводившая ключевую роль в злокачественной трансформации клеток-предшественниц гемопоэза продуктам химерных генов, мутантным тирозинкиназам, а также точковым мутациям генов CEBPA и NPM1 [6—9]. Однако за последние 3 года рядом исследователей была установлена повышенная частота мутаций гена ТР53 при ОМЛ с комплексными хромосомными аберрациями [10; 11]. Этими учеными предложена модель прогностической стратификации, базирующаяся на детекции молекулярных поломок, в том числе аномалий ТР53 [12]. В соответствии с ней мутации гена ТР53 определялись у 9,5% больных ОМЛ и были ассоциированы с крайне неблагоприятным прогнозом. Несмотря на это, клинико-диагностическое значение мутаций гена ТР53 при ОЛ остается неопределенным, в том числе при различных морфологических и иммунофено-типических вариантах ОЛ, а также при сочетании мутаций гена ТР53 с другими молекулярно-генетическими и хромосомными аномалиями [4; 11; 12].

Цель исследования — определить частоту, структурные особенности и прогностическое значение мутаций гена ТР53 при ОЛ в зависимости от морфологического варианта и цитогенетического статуса, а также наличия комбинированных повреждений генов FLT3, NPM1, KIT, N-RAS, WT1 и CDKN2A/ARF.

МАТЕРИАЛЫ И МЕТОДЫ

Исследованы пробы костного мозга и периферической крови больных ОЛ (n = 91), которые проходили программное лечение в Свердловском областном онкоге-матологическом центре (г. Екатеринбург) в период с 2008 по 2012 г. Из всех обследованных больных у 72 был ОМЛ, у 19 — острый лимфобластный лейкоз (ОЛЛ). Средний возраст пациентов с ОМЛ составил 55,3 ± 3,5 года, с ОЛЛ — 35,7 ± 6,9 года. Доля больных в возрасте 60 лет или старше составила при ОМЛ 48,6%, при ОЛЛ — 5,3%.

Диагностику ОЛ осуществляли, в соответствии с рекомендациями ВОЗ, на основании клинической картины и анализа крови и костного мозга, а также на основании цитохимического и иммунофенотипического исследования бластных клеток [13]. По показаниям выполняли трепанобиопсию подвздошной кости с последующим гистологическим и иммуногистохимическим исследованием. Морфологический вариант ОМЛ определяли в соответствии с франко-американо-британской (FAB) классификацией. Вариант М0 по FAB-классификации был выявлен у 3 пациентов, М1 — у 5, М2 — у 32, М3 — у 6, М4 — у 18, М4эо — у 3, М5 — у 1, М6 — у 3, острый миелофиброз (ОМФ) — у 1 пациента. Диагностику варианта ОЛЛ выполняли в соответствии с рекомендациями ВОЗ [13]. Иммунофенотипический вариант BI был определен в 6 случаях, В11 — в 9 случаях. На долю В!У, TI, TII и недифференцированного ОЛЛ пришлось по одному наблюдению.

Программное лечение больных ОЛ проводили по протоколам, разработанным Российской группой по изучению острых лейкозов [14]. В основе всех исследовательских протоколов лежал принцип интенсивной индукции-консолидации ремиссии с последующей по-стремиссионной поддерживающей полихимиотерапией. Основой программного лечения ОМЛ являлось комбинированное назначение на этапе индукции-консолидации циторабина и антрациклиновых антибиотиков (протоколы ОМЛ 06.06, ОМЛ 01.10, протокол программной химиотерапии для больных старше 60 лет). При остром промиелоцитарном лейкозе использовали протоколы ОПЛ 01.08 и AIDA, включавшие также полностью транс-ретиноевую кислоту. Больным ОЛЛ лечение проводили либо по протоколу «ALL-2009» (для лиц моложе 55 лет), либо винкристином в сочетании с преднизолоном, а при иммунофенотипе ОЛЛ BIV — блоками А и С по протоколу «ЛБ-М-04» [14].

В исследуемой группе всем пациентам выполнено цитогенетическое и/или молекулярно-генетическое исследование (полимеразная цепная реакция — ПЦР), прямое автоматическое секвенирование экзонов 4—11 гена ТР53 [15]. Кроме того, у больных ОМЛ в 63 пробах для выявления мутаций исследованы экзоны 12—15 и 19—21 гена FLT3, в 48 пробах — экзоны 9—12 гена NPMl, в 44 пробах — экзоны 7—12 и 16—19 гена KIT, в 32 пробах — экзоны 1—4 гена N-RAS, в 34 пробах — экзоны 6—9 гена WTl [16]. При ОЛЛ в 9 пробах исследованы мутации экзонов 1—2 гена CDKN2A, а также выполнен анализ альтернативной рамки считывания гена ARF, перекрывающейся с кодирующей последовательностью CDKN2A в области экзона 2 [17; 18]. Праймеры, фланкирующие участки кДНК, которые соответствуют перечисленным экзонам указанных генов, разработаны с использованием депонированных в GenBank нуклеотидных последовательностей (табл. 1) [16].

Секвенирование ДНК проводили на автоматическом генетическом анализаторе ABI Prism 310 с использованием реакционной смеси ABI Prism BigDye Terminator Cycle Sequencing Kit v.3.0 («Applied Biosystems», США). Сопоставление сегментов, выравнивание и сравнение последовательностей нуклеотидов и аминокислот проводили с использованием компьютерной программы MEGA, версия 3.1.

Статистическую обработку данных проводили на ЭВМ с помощью программы «Генанализ». Для проверки статистических гипотез использовали точный критерий Фишера. Доверительные интервалы (ДИ) для средних частот мутаций гена ТР53 определены с вероятностью 95% на основе биномиального распределения. Оценку взаимозависимости молекулярных повреждений TP53 и CDKN2A/ ARF, выявляемых в одной пробе одновременно, проводили посредством сравнения ожидаемой частоты, рассчитанной по формуле для независимых событий, с частотой, наблюдаемой в исследуемой выборке. Если при сопоставлении расчетной и наблюдаемой частот выявляли совпадение, то считали мутации независимыми. Если наблюдаемая частота отличалась от расчетной при уровне значимости р = 0,05, то события признавали взаимозависимыми. Вероятностную выживаемость пациентов оценивали с помощью актуариального метода по Каплану—Мейеру.

Таблица 1

Последовательности праймеров, использованные для амплификации и секвенирования исследуемых участков генов CDKN2A, FLT3, KIT, NPM1, N-RAS, TP53, WT1

Анализ биологической значимости мутаций гена ТР53, в том числе влияния аминокислотных замен и деле-ций на структуру и функцию кодируемого белка, проводили с использованием инструментов и протоколов баз данных IARC TP53 Database (R16, November 2012) [19] и The TP53 UMD mutation database in human cancer (2012 release) [5]. Мутации генов CDKN2A и ARF исследовали с помощью UVM BioDesktop CDKN2a Database [18].

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Установлено, что функционально значимые, т. е. приводящие к снижению активности кодируемого белка, мутации гена ТР53 при острых миелоидных и лимфобласт-ных лейкозах выявлялись с частотой 9,7% (при 95% ДИ от 4,3 до 19,2%) и 21,1% (при 95% ДИ от 8,1 до 43,7%) соответственно. В случае ОМЛ эти мутации определялись при морфологических вариантах М2 (n = 4), М4 (n = 1) и М6 (n = 2), при ОЛЛ — при иммунофенотипических вариантах В1 (n = 2), В4 и Т1 (по одному случаю), что можно объяснить малым объемом исследуемой выборки.

Результаты детекции мутаций экзонов 4—11 гена ТР53 при ОМЛ в зависимости от цитогенетического и морфологического варианта представлены в табл. 2. Оказалось, что частота мутаций достоверно различалась в различных цитогенетических подгруппах ОМЛ и была максимальной при комплексных хромосомных аберрациях (60%). При этом в 3 случаях из 6 указанные аномалии кариотипа включали перестройки короткого плеча 17-й хромосомы. Лишь в одном наблюдении при ОМЛ М2 транзиция c.377A>G обнаруживалась в лейкоз-ных бластах с нормальным кариотипом (5%; р = 0,003). Средний возраст больных ОМЛ с мутациями гена ТР53 составил 62,6 ± 2,5 года.

Случаев одновременной детекции мутаций ТР53 и других специфических генетических аномалий, таких, как транслокации t(8;21), t(15;17), t(9;22), t(3;3), t(6;11), t(11;19) и инверсия inv(16), при ОМЛ не зафиксировано (p = 0,001). Мутации гена ТР53 не определялись и у пациентов с прочими структурными и количественными хромосомными аберрациями (p = 0,005). В одном случае при остром эритромиелозе с комплексными хромосомными аберрациями и расщеплением на 4 субклона с различными цитогенетическими характеристиками предположено наличие в 3 из них Ph-хромосомы, однако при ПЦР-анализе химерные транскрипты BCR-ABL не обнаруживались.

При параллельном исследовании проб на ТР53 и другие прото- и антионкогены методом прямого секвениро-вания не удалось выявить кооперации мутаций гена ТР53 с повреждениями генов FLT3 (экзоны 12—15 и 19—21), NPM' (экзоны 9—12), KIT (экзоны 7—12 и 16—19), N-RAS (экзоны 1—4) и WT' (экзоны 6—9), в то время как указанные кооперации выявлялись у 12,7; 14,6; 6,8; 12,5 и 3,2% больных ОМЛ соответственно (р = 0,0002).

В одном случае при ОМЛ М2эо с кариотипом 45, XY, del(2)(q), iso(9)(q), r(12), del(17)(q), add(19)(p), -15 одновременно определялись две несинонимичные транзиции кодирующей последовательности гена ТР53 — c.292C>T и c.817C>T. Первая из них обусловливала аминокислотную замену p.98P>S, т. е. замену пролина на серин в 98-й позиции пролинового домена белка р53, вторая —

Название Последовательность

FLT-ITD-F б' TGT TCAGAC AAG TCT CCC AAC TGC 3'

FLT-ITD-R б' CAT CTT GAG TTC TGA CAT GAG TGC C 3'

FLT-TK-F 5' AAG ATC TTC TTT GCT TTG CAT ATC A 3'

FLT-TK-R 5' GGA ATG CCA GGG TAA GGA TT 3'

KIT1-F 5' CCG AAG GAG GCA CTT ACA C 3'

KIT1-R 5' GCA GGC TCC AAG TAG ATT CA 3'

KIT2-F 5' CAA CCA AGG CCG ACA A 3'

KIT2-R 5' ACT TAG AAT CGA CCG GCA TT 3'

KIT1-SF 5' TCA ATG CTG CCA TAG 3'

KIT2-SF 5' TGA CTC CCG CCA TCA 3'

KN-F 5' GCGTCCCCTTGCCTGGAAAGATACC 3'

KN-R 5' TGAGGGACCTTCCGCGGCATCTAT 3'

KN-SF 5' ACAGGGTCGGAGGGGGCTCT 3'

KN-SR 5' GCATCTATGCGGGCATGGTT 3'

NPM1-F 5' AGGAAGCTGAAGAAAAAGCG 3'

NPM1-R 5' GGACAGCCAGATATCAACTG 3'

NPM1-S1 5' GGACAAGAATCCTTCAAGAA 3'

NRAS-F 5' GTT CAT GGC GGT TCC 3'

NRAS-R 5' GGC GTA TTT CTC TTA CCA GT 3'

NRAS-S 5' CGG CTG TGG TCC TAA ATC TG 3'

P53-F 5' AGTCAG ATC CTAGCG TCG AG 3'

P53-R 5' TGG CGG GAG GTA GAC TG 3'

P53-S1 5' ACA TTT TCA GAC CTA TGG AA 3'

P53-S2 5' GCG CCA TGG CCA TCT ACA AG 3'

P53-S3 5' ACC CTT TTT GGA CTT CAG GT 3'

WT1-F 5' ACC CAG GCT GCA ATA AGA 3'

WT1-R 5' AGG AGG AGT GGA GAG TCA GA 3'

WT1-S 5' TAA GCT GTC CCA CTT ACA GA 3'

Таблица 2

Результаты детекции мутаций гена ТР53 при ОМЛ

Морфологический Число пациентов

классификации FAB Кариотип всего/мутантный ТР53 полиморфизм С215G значимые мутации синонимичные замены

Нормальный 1/0 1 0 0

МО Неизвестен 2/0 2 0 0

Всего МО 3/0 3 0 0

Нормальный 2/0 2 0 0

М1 +8 1/0 1 0 0

Неизвестен 2/0 2 0 0

Всего М1 5/0 5 0 0

Нормальный 8/1 3 1 0

1(8;21) 2/0 2 0 0

ту(16) 1/0 1 0 0

1(3;3) 1/0 1 0 0

1(б;11) 1/0 1 0 0

1(9;22) 1/1 0 0 1

М2 1(7) 1/0 1 0 0

+8 2/0 2 0 0

+8, +21 1/0 1 0 0

+ 13 1/0 1 0 0

-У 1/0 1 0 0

Комплексные 5/3 4 3 0

Неизвестен 7/0 6 0 0

Всего М2 32/5 24 4 1

М3 1(15;17) 6/0 6 0 0

Нормальный 9/1 8 0 1

ту(16) 1/0 1 0 0

ту(9) 1/0 1 0 0

М4 -5 1/0 1 0 0

Комплексные 2/1 2 1 0

Неизвестен 4/0 3 0 0

Всего М4 18/2 16 1 1

Таблица 2 (окончание)

ту(16) 1/0 1 0 0

М4эо 1(11;19) 1/0 1 0 0

+8 1/0 1 0 0

Всего М4эо 3/0 3 0 0

М5 Нормальный 1/0 0 0 0

М6 Комплексные 3/2 0 2 0

ОМФ Неизвестен 1/0 1 0 0

Всего ОМЛ 72/9 58 7 2

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

замену аргинина на цистеин в позиции 273 (p.273R>C) ДНК-связывающего домена. В остальных случаях были выявлены одиночные мутации, также приводившие к изменениям структуры ДНК-связывающего домена и инактивации белка р53. Эти мутации были представлены тремя транзициями (c.377A>G, c.659A>G, с.817С>Т), двумя трансверсиями (c.733G>T, с.84Ю>Т) и одной мутацией со сдвигом рамки считывания за счет делеции тимидина в позиции 645 (c.645delG) кодирующей последовательности ТР53. При этом мутации с.292С>Т (экзон 4), c.377A>G (экзон 5), c.645delG (экзон 6) и с.84Ю>Т (экзон 8) выявлены при ОМЛ впервые. Нуклеотидные замены c.659A>G (экзон 6), c.733G>T (экзон 7) и с.817С>Т (экзон 8) описаны в литературе и соответствуют «горячим точкам» кодирующей последовательности ДНК-связывающего домена, представленным в том числе CpG-динуклеотидами (c.733G>T и с.817С>Т) [5; 19; 20]. Кариотипы лейкозных клеток пациентов с указанными аномалиями приведены в табл. 3. Таким образом, наиболее частой мутацией гена ТР53 при ОМЛ оказалась транзиция с.817С>Т (2,8%), встречавшаяся как в виде изолированного повреждения, так и в сочетании с заменой с.292С>Т.

Влияние мутаций гена ТР53 на прогноз ОМЛ оказалось крайне неблагоприятным. Все пациенты с мутант-ным р53 были резистентны к программной полихимиотерапии, и случаев достижения клинико-гематологических ремиссий не отмечалось. Медиана общей продолжительности жизни больных не превышала 3 мес. В группе сравнения (больные ОМЛ без мутаций гена ТР53) годичная вероятностная выживаемость составила 28,8 ± 6,1%, медиана общей продолжительности жизни — 6 мес.

Синонимичные транзиции c.639A>G и с.891С>Т были выявлены у 2 (2,8%) пациентов: в одном случае — при ОМЛ М2 с экспрессией химерного транскрипта BCR-ABL вследствие реципрокной транслокации ^9;22) по малому кластеру разрыва (т-Ьсг) в интроне 1 гена BCR, обусловливающей синтез мутантной тирозинкина-зы р190; в другом случае — при ОМЛ М4 без выявленных хромосомных и молекулярных повреждений.

Несинонимичная замена c.215C>G, которая рассматривается в качестве полиморфного аллеля гена [3; 5; 19] и сопровождается аминокислотной заменой p.72P>R,

определялась в 58 (80,6%) пробах, в том числе изолированная — в 56 (77,8%) пробах. Последовательность мРНК ТР53 «дикого» типа, соответствующая NM_000546, GenBank NCBI, определялась при ОМЛ у 9 (12,5%) больных.

Средняя частота трансверсии c.215C>G при ОЛЛ составила 73,7% (п = 14), в том числе изолированной — 68,4% (п = 13). Синонимичных нуклеотидных замен экзонов 4—11 гена ТР53 при ОЛЛ не выявлено, что может быть обусловлено малым объемом выборки.

Функционально значимые мутации в экзонах 4—11 гена ТР53 определялись у 4 больных ОЛЛ в возрасте 24, 30, 32 и 73 лет и были представлены, соответственно, несинонимичными нуклеотидными заменами c.250G>Т, c.473G>A, c.527G>T и с.736А^ (см. табл. 3). При этом все аномалии, за исключением трансверсии c.250G>Т, затрагивали кодирующую последовательность ДНК-связывающего домена. В литературе имеется описание при ОЛЛ транзиции c.473G>A в «горячей точке» экзона 5, соответствующей CpG-динуклеотиду, а также транзиции c.736A>G (экзон 7) [5; 19; 20], тогда как трансверсии c.250G>Т (экзон 4) и c.527G>T (экзон 5) выявлены впервые. Во всех случаях цитогенетическим вариантом, при котором определялись мутации гена ТР53, была диплои-дия. При ОЛЛ с комплексными хромосомными аберрациями (п = 1) и специфическими транслокациями ^9;22) (п = 4) и Щ;19) (п = 1) мутации ТР53 не определялись.

В одной пробе при ОЛЛ Т1 с нормальным кариоти-пом бластов и трансверсией c.250G>Т экзона 4 гена ТР53 одновременно определялась делеция экзонов 1 и 2 гена CDKN2A протяженностью 202 нуклеотида со 134-й по 335-ю позицию от начала кодирующей последовательности, приводящая к сдвигу рамки считывания и инактивации кодируемого белка. Эта же делеция затрагивала ген ARF, мРНК которого кодируется экзоном 2 гена CDKN2A, но транслируется со смещением на — 1 нуклеотидную позицию [17; 18]. Это свидетельствует в пользу возможной кооперации мутантных продуктов генов ТР53 и CDKN2A/ ARF при злокачественной трансформации лейкозных клеток при ОЛЛ. Среди проб с последовательностью мРНК ТР53 «дикого» типа или полиморфным аллелем c.215C>G мутации гена CDKN2A выявлены в 3 случаях

Таблица 3

Варианты цитогенетических изменений при ОЛ с функционально значимыми мутациями экзонов 4—8 гена ТР53

Мутация гена ТР53 (вариант дефекта белка) Кариотип Вариант ОМЛ или ОЛЛ

ОМЛ

c.292C>T (p.98P>S), c.817C>T (p.273R>C) 45, XY del(2)(q), iso(9)(q), r(12), del(17)(q), add(19)(p), -15 М2эо

c.377A>G (p.126Y>C) 46, ХХ М2

c.645delG (фреймшифт) 47, XY del(3)(p12), del(5)(q31), add(17)(p13), -7, +21, +mar М2

c.659A>G (p.220Y>C) 46, ХХ, del(5q)(3.2), add(18p)(1.1.3) or t(5;18)(q2.3;p1.1)[6]/ 46, ХХ, del(17p) (1.2), add(18p)(1.1.3) or t(17;18)(p1.2;p1.1)[3]/ 47, ХХ, del(5q)(3.2), add(18p) (1.1.3) or t(5;18)(q2.3;p1.1), +mar[2]/ 46, ХХ[2] М6

c.733G>T (p.245G>C) 52, XYY, inv(3)(p12;q24), +1, +9, +11, +13, +19, +Y +mar М4

c.817C>T (p.273R>C) 40—45, XY del(4)(p14), -5, dup(7)(q11;q22), del(11)(q21), del(17)(p12), -19, +Ph, +mar 1—4[7]/ 41—45, XY del(4)(p14), -5, del(6)(q23), dup(7)(q11;q22), del(11) (q21), +Ph, +mar 1—3[6]/ 40—45, XY del(4)(p14), -5, dup(7)(q11;q22), del(11) (q21), inv(17)(q21;q25), -19, +Ph, +mar 1—4[5]/ 44, XY del(4)(p14), -5, dup(7) (q11;q21), -19, +Ph[2]a М6

c.841G>T (p.281D>Y) 42, X, addi(1)(q31), addi(12)(q24), del(15)(p12), addi(16)(p13), del(18)(?12), -3, -9, -13, -X М2

ОЛЛ

c.250G>T (p.84A>S) 46, XY TI

c.473G>A (p.158R>H) 46, ХХ BIV

c.527G>T (p.176C>F) 46, ХХа BI

c.736A>G (p.246M>V) 46, ХХа BI

а При ПЦР t(9;22) не обнаружена.

и представлены инсерцией в экзоне 1 (ОЛЛ В11, ^9;22) р190), делецией в экзонах 1 и 2 (ОЛЛ В1 с ^1;19), ТСГ3-РВХ1) и транзицией c.205G>A (ОЛЛ Т11 без выявленных молекулярных и хромосомных аномалий). В 2 последних наблюдениях мутации приводили к инактивации не только белка Cdkn2a, но и белка Аг^

Прогноз при ОЛЛ с наличием мутаций гена ТР53 был неблагоприятный. В 3 случаях (ОЛЛ В1, В11, Т1) пациенты оказались резистентными к программной полихимиотерапии, в одном наблюдении (ОЛЛ ВГУ", c.473G>A) была достигнута клинико-гематологическая ремиссия после первого блока полихимиотерапии по программе «ЛБ-М-04» [15], однако ее продолжительность составляла менее 6 мес. Медиана общей продолжительности жизни больных ОЛЛ с мутациями гена ТР53 не превышала 3 мес. В группе сравнения (больные ОЛЛ без мутаций гена ТР53) годичная вероятностная выживаемость составила 43,2 ± 13,6%, медиана общей продолжительности жизни — 7 мес.

ВЫВОДЫ

1. Частота мутаций в экзонах 4—11 гена ТР53 при ОМЛ в обследованной группе пациентов составила 9,7% и различалась в зависимости от кариотипа лейкозных бластов и наличия генетических аномалий в других исследованных прото- и антионкогенах.

2. Мутации гена ТР53 с высокой частотой (60%) определялись при ОМЛ с комплексными хромосомными аберрациями и не встречались при наличии других специфических молекулярных повреждений.

3. Частота аномалий гена ТР53 при ОЛЛ составляла 21,1%, при этом мутации были ассоциированы с диплоидным кариотипом, а также с повреждениями CDKN2A/ARF.

4. Наличие мутаций в гене ТР53 определяло неблагоприятный прогноз программного лечения в обследованной группе больных ОЛ. Медиана общей продолжительности жизни пациентов с мутантным р53 не превышала 3 мес.

ЛИТЕРАТУРА

1. Барлев Н. А. Роль сайт-специфического ацетилирования и метилирования в регуляции онкосупрессора р53 у человека: Дис... д-ра биол. наук. — СПб., 2009. — 142 с.

2. Многоликий р53: разнообразие форм, функций, опухоль-супрессирующих и онкогенных активностей / Копнин Б. П., Коп-нин П. Б., Хромова Н. В., Агапова Л. С. // Клин. онкогематол. — 2008. — Т. 1, №1. — С. 2—9.

3. Чумаков П. М. Белок р53 и его универсальные функции в многоклеточном организме // Успехи биол. хим. — 2007. — Т. 47. — С. 3—52.

4. Dysfunction of the TP53 tumor suppressor gene in lymphoid malignancies / Xu-Monette Z. Y., Medeiros L. J., Li Y., Orlowski R. Z., Andreeff M., Bueso-Ramos C. E., Greiner T. C., McDonnell T. J., Young K. H. // Blood. — 2012. — Vol. 119. — P. 3668—3683.

5. Data-driven unbiased curation of the TP53 tumor suppressor gene mutation database and validation by ultradeep sequencing of human tumors / Edlund K., Larsson O., Ameur A., Bunikis I., Gyllensten U., Leroy B., Sundstrom M., Micke P., Botling J., Soussi T. // Proc. Natl. Acad. Sci. USA. — 2012. — Vol. 109. — P. 9551—9556.

6. Comprehensive analysis of cooperative gene mutations between class I and class II in de novo acute myeloid leukemia / Ishikawa Y., Ki-yoi H., Tsujimura A., Miyawaki S., Miyazaki Y., Kuriyama K., Tomona-ga M., Naoe T. // Eur. J. Haematol. — 2009. — Vol. 83. — P. 90—98.

7. Cooperating gene mutations in acute myeloid leukemia: a review of the literature / Renneville A., Roumier C., Biggio V., Nibourel O., Bois-sel N., Fenaux P., Preudhomme C. // Leukemia. — 2008. — Vol. 22. — P. 915—931.

8. Myeloid malignancies: mutations, models and management / Murati A., Brecqueville M., Devillier R., Mozziconacci M. J., Gelsi-Boy-er V., Birnbaum D. // BMC Cancer. — 2012. — Vol. 12. — P. 304.

9. Takahashi S. Current findings for recurring mutations in acute myeloid leukemia // J. Hematol. Oncol. — 2011. — Vol. 4. — P. 36.

10. A comparative analysis of TP53 gene mutations in acute myeloid and lymphoblastic leukemia patients / Vinogradov A. V., Rezaikin A. V., Sergeev A. G., Konstantinova T. S., Sveshnikova J. V., Sharov L. N., Vino-gradova N. V. // Cel. Ther. Transplantat. — 2011. — Vol. 3, N 11. — P. 114.

11. TP53 alterations in acute myeloid leukemia with complex karyotype correlate with specific copy number alterations, monosomal karyotype, and dismal outcome / Rücker F. G., Schlenk R. F., Bullinger L., Kayser S., Teleanu V., Kett H., Habdank M., Kugler C. M., Holzmann K.,

Gaidzik V. I., Paschka P., Held G., von Lilienfeld-Toal M., Lubbert M., Frohling S., Zenz T., Krauter J., Schlegelberger B., Ganser A., Lichter P., Dohner K., Dohner H. // Blood. — 2012. — Vol. 119. — P. 2114—2121.

12. A novel hierarchical prognostic model of AML solely based on molecular mutations / Grossmann V., Schnittger S., Kohlmann A., Eder C., Roller A., Dicker F., Schmid C., Wendtner C. M., Staib P., Serve H., Kreuzer K. A., Kern W., Haferlach T., Haferlach C. // Blood. — 2012. — Vol. 120. — P. 2963—2972.

13. WHO classification of tumors of haematopoietic and lymphoid tissues / Swerdlow S. H., Campo E., Harris N. L., Jaffe E. S., Pileri S. A., Stein H., Thiele J., Vardiman J. W. — Lyon: IARC, 2008. — 439 p.

14. Программное лечение заболеваний системы крови // Сборник алгоритмов диагностики и протоколов лечения заболеваний системы крови / Под ред. В. Г. Савченко. — М.: Практика, 2012. — 1056 с.

15. Vinogradov A. V., Rezaikin A. V., Sergeev A. G. TP53 gene point mutation detection using sequencing techniques in acute and chronic leukemia patients // Cel. Ther. Transplantat. — 2010. — Vol. 3, N 9. — P. 126.

16. Виноградов А. В., Резайкин А. В., Сергеев А. Г. Комплексное исследование мутаций генов TP53, FLT3, KIT, N-RAS, NPM1 и WT1 при острых миелоидных лейкозах с использованием технологии прямого секвенирования // Биомика. — 2012. — Т. 3, №1. — С. 22—24.

17. Larsen C. J. Contribution of the dual coding capacity of the p16INK4a/MTS1/CDKN2 locus to human malignancies // Progress in Cell Cycle Res. — 1997. — Vol. 3. — P. 109—124.

18. The CDKN2A database: Integrating allelic variants with evolution, structure, function, and disease association / Murphy J. A., Bar-rantes-Reynolds R., Kocherlakota R., Bond J. P., Greenblatt M. S. // Hum. Mutat. — 2004. — Vol. 24. — P. 296—304.

19. Impact of mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: lessons from recent developments in the IARC TP53 database / Petitjean A., Mathe E., Kato S., Ishioka C., Tavtig-ian S. V., Hainaut P., Olivier M. // Hum. Mutat. — 2007. — Vol. 28. — P. 622—629.

20. Soussi T., Beroud C. Significance of TP53 Mutations in Human Cancer: A Critical Analysis of Mutations at CpG Dinucleotides. // Hum. Mutat. — 2003. — Vol. 21. — P. 182—200.

Поступила 22.01.2013

Alexander Vladimirovich Vinogradov1, Alexey Vasilievich Rezaikin2, Alexander Grigorievich Sergeyev3

PROGNOSTIC IMPACT OF TP53 MUTATIONS IN THE TREATMENT OF ACUTE LEUKEMIA

' MD, PhD, Researcher, Central Research Laboratory, Ural State Medical Academy (3, ul. Repina, Ekaterinburg, RF, 620028) 2 MD, Assistant, Chair of Microbiology, Virology and Immunology, Ural State Medical Academy (3, ul. Repina, Ekaterinburg, RF, 620028) 3 MD, PhD, DSc, Professor, Head, Chair of Microbiology, Virology and Immunology; Scientific Director, Central Research Laboratory, Ural State Medical Academy (3, ul. Repina, Ekaterinburg, RF, 620028)

Address for correspondence: Vinogradov Alexander Vladimirovich, Central Research Laboratory, Ural State Medical Academy, 3, ul. Repina, Ekaterinburg, RF, 620028;

e-mail: vinogradov-av@russia.ru

The paper analyzes frequency, structural features and prognostic impact of TP53 mutations in acute myeloid and lymphoblastic leukemias. The mutations were detected by direct automatic sequencing. Average frequency of TP53 mutations in acute myeloblastic leukemia was 9.7% and varied in different cytogenetic disease types and in the presence of other genetic abnormalities. Frequency of TP53 mutations reached maximum (60%) in acute myeloblastic leukemia with complex chromosomal aberrations. There was no damage in TP53 exons 4 to 11 in acute myeloblastic leukemia with expression of specific chimeric genes and/or mutations of FLT3, NPM', KIT, N-RAS, WT. Frequency of TP53 mutations in acute lymphoblastic leukemia was 21.1% and all these cases belonged to diploid karyotype. Cooperation of c.250G>T transversion of TP53 exon 4 with damage in exon 2 of CDKN2A/ARFwas detected in one case. Acute leukemias with TP53 mutations had very poor prognosis with median survival not exceeding than 3 months.

Key words: gene TP53, mutation, acute myeloid leukemia, acute lymphoblastic leukemia, sequencing.

i Надоели баннеры? Вы всегда можете отключить рекламу.