CC BY
41
UDC 577.21+ 633.11 https://doi.org/10.15407/biotech10.02.057
IDENTIFICATION OF Psyl GENES ALLELES RESPONSIBLE FOR CAROTENOID ACCUMULATION
IN WHEAT GRAINS
institute of Cell Biology and Genetic Engineering of the National Academy of Sciences of Ukraine, Kyiv 2National Technical University of Ukraine "Igor Sikorsky Kyiv Polytechnic Institute", Kyiv
E-mail: [email protected]
Received 12.01.2017
The aim of the research was to select and optimize marker systems for identification of Psyl genes alleles, which are responsible for different levels of carotenoid pigments accumulation in wheat grains, as well as to screen varieties for the selection of valuable genotypes. 162 wheat samples were analyzed by the polymerase chain reaction method. Among them, varieties and lines with different allelic states of Psy-Al and Psy-Bl genes were identified. The Psy-Dl gene did not show any polymorphism. As a result, samples with valuable alleles of Psyl genes, which potentially contain increased carotenoids content in grains, were selected.
Key words: Psyl genes, carotenoids, molecular markers, Triticum aestivum.
O. V. Stepanenko1' 2
A. I. Stepanenko1 Ye. V. Kuzminskiy2
B. V. Morgun1
Technological quality indicators define the use of wheat for the production of a certain type of product. Yellow pigment content is an important factor both for Triticum durum Dest. and T. aestivum L., which is determined mainly by accumulation carotenoid in grains. This feature affects the final quality and nutritional value of pasta and bakery products. Intense yellow color of products is attractive in yellow noodle that consumed mainly in Japan and Southeast Asia. Therefore, a high level of pigments in wheat is desirable for varieties used in that region [1]. White flour is preferable in soft wheat variety breeding, while a yellow pigment is considered undesirable characteristic for baking wheat [2]. White flour is also attractive for the production of steam bread and Chinese wheat noodle [3]. Endosperm color of wheat determines flour color and controls the main content of carotenoids in grain.
There are more than 750 compounds in carotenoid pigments family present in plants, bacteria and fungi [4, 5]. All carotenoids are formed from phytoene and most of them— C40 polyenes. They play a key role in photosynthesis, as required for proper construction of photosystems and light-absorbing complexes and performing photoprotection, reducing oxidative damage
[6]. Provitaminic activity of P-carotene, a-carotene, P-cryptoxanthin and other pigments with at least one same oxygen-free ion in one ring determine nutritive value of carotenoids [4]. Carotenoids synthesis occurs by metabolic pathway, which involves at least 10 different enzymes [7, 8]. Yellow pigment content is mainly determined by plant genotype but also depends on the environmental conditions [9].
Duplicated genes Psyl, Psy2 and Psy3 were detected, in cereals on chromosomes 7, 5 and 5, respectively, which are responsible for the carotenoids synthesis. In subsequent studies it was shown that Psyl only is related to the yellow pigment content. Silencing Psyl gene expression using RNA interference to 54-76% led to a significant reduction of carotenoids in grains at 26-35% [10, 11]. Phytoene synthase (PSY) is the key enzyme in carotenoid biosynthesis that shows high correlation with yellow pigment content in wheat grain [12]. The phytoene synthase enzyme catalyzes condensation of two geranylgeranyl pyrophosphate molecules to form the phyton
[13].
Homeological wheat genes Psy-Al, Psy-Bl, Psy-Dl are located on chromosomes 7A, 7B and 7D, respectively. Psyl genes contain six exons and five introns in wheat and its relatives, and
also in maize, rice and other cereals [14-16]. It was determined that carotenoids are the only 30-50% of endosperm yellow pigment in cereals and the remaining substances that provide color has not been identified yet. The main carotenoids in wheat endosperm are lutein and zeoxanthin, while a-carotene, P-carotene and P-cryptoxanthin present in much lower quantities [17].
The aim of the study was to develop biotechnological approaches based on molecular marker systems for the detection of Psy-1 genes alleles, which are responsible for the biosynthesis of carotenoid pigments in cereals and screening a collection of domestic and foreign wheat accessions for proper genotype selection.
Materials and Methods
The subjects of the research were 156 samples of wheat Ukrainian and foreign selection, 1 sample of Aegilops cylindrica, 1 sample of Aegilops tauschii, 1 wheat amfiploid and 3 samples of emmer from different originators.
Total plant DNA was isolated with the CTAB method [18] with some modifications. The reaction mixes for PCR included: specific primers, 0.25 mM (Table 1), reaction buffer B (Solis BioDyne), 2 mM MgCl2 solution (Solis BioDyne), 0.2 mM of each deoxyribonucleotide-3-phosphate (Thermo Fisher Scientific), 0,5 units of polymerase FIREPol® DNA Polymerase (Solis BioDyne), 30 ng of total
DNA and deionized water Milli-Q (Merck Millipore) to a final volume of 20 pl.
Separation of amplification products was performed by horizontal electrophoresis in agarose gel with either sodium borate or lithium borate buffer containing 0.5 mg/ml ethidium bromide and vertical electrophoresis in polyacrylamide gels. Visualization of results was performed in UV-light with the photosystem Canon EOS 600D, image processing with MS PowerPoint and GIMP.
Results and Discussion
A number of varieties and lines with different allelic composition of Psy-A1 and Psy-B1 genes have been discovered in our study. At the same time the Psy-D1 gene didn't show any polymorphism.
Three varieties (Glenlea, Antonivka and Bobwhite) with Psy-A1b allele responsible for the low grain carotenoid content, according to the published data [19, 21], were detected among 162 studied samples in our collection. Two varieties Zymoiarka and Nedra did not reveal any presence of the expected alleles. Allele Psy-A1c was not identified among the samples. The rest of the samples carried Psy-A1a allele, which defines high carotenoid content (Fig. 1).
The differentiation between varieties carrying Psy-B1a and Psy-B1b alleles was not practically possible with the use of agarose electrophoresis gels. However, according to the literature these alleles do not result in
Fig. 1. Agarose gel showing the results of Psy-A1 gene amplification to identify Psy-A1a and Psy-A1b alleles:
Lane 1 — Drevlianka; 2 — Khutorianka; 3 — Dvorianka; 4 — Trizo; 5 — Nedra; 6 — Nyva Kyivshchyny; 7 — Tybalt; 8 — Torchynska; 9 — Pereiaslavka; 10 — Granny; 11 — Antonivka; 12 — Podolianka; 13 — Favorytka; 14 — Zolotokolosa; 15 — Zymoiarka; 16 — Glenlea; 17 — Volodarka; 18 — Novokyivska; hereafter E— negative control without DNA; М — molecular weight marker GeneRuler™ DNA Ladder Mix
Table 1. List of primers used in research and the length of expected amplification products
Primer name Sequence 5' to 3', reference Allele —amplicon length, bp Gene
YP7AF YP7AR GGACCTTGCTGATGACCGAG TGACGGTCTGAAGTGAGAATGA [12] Psy-A1a— 194 Psy-A1b— 231 Psy-A1
YP7A2F YP7A2R GCCAGCCCTTCAAGGACATG CAGATGTCGCCACACTGCCA [19] Psy-A1a— 1686 Psy-A1b— 1686 Psy-A1c— 1001 Psy-A1
YP7B-1F YP7B-1R GCCACAACTTGAATGTGAAAC ACTTCTTCCATTTGAACCCC [19] Psy-B1a— 151 Psy-B1b— 156 Psy-B1
YP7B-2F YP7B-2R GCCACCCACTGATTACCACTA CCAAGGTGAGGGTCTTCAAC [19] Psy-B1c— 428 Psy-B1
YP7B-3F YP7B-3R GAGTAAGCCACCCACTGATT TCGCTGAGGAATGTACTGAC [19] Psy-B1d— 884 Psy-B1
YP7B-4F YP7B-4R AGGTACCAGCCAGCCCATA CTCGTCAAAGTTCGTGTACC [19] Psy-B1e— 716 Psy-B1
YP7D-2F YP7D-2R ACTCCCACAAACCTACAACG ACGCTCATCAACCCCACG [14] Psy-D1a— 967 Psy-D1g— 1046 Psy-D1
RTF RTR CAACGCTAGCTGCACCACTAACT ACTCCTCCTTGATAGCAGCCTT [20] 934 TaTM20
increasing carotenoid content in cereals and the levels of pigments in case of presence Psy-B1a or Psy-B1b do not differ significantly. Among the analyzed wheat sample 62 accessions that carry Psy-B1d allele, 14 accessions with Psy-B1c allele and also 1 hybrid with Psy-B1e allele were found. Some accessions with Psy-B1c allele had unexpected additional amplicon of about 900 bp. It indicates the additional polymorphisms of Psy-B1 gene.
Allele Psy-B1c is responsible for high carotenoid content in grains, according to the literature, so this data is valuable for further research and biofortification of wheat.
To optimize the analysis the multiplex PCR detecting alleles Psy-B1d, Psy-B1s and Psy-B1e together with the reference TaTM20 gene was developed. Typical electrophoregrams are shown in Fig. 2 and 3.
Fig. 2. Agarose gel showing the results of multiplex PCR of Psy-B1 gene to identify Psy-B1d and Psy-B1c alleles with TaTM20 reference gene: Lane 1 — Diuk; 2 — Dvorianka; 3 — Khutorianka; 4 — Nikoniia; 5 — Khyst; 6 — Nyva Kyivshchyny; 7 — Ukrainka; 8 — Zorepad; 9 — Pereiaslavka; 10 — Antonivka; 11 — Granny; 12 — Podiaka; 13 — Nedra; 14 — Yatran 60; 15 — Yednist; 16 — Federer; 17 — positive control carrying Psy-B1d allele; 18 — positive control containing Psy-B1c allele
Fig. 3. Agarose gel showing the results of multiplex PCR of gene to identify Psy-B1d, Psy-B1c and Psy-B1e alleles with TaTM20 reference gene:
Lane 1 — Khutorianka; 2 — Aranka; 3 — Blahodar-ka; 4 — Dobrochynna; 5 — control which carries Psy-B1c allele; 6 — control containing Psy-B1e allele; 7— control bearing Psy-B1d allele
There is the wild Psy-D1a allele only found among the studied accessions. Typical electrophoregram is shown in Fig. 4.
The list of the detected samples with identified alleles of Psy1 genes shown at Table 2.
Allele frequency of studied genes for the Ukrainian varieties are the following: 97.8% for Psy-A1a, 0.8% for Psy-A1b, and 1.4% for the samples that did not reveal any of the
expected alleles; 47% of the total for the both alleles Psy-B1a and Psy-B1b together, 43.3% for Psy-B1d, and, finally, 9.7% for Psy-B1c.
According to the information set out in the paper by He et al. (2009) the highest content of carotenoids is observed in the presence of allele Psy-A1a and Psy-B1c. Therefore, the highest concentration of carotenoids is expected in the following accessions: wheat varieties Dobrochynna, Kosovytsia, Odeska 265, Biliava, Pysanka, Panna, Lider, Odeska 51, Selianka, Povaha, Lanovyi, Suputnytsia and the Emmer accession originating from Germany. Also, the presence of 1B»1R translocation increases carotenoid content in grain. Among the samples with Psy-A1a and Psy-B1c alleles, and therefore potentially high carotenoids content, there are no accessions with 1B»1R translocation. The least carotenoid content is expected in accessions with Psy-A1b and Psy-B1b alleles and without 1B»1R translocation.
To confirm phenotypic expression of the studied genes as well as the relationship between their allelic state and the manifestation of a sign the carotenoid content in wheat was measured by the AACC International Method 14-60.01 (2012) in grains. It was found that the carotenoid content in studied wheat samples is so low that it cannot be identified by standard method, designed specifically for the measurement of carotenoid pigments in cereals and flour. At the same time, we conducted the control experiment which allowed us to reliably distinguish among carotenoid pigments content in corn samples, which confirmed the adequacy and reproducibility of chosen measurement method. The carotenoid pigments content in wheat, which is below the sensitivity threshold of common methods, clearly confirms the importance of the study subjects. The development of wheat with a high
Fig. 4. Agarose gel showing the results of Psy-D1 gene amplification:
1 — Drevlianka; 2 — Khutorianka; 3 — Dvorianka; 4 — Trizo; 5 — Nyva Kyivshchyny; 6 — Tybalt; 7 — Torchynska; 8 — Pereiaslavka; 9 — Granny; 10 — Podolianka; 11 — Zymoiarka; 12 — Zolotokolosa; 13 — Favorytka; 14 — Volodarka; 15 — Novokyivska; 16 — Sonechko; 17 — Glenlea; 18 — Smuhlianka
Table 2. Allelic profiling of genes responsible for accumulation of carotenoids in wheat grains
№ Genotype Psy-A1 Psy-B1 Psy-D1
1 Aegilops cylindrica 220/34 a a/b a
2 Aegilops tauschii 232/87 a d a
3 Akter a a/b a
4 Albatros a d a
5 Amphiploid 4 242/59 a e a
6 Antonivka a d a
7 Antonivka 2 b d a
8 Aranka a a/b a
9 Bankuti 1201 a a/b a
10 Bezosta 1 a a/b a
11 Biliava (Kyiv) a c a
12 Biliava (Odesa) a d a
13 Bilotserkivska napivkarlykova a a/b a
14 Blahodarka a d a
15 Bobwhite (Kyiv) a a/b a
16 Bobwhite (Odesa) b a/b a
17 Bohdana a a/b a
18 Boriia a a/b a
19 Borviy a d a
20 Bunchuk a a/b a
21 Chinese spring a a/b a
22 Chinese spring 2 a a/b a
23 Chorniava a a/b a
24 Chornobrova a a/b a
25 Dalnytska a d a
26 Dobrochyn a d a
27 Dobrochynna a c a
28 Dobroslava a d a
29 Donetska 46 a a/b a
30 Donetska 48 a a/b a
31 Donska napivkarlykova a a/b a
32 Doskonala a a/b a
33 Drevlianka a a/b a
34 Dvorianka a d a
35 Diuk a d a
36 Emmer (commer) a a/b a
37 Emmer (Germany) a c a
38 Emmer (Hungary) a a/b a
39 Epokha a d a
40 Favorytka a a/b a
41 Federer a a/b a
Continuation Table 2
№ Genotype Psy-A1 Psy-B1 Psy-D1
42 Glenlea b d a
43 Granny a a/b a
44 Harmoniia a a/b a
45 Hileia a a/b a
46 Hoduvalnytsia a a/b a
47 Hospodynia a d a
48 Hrezdivlytsia a a/b a
49 Hurt a d a
50 Istyna a d a
51 Khersonska b/o a d a
52 Khutorianka a a/b a
53 Khyst a d a
54 Kiriia a d a
55 Kniahynia Olha (Kyiv) a d a
56 Kniahynia Olha (Odesa) a d a
57 Kolleha a d a
58 Kolumbiia a a/b a
59 Koreli a a/b a
60 Kosovytsia a c a
61 Krasen a d a
62 Kryzhynka a a/b a
63 Kuialnyk (Kyiv) a a/b a
64 Kuialnyk (Odesa) a d a
65 Kyivska ostysta a a/b a
66 Lad a d a
67 Lanovyy a c* a
68 Lastivka a d a
69 Lasunia a a/b a
70 Lebidka a d a
71 Lider a c a
72 Liona a d a
73 Lira a d a
74 Lybidka a d a
75 Lytanivka a d a
76 Marquis a a/b a
77 Misiia a d a
78 Myronivska 30 a a/b a
79 Myronivska 61 a a/b a
80 Myronivska 65 a a/b a
81 Myronivska 808 a a/b a
Continuation Table 2
№ Genotype Psy-A1 Psy-B1 Psy-D1
82 Natalka а а/b а
83 Natalka (Kyiv) а d а
84 Nebokray а d а
85 Nedra empty с а
86 Nikoniia а d а
87 Nirit а а/b а
88 Norin 16 а а/b а
89 Norin 29 а а/b а
90 Norin 35 а а/b а
91 Novokyivska а а/b а
92 Novosibirskaya 67 а а/b а
93 Novosmuhlianka а а/b а
94 Nyva а d а
95 Nyva Kyivshchyny а а/b а
96 Nyva Odeska а а/b а
97 Odeska 51 (Kyiv) а с а
98 Odeska 51 (Odesa) а а/b а
99 Odeska 265 а с а
100 Odeska 267 (Kyiv) а а/b а
101 Odeska 267 (Odesa) а а/b а
102 Oslo а а/b а
103 Otaman а d а
104 Panna а с а
105 Pereiaslavka а d а
106 Podiaka а d а
107 Podolianka а а/b а
108 Polianka а а/b а
109 Poliska 90 а а/b а
110 Polovyk а d а
111 Poshana а а/b а
112 Povaha а с* а
113 Pylypivka а а/b а
114 Pysanka а с* а
115 Pyvna а а/b а
116 Selianka а с* а
117 Shchedrivka Kyivska а а/b а
118 Skarbnytsia (Kyiv) а а/b а
119 Skarbnytsia (Odesa) а d а
120 Sluzhnytsia а d а
121 Smuhlianka а а/b а
122 Solokha а а/b а
End Table 2
№ Genotype Psy-Al Psy-Bl Psy-Dl
123 Solomiia а d а
124 Sonata а а/b а
125 Sonechko а d а
126 Sotnytsia а а/b а
127 Spasivka а а/b а
128 Statna а а/b а
129 Suputnytsia а с а
130 Torchynska а а/b а
131 Trizo а а/b а
132 Trypilska а а/b а
133 Turunchuk а d а
134 Tybalt а а/b а
135 Ukrainka а d а
136 Ukrainska 0246 а а/b а
137 Uzhynok (Kyiv) а а/b а
138 Uzhynok (Odesa) а а/b а
139 Vatazhok а а/b а
140 Vesnianka а а/b а
141 Viktoriia а d а
142 Volodarka а а/b а
143 Vykhovanka а d а
144 Yatran 60 а d а
145 Yednist а d а
146 Zadumka а а/b а
147 Zahrava а d а
148 Zamozhnist а d а
149 Zaporuka а d а
150 Zdobutok а а/b а
151 Zemliachka (Kyiv) а а/b а
152 Zemliachka (Odesa) а а/b а
153 Zhaivir а d а
154 Zhuravka а d а
155 Zmina а d а
156 Znakhidka а d а
157 Zoloto Ukrainy а d а
158 Zolotokolosa а а/b а
159 Zorepad а d а
160 Zvytiaha а а/b а
161 Zymoiarka empty а/b а
162 Zysk а d а
*— samples have additional unexpected amplicon.
content of carotenoids in grains is a promising area of plant breeding for getting crops of special nutritional purposes.
The research was conducted within the project 0116U000173 "Development of
genotyping and marking systems for valuable biological characteristics of crops" financed by the National Academy of Sciences of Ukraine.
REFERENCES
1. Fu B. X. Asian noodles: History, classification, raw materials, and processing. Food Res. Int. 2008, 41 (9), 888-902.
2. Zhang W., Dubcovsky J. Association between allelic variation at the Phytoene synthase 1 gene and yellow pigment content in the wheat grain. Theor. Appl. Genet. 2008, V. 116, P.635-645.
3. He Z. H., Yang J., Zhang Y., Quail K. J., Peña R. J. Pan bread and dry white Chinese noodle quality in Chinese winter wheats. Euphytica. 2004, V. 139, P.257-267.
4. DellaPenna D., Pogson B. J. Vitamin synthesis in plants: tocopherols and carotenoids. Annu. Rev. Plant Biol. 2006, V. 57, P. 711-738.
5. Kushwaha K., Saini A., Saraswat P., Agar-wal M. K., Saxena J. Colorful World of Microbes: Carotenoids and Their Applications. Adv. Biol. 2014, V. 2014, P. 1-13.
6. Cazzonelli C. I. Carotenoids in nature: insights from plants and beyond. Func. Plant Biol. 2011, V. 38, P. 833-847.
7. Hirschberg J. Carotenoid biosynthesis in flowering plants. Curr. Opin. Plant Biol. 2001, V. 4, P. 210-218.
8. Giuliano G. Plant carotenoids: genomics meets multi-gene engineering. . Curr. Opin. Plant Biol. 2001, 2014 (19), 111-117.
9. Lacko-Bartosova M., Lacko-Bartosova L. Effect of farming system on colour components of wheat noodles. Potravinarstvo. 2016, 10 (1), 413-417.
10. Palaisa K. A., Morgante M., Williams M, Rafalski A. Contrasting effects of selection on sequence diversity and linkage disequilibrium at two phytoene synthase loci. Plant Cell. 2003, V.15, P.1795-1806.
11. Zhai S., He Z., Wen W., Jin H., Liu J., Zhang Y., Liu Z., Xia X. Genome-wide linkage mapping of flour color-related traits and polyphenol oxidase activity in common wheat. Theor. Appl. Gen. 2016, 129 (2), 377-394.
12. He X. Y., Zhang Y. L., He Z. H., Wu Y. P., Xiao Y. G., Ma C. X., Xia X. C. Characterization of phytoene synthase 1 gene (Psyl) located on common wheat chromosome 7A and development of a functional marker. Theor. Appl. Genet. 2008, V. 116, P. 213-221.
13. Vranova E., Coman D., Gruissem W. Structure and dynamics of the isoprenoid pathway network. Mol. Plant. 2012, V. 5, P. 318-333.
14. Wang J., He X., He Z., Wang H., Xia X. Cloning and phylogenetic analysis of phytoene synthase 1 (Psy1) genes in common wheat and related species. Hereditas. 2009, V.146, P.208-256.
15. Fu Z., Yan J., Zheng Y. Nucleotide diversity and molecular evolution of the PSY1 gene in Zea mays compared to some other grass species. Theor. Appl. Genet. 2009, V. 120, P.709-720.
16. Crawford A. C., Stefanova K., Lambe W., McLean R., Wilson R., Barclay I., Francki M. G. Functional relationships of phytoene synthase 1 alleles on chromosome 7A controlling flour colour variation in selected Australian wheat genotypes. Theor. Appl. Genet. 2011, V. 123, P.95-108.
17. Blanco A., Colasuonno P., Gadaleta A., Mangini G., Schiavulli A., Simeone R., Digesu A. M., De Vita P., Mastrangelo A. M. Quantitative trait loci for yellow pigment concentration and individual carotenoid compounds in durum wheat. J. Cereal Sci. 2011, V. 54, P. 255-264.
18. Stewart C. N., Via L. E. A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications. BioTechniques. 1993, 14 (5), 748-749.
19. He X., Wang J., Ammar K. Allelic variants at the Psy-A1 and Psy-B1 loci in durum wheat and their associations with grain yellowness. Crop Science. 2009, V. 49, P. 2058-2064.
20. Kim Y.-Y., Kim D.-Y., Shim D., Song W.-Y., Lee J., Schroeder J. I., Kim S., Moran N., Lee Y. Expression of the novel wheat gene TM20 confers enhanced cadmium tolerance to bakers' yeast. Biol. Chem. 2008, 283 (23), 15893-15902.
21. AACCI Method 14-60.01 Total Carotenoid Content of Cereal Grains and Flours. American Association for Cereal Chemistry Approved methods of the AACC-method, 11th edn. St Paul, MN. 2012, P. 1-4.
1ДЕНТИФ1КАЦ1Я АЛЕЛ1В ГЕН1В Psy1, ЩО В1ДПОВ1ДАЮТЬ ЗА НАКОПИЧЕННЯ КАРОТИНО1Д1В У ЗЕРН1 ПШЕНИЦ1
О. В. Степаненко1' 2 А. I. Степаненко1 G. В. Кузьмшський2 Б. В. Моргун1
Институт кл^инно! бмлоги та генетично! шженери НАН Укра!ни, Ки!в 2Нацiональний технiчний унiверситет Укра!ни «Ки1вський полiтехнiчний iнститут iменi 1горя Сшорського»
E-mail: [email protected]
Метою дослiдження було п^брати та оптимiзувати маркернi системи для щенти-ф^аци алелiв гешв Psyl, що вiдповiдають за рiзний рiвень накопичення каротино!д-них шгменив у зернi пшеницi, та здшснити скринiнг вибiрки сортiв для добору необх^-них генотипiв. Методом полiмеразноl лан-цюгово! реакцп проаналiзовано 162 зразки пшениць Серед вибiрки було виявлено сор-ти i лшп з рiзним алельним складом гешв Psy-Al та Psy-Bl. Ген Psy-Dl не виявив по-лiморфiзму. В результат вiдiбрано зразки з необхщними алелями генiв Psyl, що потен-цiйно мають пiдвищений вмiст каротиноЩв у зернiвках.
Ключовi слова: гени Psyl, каротино!ди, моле-кулярнi маркери, Triticum aestivum.
ИДЕНТИФИКАЦИЯ АЛЛЕЛЕЙ ГЕНОВ
Psyl, КОТОРЫЕ ОТВЕЧАЮТ ЗА НАКОПЛЕНИЕ КАРОТИНОИДОВ В ЗЕРНЕ ПШЕНИЦЫ
Е. В. Степаненко1' 2 А. И. Степаненко1 Е. В. Кузьминский2 Б. В. Моргун1
1Институт клеточной биологии и генетической инженерии НАН Украины, Киев 2Национальный технический университет Украины «Киевский политехнический институт им. Игоря Сикорского»
E-mail: [email protected]
Целью исследования были подбор и оптимизация маркерных систем для идентификации аллелей генов Psyl, отвечающих за разный уровень накопления каротиноидных пигментов в зерне пшеницы, а также скрининг выборки сортов для отбора нужных генотипов. Методом полимеразной цепной реакции проанализированы 162 образца пшеницы. Среди выборки были выявлены сорта и линии с различным аллельным составом генов Psy-Al и Psy-B1. Ген Psy-Dl не проявил полиморфизма. В результате отобраны образцы с нужными аллелями генов Psyl, которые потенциально имеют повышенное содержание каротиноидов в зерновках.
Ключевые слова: гены Psyl, каротиноиды, молекулярные маркеры, Triticum aestivum.
