CC BY
22
UDC 577.218+575.22+633.11 https://doi.org/10.15407/biotech11.02.047
POLYMORPHISM OF SOME TRANSCRIPTION FACTOR GENES RELATED TO DROUGHT TOLERANCE IN WHEAT
O. R. Lakhneko1, 2 institute of Cell Biology and Genetic Engineering
A. I. Stepanenko1, 3 of the National Academy of Sciences of Ukraine, Kyiv Ye. V. Kuzminskiy2 2National Technical University of Ukraine
B. V. Morgun1, 2 "Igor Sikorsky Kyiv Polytechnic Institute", Kyiv
3School of Life Sciences, Huaiyin Normal University, Huaian, 223300, China
E-mail: molgen@icbge.org.ua
Received 17.12.2017
The aim of the research was to study polymorphism of preselected gene loci of three transcription factors (TaNAC2a, TaWRKY2, and TaWRKY19) and the Late Embryogenesis Abundant (LEA) proteins dehydrin (Td29b) related to wheat drought tolerance. The genes structure and chromosome location were established via bioinformatics tools. It is stated that TaWRKY2 and TaWRKY19 genes were comprised of 4 exons and 3 introns located on 2BS and IDS chromosome arms, respectively; TaNAC2a — 2 exons and 1 intron 7AS; Td29b — single exon gene 3AS. Using polymerase chain reaction, no polymorphism was observed. Polymorphic bands were detected for TaWRKY2 locus. The screening of the distribution of the revealed polymorphic loci was carried out for a set of wheat and rye varieties, old landraces and interspecific hybrids. The polymorphism of TaWRKY2 locus indicated the presence of some other possible alleles of the gene. The obtained data are importantfor further investigations of wheat drought tolerance.
Key words: Triticum spp., polymerase chain reaction, transcription factors, TaNAC2a, TaWRKY2, TaWRKY19, LEA, Td29b, drought tolerance.
Common wheat (Triticum aestivum L.) is very important widely grown crop used for bread baking, food and animal feed. Wheat yield is the third largest cereal production in the world, after maize and rice [1]. In consequence of methods of modern plant breeding, numerous varieties with increased productivity were obtained. However, due to the recent undesired climate changes and global warming, the selection of drought-tolerant germplasm donors must be constantly monitored to include them in contemporary breeding programs [2]. Marker-assisted selection (MAS) based on DNA markers can be effectively applied in the process of such selection [3-6]. While different types of DNA sequences can be employed for this purpose.
First DNA marker systems to study drought tolerance in plants were based on non-coding DNA sequences — RAPD (Random Amplified Polymorphic DNA) [7, 8], SSR (Simple Sequence Repeats) [9, 10] and
ISSR (Inter Simple Sequence Repeats) [8] etc. Presently, attention mostly attracted to target encoding gene sequences, which play a great role in plant response to stress factors. These genes predominantly represented with transcriptional factors (TFs) and dehydrin genes [11].
In present work, our aim was to study DNA polymorphism of preselected gene loci of three transcription factors (TaNAC2a, TaWRKY2, TaWRKY19) and the LEA dehydrin (Td29b) related in their expression response to wheat drought tolerance.
WRKY transcription factors represent family of proteins that have WRKY domain (approximately 60 amino acids), involving the conserved WRKYGQK domain and a zinc-finger-like motif [12, 13]. These proteins are of great importance for biotic and abiotic stress responses [14, 15]. Overexpression of TaWRKY2 as well as TaWRKY19 increased dehydration stress tolerance in transgenic
Arabidopsis plants [12]. It was also found out that TaWRKY2 overexpressing plants had enhanced STZ and RD29B gene expressions due to temperate binding to the loci from RD29B STZ-1 and STZ-2 locus of Arabidopsis. As to TaWRKY19 transgenic plants, they had higher expression levels of DREB2A, RD29B, Cor6.6 and RD29A genes [12].
Another TF family that highly introduced in common wheat is represented with proteins containing a highly conserved NAC domain at the N-terminus and a variable transcriptional regulation domain at the C-terminus [16, 17]. Overexpression of different TaNAC responded to enhanced biotic and abiotic tolerance [18, 19]. It was postulated in the [16], that TaNAC2a transgenic plants of tobacco had extremely increased drought tolerance.
Special role in response to dehydration stress relates to dehydrin proteins, which help plant cell cope with osmotic changes. The number of dehydrins were described in wheat [20, 21]. Late Embryogenesis Abundant (LEA) proteins belong to above mentioned group of proteins and can be candidate for wheat improvement [22]. It was reported [23] that LEA proteins accumulation enhanced stress tolerance protecting plant cells against dehydration. It was also described the importance of Td29b dehydrin in common wheat, which synthesis was highly induced by dehydration.
Materials and Methods
The subject of the study was a set of wheat cultivars of Ukrainian and foreign origin (25 and 36, consequently), a set of 52 old wheat species, distant and interspecific hybrids, 4varieties of rye.
BLAST searches and sequence analyses were implemented by BLASTn on the Triticum
aestivum genome (https://blast.ncbi.nlm.nih. gov/ and https://wheat-urgi.versailles.inra. fr). The schemes of exon-intron structures were obtained by employing the online Gene Structure Display Server bioinformatic tools (http://gsds.cbi.pku.edu.cn/) from both coding sequence (CDS) and genomic sequences [24].
Total DNA was isolated from one kernel with the modified CTAB method [25]. Polymerase chain reaction (PCR) of 20 pl included 0.5 pM of forward and reverse primers each (Metabion, Germany), 1x Reaction Buffer B (Solis BioDyne, Estonia), 2 mM MgCl2, 0.2 pM of each deoxyribonucleoside triphosphate (Thermo Fisher Scientific, USA), 1 unit of FIREPol® DNA Polymerase (Solis BioDyne, Estonia), 30 ng of total plant DNA. Primer sequences for loci TaNAC2a, TaWRKY2, TaWRKY19 and Td29b used in the study and PCR conditions are indicated in the Table 1. The CDS accessions in the GenBank are HM027575.2 (TaNAC2a), EU665425.1 (TaWRKY2), EU665430.1 (TaWRKY19) and AJ890139.1 (Td29b).
The PCR products were separated by means of electrophoresis in 2% agarose gels in lithium borate buffer, 0.1 pg/ml ethidium bromide [26]. Gels were visualized in UV-light with a photosystem Canon EOS 600D. GelAnalyzer 2010 software was applied to identify the size of amplified fragments (http: //www.gelanalyzer.com). Frequencies for each combination of amplified fragments were calculated according to [27].
Results and Discussion
As it was denoted above, data on CDS only are available for those three studied transcriptional factors (TaNAC2a, TaWRKY2, and TaWRKY19) and the dehydrin (Td29b). Thus, we managed to predict the exon-intron
Table 1. Primer sequences and PCR conditions
TF gene Primer sequences 5'—>3' PCR conditions
TaNAC2a F: GGTAGTGCGGTGCTTCCAAT R: TGAATGTTGTTGCTCGTCCC [16] 94 °C — 30 s; 58 °C — 30 s 72 °C — 30 s; 35 cycles
TaWRKY2 F: GGCGCTGCCGACGTCATCTT R: AGCAGAGGAGCGACTCGACGA [12] 94 °C — 30 s; 58 °C — 30 s 72 °C — 30 s; 35 cycles
TaWRKY19 F: AGGGAAGCATACGCATGACGTGC R: GGCGAGATCGTTCAGAATGGCTGT [12] 94 °C — 30 s; 60 °C — 30 s 72 °C — 30 s; 35 cycles
Td29b F: CGCACCCAGCTAGTAAGTTCG R: CCCAGCCCAGTAATAACCCAT [23] 94 °C — 30 s; 53 °C — 30 s 72 °C — 30 s; 35 cycles
structure and location of their genes by means of alignment via BLAST tools.
Having carried out every CDS alignments in the database of wheat whole genome shotgun contigs, the gene structures and chromosomal location were defined for three studied transcription factors (TaNAC2a, TaWRKY2, TaWRKY19) and the dehydrin (Td29b) (Fig. 1) in accordance with [28]. Hence, TaWRKY2 and TaWRKY19 have similar structure of 4 exons and 3 introns (Fig. 1, A, B), though, they are situated in different chromosomes (TaWRKY2 — short arm of 1D chromosome; TaWRKY19 — short arm of 1B). Both primer pairs applied in the following DNA polymorphism study hybridized at the end of the fourth exon. The gene of TF TaNAC2a comprises of 2 exons and 1 intron (Fig. 1, C) and allocates at the short arm of 7A chromosome. The primer pair for this gene locus annealed at the central part of exon 2. It was established, that Td29b gene might have referred to single exon gene (Fig. 1, D). Its location is the short arm of 3A chromosome.
Molecular genetic study
To study DNA polymorphism of the selected loci of 4 genes (three TF — TaNAC2a, TaWRKY2, TaWRKY19; and the dehydrin gene Td29b) a set of 25 Ukrainian and 37 international wheat accessions from Global Wheat Program of the International Maize and Wheat Improvement Center (CIMMYT) and the Wheat Germplasm Bank was collected. By means of applying primer pairs and PCR conditions indicated in the Table 1, we observed no polymorphism for gene loci TaNAC2a, TaWRKY19 and Td29b. There was one fragment amplified only for each sample — fragment of approximately 227 base pairs (bp) for TaNAC2a gene locus, 160 bp for TaWRKY19, 86 bp for Td29b (Fig. 2).
Following the amplification of total genomic DNA of all common wheat varieties of Ukrainian and foreign origin, there were two fragments detected for each sample. We observed three different genotypes in the studied TaWRKY2 locus. The first one
A
NMPUK1H3441 j
B NMPLD2] 19059 1 J*OObp iMKfcp ISOO F » R
r
№p 500bp lODObp lioobp :oocbp 2i00bp îOOObp
C FAOMOl'70609 1 F R
J' . J1
D CBTL0107SJ5747 1 Of ;oobp öoobp sooty 10 F OCVp R I-OObp UMbp
. 1
<M> 1 OffiT :00ip MBbp JOOtD 'Otrtip 6O0bf> JOObp soav
Legend: CDfi upitoAmTdowrctuun
A — Fig. 1. Prediction of gene exon-intron structure: TaWRKY2; B — TaWRKY19; C — TaNAC2a; D — Td29b
A B C
M 1 2 3 4 56 Ml 2 3 4 5 6 M 1 2 3 4 5 6
m,
300 bp- 200 bp- -
200 bp- \ 227 bp 100 bp- \ 160 bp
200 bp -
100 bp -
Fig. 2. The electrophoregrams denoting PCR-products segregation of DNA marker systems: A — TaNAC2a; B — TaWRKY19; C — Td29b Lanes 1-6 — common wheat varieties (Glenlea, Comanche, Wilbur, Granero Inta, Tobarito M 97, V-17); M — marker of molecular weight GeneRuller™ DNA Ladder Mix
represented amplified fragments of 173 and 188 bp, second — 188 and 200 bp, the third — of 173 and 200 bp (Fig. 3). Moreover, Ukrainian varieties showed greater diversity, than those foreign ones. The frequencies for each allele of amplified fragments among Ukrainian varieties are 0.52 (173+188 bp), 0.28 (173+188 bp) and 0.2 (173 + 200 bp). On the contrast, a set of amplified fragments 188+ +200 bp was not observed among 36 foreign varieties obtained from the CIMMYT. In addition, only two samples (Millaleau Inia and Tobarito M 97) possessed 173+200 bp pattern. Thereafter, frequencies for these two allele of amplified fragments among the CIMMYT varieties were 0.944 (173+188 bp) and 0.056 (173+200 bp). The results on the DNA polymorphism study of TaWRKY2 locus are indicated in the Tables 2 and 3.
Table 2. Detected DNA polymorphism of TaWRKY2 locus in Ukrainian varieties
Variety Originator Amplified fragment, bp Variety Originator Amplified fragment, bp
Astarta IPPG NASU 173,200 Poliska 90 NSC "IA NAAS" 173,188
Bohdana IPPG NASU 173,188 Shchedrivka Kyivska IPPG NASU NSC "IA NAAS" 173,188
Bunchak PBGI NCSCI NAASU 173,188 Slavna IPPG NASU 188,200
Darunok Podillia IPPG NASU 173,188 Smuhlianka IPPG NASU 188, 200
Drevlianka n.a. 173,188 Solomiia IPPG NASU 173,188
Favorytka IPPG NASU 173,200 Sonata Institute of Field and Vegetable Crops, Novi Sad, Serbia 173,200
Hileia IPPG NASU 188,200 Sotnytsia IPPG NASU 188,200
Kryzhynka RMIW NAASU IPPG NASU 173,200 Spasivka IPPG NASU 188, 200
Natalka IPPG NASU 173,188 Vesnianka IPPG NASU 188,200
Novokyivska IPPG NASU 173,200 Yatran 60 IPPG NASU 173,188
Odeska 267 PBGI NCSCI NAASU 173,188 Yednist PBGI NCSCI NAASU 173,188
Pereiaslavka IPPG NASU 173,188 Zolotokolosa IPPG NASU 188,200
Podolianka IPPG NASU 173,188
Note: IPPG NASU — Institute of Plant Physiology and Genetics, National Academy of Sciences of Ukraine; PBGI NCSCI NAASU — Plant Breeding and Genetics Institute — National Center of Seed and Cultivar Investigation, the National Academy of Agrarian Sciences of Ukraine; RMIW NAASU — The V.M. Remeslo Myronivka Institute of Wheat, the National Academy of Agrarian Sciences of Ukraine; NSC "IA NAAS" — National Scientific Centre "Institute of Agriculture of the National Academy of Agrarian Sciences of Ukraine"; n.a. — not available. http://www.wheatpedigree.net, State register of plant varieties suitable for distribution to Ukraine of the Ministry of Agrarian Policy and Food of Ukraine http://www.sops.gov.ua/ reestr-sortiv-roslin.
Fig. 3. The electrophoregram depicting DNA polymorphism of TaWRKY2 locus: Lanes 1 — Odeska 267; 2 - Poliska 90; 3 — Darunok Podillia; 4 — Podolianka; 5 - Astarta; 6 — Kryzhynka; 7 — Sotnytsia; 8 - Zolotokolosa; M — molecular weight marker GeneRuller™ DNA Ladder Mix
Table 3. Detected DNA polymorphism of TaWRKY2 locus in varieties from germplasm collections
of the CIMMYT
Variety Locality Originator* Year of registration Amplified fragment, bp
1 2 3 4 5
AC Vista Canada (Saskatchewan) Agriculture and Agri-Food Canada Semiarid Prairie Agricultural Research Centre, Swift Current 1996 173,188
Albis Switzerland (Zurich) Federal Research Station for Agronomy 1983 173,188
Anza Mexico, USA (California) California Agricultural Experiment Station 1971 173,188
Batavia Australia (Queensland) Queensland Wheat Research Institute 1991 173,188
Caribo Germany Heidenreih, Bad-Schwartau 1968 173,188
Cenad-512 Romania n.a. 1958 173,188
Comanche USA (Kanzas) Kansas Agricultural Experiment Station 1942 173,188
D-12 Peru n.a. 1972 173,188
Excalibur Australia (South-Australia) RAGT 1990 173,188
Gabo Australia (New-South-Wales) University of Sydney Plant Breeding Institute, Cobbitty 1942 173,188
Glenlea Canada (Manitoba) University of Manitoba 1972 173,188
Grande-Del-Monte Venezuela n.a. n.a. 173,188
Granero Inta Argentina Inta 1987 173,188
Inia-F-66 Mexico INIA, CIMMYT 1966 173,188
Iskamish-K-2-Light Afghanistan n.a. 1975 173,188
Janz Australia (Queensland) Queensland Wheat Research Institute 1989 173,188
Katunga Australia (Victoria) n.a. 1992 173,188
Ke Feng 2 China (Heilongjiang) Keshan WRI 1979 173,188
Kimmo Finland n.a. 1941 173,188
Klein Favorito Argentina E. Klein 1920 173,188
Kulin Australia (Western-Australia) Department of Agriculture, W.A. 1986 173,188
Manital Italy Samoggia Luigi, Bologna 1981 173,188
Millaleau Inia Chile INIA, CIMMYT 1982 173,200
Recital France Benoist 1986 173,188
Rokycans-ka sametka Czechoslovakia n.a. 1899 173,188
Safed Le-rma India Indian Agricultural Research Institute 1967 173,188
Sakha 69 Egypt Agricultural Research Center, Giza 1980 173,188
Svenno Sweden W. Weibull 1953 173,188
Talimka Kyrgyzstan Kirgizskaya GSS 1940 173,188
Tobarito M 97 Mexico CIMMYT 1997 173,200
Note: n.a. — not available; * — from the Genetic Resources Information System for Wheat and Triticale (http://www.wheatpedigree.net/) provided by Vavilov Research Institute of Plant Industry (VIR) and International Maize and Wheat Improvement Center (CIMMYT).
Table 3. End
1 2 3 4 5
Tobarito M 97 Mexico CIMMYT 1997 173,200
Tselin-naya-Yu-bileinaya Kazakhstan Kazakhskiy NII zernovogo khozyaystva 1988 173,188
V-17 Mexico CIMMYT 1968 173,188
Wilbur USA (Oregon) W.J. Mariner 1897 173,188
Zambesi Zimbabwe Salisbury AES 1963 173,188
Zerdakia Iraq n.a. n.a. 173,188
Zirka Ukraine Plant Breeding and Genetics Institute, National Academy of Agrarian Sciences of Ukraine 1984 173,188
According to CDS sequence of TaWRKY2 (GenBank ID EU665425.1), the primer pair for this TF locus is likely to amplify the fragment of 188 bp long. Such a fragment was observed through the study; however, not all the wheat samples possessed it. Consequently, there must be an indel mutation, which is likely to form another allele.
The old wheat landraces is the source of potential genes of interest which can be of great value for common wheat improvement
in modern breeding programs. Thus, the following screening of a number of wheat landraces and interspecific hybrids was carried out. The data were indicated in the Table 4. As it can be seen from the table, most of them carried fragments of 173 + 188 bp (46 among 52 samples, frequency — 0.88). On the other hand, all the 3 fragments (173, 188 and 200 bp) were amplified from 2 wheat accessions (T. spelta var. duhamelianu Baulaender and
Species/Hybrid/Cross Subspecies Country of originator Amplified fragment, bp
1 2 3 4
AD T. persicum/Ae. tauschii Japan 173,188
AD T. dicoccum/Ae. speltoides Azerbaijan 173,188
AD Ae. ventricosa/T. dicoccum Russia 173,188
AD T. aestivum/Ae. comosa Russia 173,188
AD 217 T. timopheevii/Ae. umbellulata Japan 173,188
AD 7 T. ispahanicum/Ae. cylindrical Azerbaijan 173
AD 8 T. dicoccum/Ae. triuncialis Azerbaijan 173,188
Aegilotricum cylindroaesti-vum Aegilops cylindrica/T. aestivum Armenia 173,188
Haynatricum T. dicoccum/Dasypyrum villosum Russia 173,188
PAH-31 T. dicoccum/T. monococcum Russia 173,188
PEAH T. dicoccum/Ae. tauschii Russia 173,188
T. dicoccum Schuebl. var. rufum Sweden 173,188
Table 4. Detected DNA polymorphism of TaWRKY2 locus in old wheat species, distant and interspecific
hybrids
Table 4. npodoewenux
1 2 3 4
T. dicoccum Schuebl. var. aeruginosum Azerbaijan 173,188
T. dicoccum var. aeruginosum Runo Russia 173,188
T. dicoccum var. serbicum Polba 3 Russia, Udmurtia 173,188
T. dicoccum var. dicoccum Ukraine 173,188
T. dicoccum var. nigroajar Ethiopia 173,188
T. dicoccum var. rufum Ukraine 173,188
T. dicoccum var. aeruginosum Russia, Dagestan 173,188
T. dicoccum var. semicanum Germany 173,188
T. dicoccum Polba Kokchetavska Kazakhstan 173,188
T. dicoccum var.vasconicum Crjunella Spain 173,188
T. dicoccum var. rufum Spain 173,188
T. dicoccum var. atratum Poland 173,188
T. dicoccum n.a. Kazakhstan 173,188
T. dicoccum Schuebl. var. serbicum Belarus 173,188
T. dicoccum Schuebl. var. dicoccum n.a. 173,188
T. dicoccum Schuebl. var. serbicum Chervona krasa Belarus 173,188
T. dicoccum Schuebl. var. haussknachtianum Bolshaia holova India 173,188
T. dicoccum Schuebl. var. loganse Polba Kokchetavska n.a. 173,188
T. dicoccum Schuebl. var. volgense Vernal USA 173,188
T. dicoccum Schuebl. var. aeruginosum Armenia 173,188
T. dicoccum Schuebl. var. serbicum Russia 173,188
T. dicoccum Schuebl. var. volgense Russia 173,188
T. dicoccum Schuebl. var. haussknachtianum Kazakhstan 173,188
T. dicoccum Schuebl. var. haussknachtianum Azerbaijan 173,188
T. dicoccum Schuebl. var. aeruginosum Runo Russia 173,188
T. ispahanicum var. ispahanicum Iran 173,188
T. kiharae T. timopheevii x Ae.tauschii Japan 173,188
T. macha var. palaeoimereticum Georgia 173,188
T. sinkajae var. sinskajae Russia 173
T. spelta var. album Canada 173,188
T. spelta var. caeruleum CDC Zobra Canada 173,188
T. spelta var. griseoturanorecens Tajikistan 173,188
T. spelta var. duhamelianum Poland 173,188
T. spelta var. duhamelianum Baulaender Germany 173, 188, 200
T. spelta var. duhamelianum Frankenkorn Germany 173, 188
Table 4. End
1 2 3 4
T. spelta var. caeruleum Azerbaijan 173,188
T. spelta var. album Canada 173,188
T. vavilovii var. vavilovii Armenia 173,188, 200
T. hexapolonicum n.a. Armenia 173,200
Tritordeum 1199/09 T. durum/Hordeum chilense Spain 188
T. vavilovii var. vavilovii) representing frequency 0.04 only. Three wheats (frequency — 0.06) had only one type of fragment (173 or 188 bp). The only sample (frequency — 0.02) (T. hexapolonicum) had fragments of 173+200 bp.
Additionally, four rye verities (Avgust, Khmarka, Remington and Stoir) were tested for polymorphism in TaWRKY2 locus. As a result, the only fragment of 200 bp was detected in each sample. This fact shows that other cereal crops might have the TaWRKY2 gene too.
The study of the genes, that impact greatly on drought response, is of great value for wheat improvement in present-day plant breeding programs. The current research reveals knowledge on DNA polymorphism of three transcriptional factors (TaNAC2a, TaWRKY2, TaWRKY19) and the dehydrin (Td29b) genes which can be applied for MAS. During the analysis the gene structure and chromosomal location were established. Thus, TaWRKY2 and TaWRKY19 genes comprised of 4 exons and 3 introns (2BS and
REFERENCES
1. Food Outlook: Biannual report on global food markets. November 2017. Available at: http:// www.fao.org/3/a-I8080e.pdf.
2. Kaur V., Singh S., Behl R. K. Heat and drought tolerance in wheat: Integration of physiological and genetic platforms for better performance under stress. Ekin J. 2016, 2 (1), 1-14.
3. Pokhylko S. Yu., Troyanovska A. V., Stepanen-ko A. I., Urbanovich O. Yu., Dugan O. M., Rybalka O. I., Morhun B. V. Studies of bread wheat genotypes with transferred gene GPC-B1 of Triticum turgidum ssp. dicoccoides. Fact. Exp. Evol. Org. 2016, 18, 132-136. (In Ukrainian).
4. Stepanenko O. V., Stepanenko A. I., Kuzmins-kiy Ye. V., Morgun B. V. Identification of
1DS, respectively); TaNAC2a — 2 exons and 1 intron (7AS); Td29b — single exon gene (3AS).
In the result of this study, no polymorphism was observed for gene loci TaNAC2a, TaWRKY19 and Td29b by means of preselected primer pairs. In contrast, polymorphic bands were detected for TaWRKY2 locus that did not correspond to CDS from GenBank. This fact indicated the presence of some other possible alleles of the gene.
This research was financially supported by the projects "Development of Genotyping and Marking Systems for Valuable Biological Characteristics in Crops" (state registration number 0116U000173) and "Study of Genetic Determinants and New Allele Effects of Genes to Improve Cereals under the Negative Impact of Global Climate Change" (state registration number 0117U000385) provided by the National Academy of Sciences of Ukraine. The authors express their sincere gratitude to Professor Nikolai Borisjuk for critical remarks and help with experiments.
Psyl gene alleles responsible for carotenoid accumulation in wheat grains. Biotechnol. acta. 2017, 10 (2), 57-66. https://doi. org/10.15407/biotech 10.02.057.
5. Lakhneko O. R., Stepanenko A. I., Morgun B. V. Genotyping Triticum aestivum L. cultivars of Ukraine with microsatellite markers. Fact. Exp. Evol. Org. 2016, 19, 61-63.
6. Kosovâ K., Vitâmvâs P., Urban M. O., Kholovà J., Prâsil I. T. Breeding for enhanced drought resistance in barley and wheat — drought-associated traits, genetic resources and their potential utilization in breeding programmes. Czech J. Genet. Plant Breed. 2014, 50 (4), 247-261.
7. ElSayed A. I., Rafudeen M. S. Molecular marker assisted for recognition drought tolerant in some of bread wheat genotypes.
J. Crop Sci. Biotech. 2012, 15 (1), 17-23. doi: 10.1007/s12892-011-0051-1.
8. El-Sayed O. E., Ibrahim H. F. RAPD and ISSR markers related to drought tolerance of regenerated plants in wheat double haploids and varieties. Middle East. Russian J. Plant Sci. Biotechnol. 2008, 2 (2), 44-51.
9. Kim S. H., Kim D. Y., Yacoubi I., Seo Y. W. Phenotypic and genotypic analyses of drought tolerance in Korean and Tunisian wheat cultivars. Plant Breed. Biotech. 2014, 2 (2), 139-150. doi: 10.9787/PBB.2014.2.2.139.
10. Sadat S, Saeid K. A., Bihamta M. R, Torabi S, Salekdeh S. G. H., Ayeneh G. A. L. Marker assisted selection for heat tolerance in bread wheat. World Appl. Sci. J. 2013, 21 (8), 11811189. doi: 10.5829/idosi.wasj.2013.21.8.2866.
11. Rana R. M., Rehman S. U., Ahmed J., Bilal M. A comprehensive overview of recent advances in drought stress tolerance research in wheat (Triticum aestivum L.). Asian J. Agr. Biol.
2013, 1 (1), 29-37.
12. Niu C.-F., Wei W., Zhou Q.-Y., Tian A.-G., Hao Y.-J., Zhang W.-K., Ma B., Lin Q., Zhang Z.-B., Zhang J.-S., Chen S.-Y. Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Environ. 2012, 35, 1156-1170. doi: 10.1111/j.1365-3040.2012.02480.x.
13. Okay S., Derelli E., Unver T. Transcriptome-wide identification of bread wheat WRKY transcription factors in response to drought stress. Mol. Genet. Genomics. 2014, 289 (5), 765-781. doi: 10.1007/s00438-014-0849-x.
14. Zhu X., Liu S., Meng C., Qin L., Kong L., Xia G. WRKY transcription factors in wheat and their induction by biotic and abiotic stress. Plant Mol. Biol. Rep. 2013, 31 (5), 10531067. doi:10.1007/s11105-013-0565-4.
15. Pandey S. P., Somssich I. E. The role of WRKY transcription factors in plant immunity. Plant Physiol. 2009, 150 (4), 1648-1655. doi: 10.1104/pp.109.138990.
16. Tang Y. M., Liu M. Y., Gao S. Q., Zhang Z., Zhao X., Zhao C. P., Zhang F. T., Chen X. P. Molecular characterization of novel TaNAC genes in wheat and overexpression of TaNAC2a confers drought tolerance in tobacco. Physiol. Plant. 2012, 144, 210-224. doi:10.1111/j.1399-3054.2011.01539.x.
17. Nakashima K., Yamaguchi-Shinozaki K., Shinozaki K. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat. Front. Plant Sci.
2014, 5, 1-7. doi: 10.3389/fpls.2014.00170.
18. Xue G. P., Way H. M., Richardson T., Drenth J., Joyce P. A., Mclntyre C. L. Overexpression of TaNAC69 leads to enhanced transcript levels
of stress up-regulated genes and dehydration tolerance in bread wheat. Mol. Plant. 2011, 4 (4), 697-712. doi: 10.1093/mp/ssr013.
19. Xia N., Zhang G., Liu X. Y., Cai G. L., Zhang Y, Wang X. J., Zhao J., Huang L. L., Kang Z. S. Characterization of a novel wheat NAC transcription factor gene involved in defense response against stripe rust pathogen infection and abiotic stresses. Mol. Biol. Rep. 2010, 37 (8), 3703-3712. doi: 10.1007/ s11033-010-0023-4.
20. Hassan N. M., El-Bastawisy Z. M,, El-Sayed A. K., Ebeed H. T., Alla M. M. N. Roles of dehydrin genes in wheat tolerance to drought stress. J.Advanced Res. 2015, 6, 179-188. doi: 10.1016/j.jare.2013.11.004.
21. Min D.-H., Zhang X.-H., Xu Z.-S.; Zhao Y., Chen Y., Li L.-C., Chen M., Ma Y.-Z. Induction kinetics of a novel stress-related LEA gene in wheat. Plant Mol. Biol. Rep.2012, 30 (6), 1313-1321. doi: 10.1007/s11105-012-0446-2.
22. Amara I., Zaidi I., Masmoudi K., Ludevid M., Pages M., Goday A., Brini F. Insights into late embryogenesis abundant (LEA) proteins in plants: from structure to the functions. Amer. J. Plant Sci. 2014, 5 (22), 3440-3455. doi: 10.4236/ajps.2014.522360.
23. Ali-Benali M. A., Alary R., Joudrier P., Gautier M.-F. Comparative expression of five Lea Genes during wheat seed development and in response to abiotic stresses by real-time quantitative RT-PCR. Biochim. Biophys. Acta. 2005, 1730, 56-65. doi: 10.1016/j. bbaexp.2005.05.011.
24. Hu B., Jin J., Guo A.-Y., Zhang H., Luo J., Gao G. GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics. 2015, 31 (8), 1296-1297. doi: 10.1093/ bioinformatics/btu817.
25. Murray M., Thompson W. Rapid isolation of high molecular weight plant DNA. Nucl. Acids Res. 1980, 8 (19), 4321-4325.
26. Singhal H., Ren Y. R., Kern S. E. Improved DNA electrophoresis in conditions favoring polyborates and Lewis acid complexation. PLoS One. 2010, 5 (6), 1-6. doi: 10.1371/ journal.pone.0011318.
27. Akinina G. E., Dugar V. N. Popov V. N. Statistical analysis of genetic data using software ARLEQUIN, PHILYP, CLANN, STRUCTURE. Kharkiv: The Plant Production Institute named by V. Ya. Yuryev, NAAS. 2014, 100 p. (In Russian).
28. International Wheat Genome Sequencing Consortium (IWGSC). A chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome. Science. 2014, 345 (6194), 1251788. doi: 10.1126/ science.1251788.
ПОЛ1МОРФ1ЗМ ГЕН1В ДЕЯКИХ ТРАНСКРИПЦ1ЙНИХ ФАКТОР1В, ЩО ПОВ'ЯЗАН1 З ПОСУХОСТ1ЙК1СТЮ ПШЕНИЦ1
О. Р. Лахнеко1' 2 А. I. Степаненко1' 3 G. В. Кузьмшський2 Б. В. Моргун1, 2
Институт клггинно! бмлоги i генетично!
шженери НАНУ, Ки!в 2Нащональний технiчний унiверситет Укра!ни «Ки!вський полггехшчний iнститут
iM. 1горя Сшорського», Ки!в 3Бiологiчна школа Унiверситету Хунань, КНР
E-mail: molgen@icbge.org.ua
Метою дослщження було вивчити поль морфiзм попередньо вЩбраних локусiв генiв трьох транскрипцiйних факторiв (TaNAC2a, TaWRKY2, TaWRKY19) та проте!н пiзнього ембрiогенеза (LEA) дегидрину (Td29b), пов'я-заних 3i стiйкiстю пшенищ до посухи. Структуру гешв та хромосомну локалiзацiю було встановлено за допомогою бiоiнформацiйних пiдходiв. З'ясовано, що гени TaWRKY2 та TaWRKY19 складаються з 4 екзонiв i 3 штро-нiв, локалiзованих на плечах 2BS та 1DS хро-мосоми, вщповщно; TaNAC2a мiстить 2 екзони та 1 штрон 7AS. Ген Td29b мiстить один екзон 3AS. У результатi використання полiмеразноl ланцюгово! реакцй не було виявлено полiмор-фiзму для локусiв гешв TaNAC2a, TaWRKY19 та Td29b за допомогою попередньо вЩбраних пар праймерiв. Проте для локусу TaWRKY2 виявлено полiморфнi фрагменти. Скриншг по-ширення полiморфних локусiв проводили для набору сорив пшенищ та жита, давшх пше-ниць та мiжвидових гiбридiв. Полiморфiзм локусу TaWRKY2 свщчить про наявнiсть деяких iнших алелiв цього гена. Цi данi е важливими для подальших дослiджень посухостшкост пшеницi.
Ключовi слова: Triticum spp., полiмеразна ланцюгова реакцiя, фактори транскрипцп, TaNAC2a, TaWRKY2, TaWRKY19, LEA, Td29b, посухостiйкiсть.
ПОЛИМОРФИЗМ ГЕНОВ НЕКОТОРЫХ ТРАНСКРИПЦИОННЫХ ФАКТОРОВ, СВЯЗАННЫХ С ЗАСУХОУСТОЙЧИВОСТЬЮ ПШЕНИЦЫ
О. Р. Лахнеко 1, 2
А. И. Степаненко1' 3 Е. В. Кузьминский2 Б. В. Моргун1, 2
1Институт клеточной биологии и генетической инженерии НАНУ, Киев 2Национальный технический университет Украины «Киевский политехнический институт им. Игоря Сикорского», Киев
3Биологическая школа Университета Хунань, КНР
E-mail: molgen@icbge.org.ua
Целью исследования было изучение полиморфизма предварительно отобранных локу-сов генов трех транскрипционных факторов (TaNAC2a, TaWRKY2, TaWRKY19) и протеин позднего эмбриогенеза (LEA) дегидрина (Td29b), связанных с устойчивостью пшеницы к засухе. Структура генов и хромосомная локализация определены с помощью биоинформационных подходов. Установлено, что гены TaWRKY2 и TaWRKY19 состоят из 4 экзонов и 3 интронов, 2BS и 1DS хромосомы, соответственно; TaNAC2a содержит 2 экзона и 1 интрон 7AS. Ген Td29b состоит из одного экзона 3AS. В результате использования по-лимеразной цепной реакции не было выявлено полиморфизма для локусов генов TaNAC2a, TaWRKY19 и Td29b с помощью предварительно отобранных пар праймеров. Однако для локуса TaWRKY2 обнаружены полиморфные фрагменты. Скрининг распространения полиморфных локусов проводили для набора сортов пшеницы и ржи, древних пшениц и межвидовых гибридов. Полиморфизм локуса TaWRKY2 свидетельствует о наличии других аллелей этого гена. Эти данные важны для дальнейших исследований устойчивости пшеницы к засухе.
Ключевые слова: Triticum spp., полимеразная цепная реакция, факторы транскрипции, TaNAC2a, TaWRKY2, TaWRKY19, LEA, Td29b, засухоустойчивость.
