CC BY
30UDC 633.853.494.577.213.3 https://doi.Org/10.21498/2518-1017.14.4.2018.151898
Polymorphism in spring and winter rapeseed varieties (Brassica napus L.) identified by SSR markers
O. L. Klyachenko1, L. M. Prysiazhniuk2*, N. V. Shofolova1, O. V. Piskova2
National University of Life and Environmental Sciences of Ukraine, Heroiv Oborony St., 15, 03041, Kyiv, Ukraine 2Ukrainian Institute for Plant Variety Examination, 15 Henerala Rodymtseva St., 03041, Kyiv, Ukraine, *e-mail: [email protected]
Purpose. To assess the genetic diversity of rapeseed varieties using SSR markers in order to create breeding material and use that material in complex in vitro selection for drought and salt tolerance. Methods. PCR analysis, cluster analysis. Results. The results of analysis of rapeseed varieties polymorphism based on molecular-genetic markers is presented. As a result of the analysis of rapeseed varieties, 41 alleles were detected using the studied markers, that is, an average of 10.3 alleles per marker. The number of polymorphic loci identified by four microsatellite markers (Ra3-H09, Na12-A02, FITO-063 and Na10-B07) was 24. The polymorphism level of the studied varieties was 51% on average and varied between 33% (identified by FIT0-063) and 87% (identified by Na12-A02). According to the frequency distribution of the obtained alleles, the highest frequency by SSR marker Ra3-H09 had a 117 bp allele identified in three varieties: 'Senator Liuks', 'Danhal' and 'Chornyi Veleten'. It was found that the unique alleles identified by Ra3-H09 were the alleles at a frequency of 0.06 and size of 135 bp (variety 'Aliot') and 156 bp (variety 'Kliff). FIT0-063 marker identified the smallest number of alleles (5) at a frequency distribution ranging from 0.11 to 0.33. The unique alleles identified by FIT0-063 marker were the ones at a frequency of 0.1 and size of 258 bp (variety 'Geros') and 273 bp (variety 'Chornyi Veleten'). The maximum number of alleles was obtained using Na12-A02 marker. The distribution showed the highest frequency (0.11) for the 158 bp and 192 bp alleles. Using Na10-B07 marker, three alleles were identified at a frequency of 0.04. These 144, 156 and 194-bp alleles were found in varieties 'Kliff, 'Geros' and 'Nelson'. Cluster analysis revealed four variety clusters: 'Senator Liuks' and 'Danhal', 'NK Technik' and 'NK Petrol', 'Geros' and 'Aliot', 'Kliff and 'Nelson'. 'Chornyi Veleten' variety did not enter any cluster. The most distant varieties are 'Kliff and 'Nelson' with a genetic distance value of 3.32. Foreign varieties 'NK Technik' and 'NEC Petrol' with the value of genetic distances between them equal 1.41 appeared to be the most similar by the four studied SSR markers. Other varieties differed by at least one marker. Conclusions. Consequently, using the set of four microsatellite markers provides an assessment of rapeseed varietal diversity that can be used in complex in vitro selection for drought and salt tolerance. Keywords: varietal diversity; rapeseed; microsatellite markers; cluster analysis.
j . i I •
lntr°auctl°n The constantly growing area of saline lands,
Rapeseed (Brassica napus L.) is one of the which now, according to FAO, exceeds 7% of
most important high-yielding industrial the world's agricultural land [4-5] along with
crops promising for export and production climate change, requires research aimed at
of rapeseed oil and biodiesel for the domes- creating hybrids of complex tolerance to ad-
tic market [1-3]. The crop productivity can verse abiotic factors.
be increased through creating new hybrids The efficiency of breeding is largely deter-
with a better tolerance to environmental mined by the genetic diversity of the parent
changes. material; consequently, it is necessary to search
__and introduce new approaches to increasing the
genetic heterogeneity of the selection material
Larysa/ Prysifhniuk [6-7]. Such approaches include cell, tissue, plant
li4-4-n. Unrr-IA /nnnn nnnQ /QOO C\/. OR L J ' ' ^
http://orcid.org/0000-0003-4388-0485 Oksana Klyachenko
https://orcid.org/0000-0002-4087-4082 Natalia Shofolova
organ culture and using DNA-markers for identification of the selection material [8-10].
Genotyping technology based on DNA poly-
https://orcid.org/0000-0003-3207-0110 morphism is used for both cultural and wild
Oksana Piskova species of the genus Brassica L. DNA makers
https://orcid.org/0000-0003-3650-2101 have many advantages. The molecular markers
are not subjected to environmental change, which makes them particularly informative and superior to traditional methods [11].
Various DNA markers have been successfully used to study genetic diversity in Brassica, such as random amplified polymorphic DNA (RAPD), restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), sequence-related amplified polymorphism (SRAP), simple sequence repeat (SSR), single-nucleotide polymorphisms (SNP) [12]. SSR analysis allows distinguishing genera, species and varieties, revealing genetic heterogeneity of breeding material, and controlling genetic material introgression from parents [13-15]. The technology of geno-typing based on SSR markers allows identifying genetic diversity of rapeseed varieties and genetic homogeneity of breeding material, selecting parents for crosses and controlling trans-
The research was carried out at the Ukrainian Institute for Plant Varieties Examination (Kyiv, Ukraine) in collaboration with the National University of Life and Environmental Sciences of Ukraine (Kyiv, Ukraine) in 2017/2018.
Isolation of DNA and PCR
The material was provided by the National University of Life and Environmental Sciences of Ukraine (The Problem Laboratory Of Phytovirology and Biotechnology) where the selection in vitro for drought and salt tolerance was carried out. DNA was isolated from the leaves of obtained in vitro rapeseed plants using cationic detergent CTAB (cetyl-trimethylammonium bromide). Chloroform-isoamyl alcohol and ethanol solution were used in double purification of the mixture [19-21].
fer of genetic material from parents to hybrids [7, 16-18].
The goal of this research was to assess the genetic diversity of rapeseed varieties using SSR markers in order to create breeding material and use that material in complex in vitro selection for drought and salt tolerance.
Materials and methods
Characteristics of the investigated material
The material for the study was nine varieties of winter and spring rapeseed of Ukrainian ('Senator Liuks', 'Danhal', 'Chornyi Veleten' and 'Aliot') and foreign origin ('NK Technik', 'Necropolis', 'Kliff', 'Geros', 'Nelson') promising for the creation of drought and salt-resistant lines. All the varieties have been listed in the State Register of Varieties Suitable for Distribution in Ukraine from 2001 to 2011 as shown in Table 1.
PCR (polymerase chain reaction) was used to investigate the molecular and genetic polymorphism of rapeseed varieties. For this purpose, we used four specific primers for four microsatellite loci (MS-loci): Ra3-H09, Na12-A02, FITO-063 and Na10-B07 as shown Table 2.
The primers were chosen based on their ability to differentiate genotypes and PIC [11, 2124]. The PCR was performed using BioRad IQ5 (USA). The reaction mixture (20 pL) contained 100 ng of total plant DNA, buffer (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 0.01% Triton X-100, 2.5 mM MgCl2), 200 pM deoxynucleoside triphosphates mix (dNTPs), 0.2 pM of each primer and 1 unit of Taq polymerase (Thermo Fisher Scientific, USA). The amplification parameters for the examined rapeseed markers were set as follows: initial denaturation (94 °C) 5 min, 35 cycles; denaturation (94 °C) 45 s;
Table 1
Characteristics of varieties of winter and spring rapeseed
Name of variety Year of registration Applicant
Winter varieties
'Senator Liuks' 2006 National Research Centre Institute of Agriculture Ukrainian Academy of Aqrarian Sciences
'NK Technik' 2011 Synqenta Seeds S.A.S.
'NK Petrol' 2011 Synqenta Seeds S.A.S.
'Danhal' 2001 Ivano-Frankivsk Institute of Agroindustrial Production Ukrainian Academy of Aqrarian Sciences
'Nelson' 2008 Synqenta Seeds S.A.S.
'Chornyi Veleten' 2002 Institute of Fodder and Agriculture of Podillia Ukrainian Academy of Aqrarian Sciences
'Aliot' 2007 National University of Life and Environmental Sciences of Ukraine; Sytnik I. D.; Kolodii Yu. A.
Spring varieties
'Kliff 2003 Norddeutsche Pflanzenzucht Hans-Georq Lembke KG
'Geros' 2006 Raps GbR Saatzucht Lundsqaard
Table 2
Characteristics of SSR-loci primers of rapeseed
Primer The nucleotide sequence of primers 5'...3' Motif Hybridization temperature (°C) Expected size of amplicones (bp)
Ra3-H09 F - gtggtaacgacggtccattc (IGG)3 53.6 119-129
R - accacgacgaagactcatcc
Na12-A02 F - agccttgttgcttttcaacg (Cl)i6 54.0 161-202
R- agtgaatcgatgatctcgcc
FIT0-063 F - gttcagttcccagattcctaa 49.0 267-700
R - tttcctcttccttctctcttc
Na10-B07 F - gccttagattagatggtcgcc № 53.0 174-213
R - acttcagctccgatttgcc
annealing (49-54 °C) 45 s; synthesis (72 °C) 1 min; final elongation (72 °C) 10 min.
Visualization of amplifications and cluster analysis
After amplification, the reaction products were visualized by electrophoresis in a 2% agarose gel in 0.5 x TBE (tris-borate buffer solution) [25]. DNA electrophoresis was carried out for 1 hour at an electric field intensity of 5 V/cm.
After the completion the electrophoresis, based on the obtained data a matrix was constructed, where the presence / absence of a certain amplicon was designated as 1/0, respectively.
The method of hierarchical clustering with Euclidean distance and STATISTICA 12.0 (Trial version) were exploited to analyse the obtained research data [26-27].
Results and discussion
Determination of polymorphism in rape-seed varieties by SSR markers
Alleles of the expected size were obtained by PCR on four SSR markers with specific primers. The amplicons were obtained by markers Na12-A02 (the most polymorphic loci) and FIT0-063 (the lowest level polymorphism) and are shown Figures 1 a, b.
M 1 2 3 4 5 6 M 1 2 3 4 5 6 a b
Fig. 1. Electropherogram of DNA amplification products of different rapeseed varieties: M - molecular weight marker 100 bp DNA Ladder O'GeneRuler (Thermo Scientific); (a) based on Na12-A02 marker: 1-3 genotypes of 'Kliff variety, 4-6 genotypes of 'Geros' variety; (b) based on FIT0-063 marker: 1-3 genotypes of 'Kliff' variety, 4-6 genotypes of 'Geros' variety
As a result of PCR the Kliff' variety by primer Na12-A02 marker, amplicons of 198 bp and 154 bp were found. The amplification products of 'Geros' variety were 178 bp and 158 bp. In general two alleles of different size were identified for all studied varieties by Na12-A02 marker. Using FIT0-063 marker five alleles were obtained for nine varieties. Figure 1 b illustrates that the allele 267 bp was identified in 'Kliff' variety. Allele 258 bp was found 'Geros' variety by FIT0-063 marker. It should be mentioned that the allele 267 bp was identified also in 'Aliot' and 'Nelson' varieties.
Resulting from analysis of the rapeseed varieties by the investigated markers 41 alleles were detected, i.e. on the average of 10.3 alleles per marker as shown Table 3.
Table 3
Analysis of the level of polymorphism with SSR markers
Primer Total alleles Polymorphic alleles Polymorphism level* (%)
Ra3-H09 11 5 45
Na12-A02 16 14 87
FIT0-063 5 2 33
Na10-B07 9 3 40
*Polymorphism level = (number of polymorphic bands/ number of total bands) x 100%
The total number of polymorphic loci was 24 and varied from 2 to 14 by markers. The polymorphism level for the varieties under study was 51%. The highest level of polymorphism (87%) was marked by Na12-A02 marker and the lowest (33%) by FIT0-063. A slightly lower level of polymorphism (40%) was obtained by Li and co-authors [11] in the study of 16 rape-
seed varieties. Hasan et al. [16], 2006 used combinations of 30 SSR-primers, which included the primer groups Ra3 and Na12, to estimate genetic diversity of rapeseed varieties. They obtained 51 polymorphic loci of (out of 220) for 96 genotypes. Polymorphic loci demonstrated unique allele sizes for all 96 genotypes.
Tommasini et al. [30] obtained a high level of polymorphism (68%) for the primer Na12-A02 2003. The researchers suggested the use of a set of 15 SSR-primers for use in the DUS-test.
We determined the frequencies of identified alleles for each marker under study as shown Figures 2 a, b; 3 a, b.
L
102 105 108 111 114 117 123 135 141 147 156 Allele size, bp
154 158 160 164 178 186 188 192 198 200 208 214 232 240 246 252
Allele size, bp
Fig. 2. Distribution of allele frequencies detected by markers (a) Ra3-H09 and (b) Na12-A02
a
b
The distribution showed that the highest frequency by SSR marker Ra3-H09 had a 117 bp allele identified in three varieties: 'Senator Li-uks', 'Danhal' and 'Chornyi Veleten'. The unique alleles at a frequency of 0.06 were found in 'Aliot' variety (135 bp) and 'Kliff' variety (156 bp). The biggest number of alleles
0,35
0,3
0,25
u
= 0 2
£ 0,15
LL.
0,1 0,05 0
a 258
was obtained using Na12-A02 marker. The distribution showed the highest frequency (0.11) for the 158 bp and 192 bp alleles. An allele of 158 bp was detected in 'Geros' and 'Nelson' varieties and another allele of 192 bp was identified in 'NK Technik' and 'NK Petrol'. Other detected alleles had a frequency of 0.06.
267 273 280 286
Allele size, bp
L
FIT0-063 marker identified the smallest number of alleles (5) at a frequency distribution ranging from 0.11 to 0.33. The 258 bp and 273 bp alleles at a frequency of 0.11 were unique. The specified alleles were identified in 'Geros' and 'Chornyi Veleten' varieties, respectively. Na10-B07 marker detected three alleles at a frequency of 0.04: 144, 156 and 194 bp, in 'Kliff', 'Geros' and 'Nelson' varieties, respectively.
Thus, it was found that 'Geros', 'Kliff', 'Ali-ot' and 'Chornyi Veleten' had the unique alleles, while 'Nelson' differed by Na10-B07 marker. It was found that the studied rapeseed varieties differed by at least one marker.
Cluster analysis of rapeseed varieties To find out the similarity of rapeseed varieties, we carried out cluster analysis of the matrix of the presence/absence of identified alleles. The method of unweighted pair-group average was used to divide the genotypes under investigation into clusters. The average value of genetic proximity between the members of a cluster and a candidate for inclusion in the cluster was the criterion for determining the degree of similarity [28-29]. Shown in Figure 4 are the clustering results, presented as a phyloge-netic tree.
Unweighted pair-group average EucLdean distances
'Senator Liuks' 'DanhaL' 'Chornyi veleten' 'NK Technik' 'NK PetroL' 'Geros' 'ALiot' 'KLiff 'Nelson'
1,0 1,5 2,0 2,5 3,0 3,5 4,0
Linkage Distance
Fig. 4. Cluster analysis of rapeseed varieties by SSR markers
As a result of clustering, four variety clusters emerged: 'Senator Liuks' and 'Danhal', 'NK Technik' and 'NEC Petrol', 'Geros' and 'Aliot', 'Kliff' and 'Nelson'. 'Chornyi Veleten' formed a separate cluster next to 'Senator Liuks' and 'Danhal' varieties. The value of its genetic distances in relation to other varieties was 3.46. Foreign varieties 'NK Technik' and 'NEC Petrol' with the value of genetic distances between them equal 1.41 appeared to be the most similar by the four studied SSR markers.
The most distant varieties included in one cluster were 'Kliff 'and 'Nelson' with a value of 3.32. The highest value of genetic distance (4.00) was recorded between the 'Geros' and 'Kliff' varieties. However, despite the fact these varieties belong to the same type (spring varieties), they considerably differ from each other. However, it should be emphasized that these varieties are the most distant from winter varieties and the value of their genetic distance was 3.74.
In a research conducted by Tommasini et al. [30], 10 rapeseed varieties were differentiated in terms of type (winter/spring) using a set of 15 markers. The authors found that the SSR markers had the potential to differentiate the varieties of Brassica napus L. and can be used to determine the homogeneity and differences at the initial stage of the DUS-test for the candidate varieties. However, the researchers point out that it is necessary to study and evaluate a larger number of assays and markers to develop a system for their differentiation, not only for testing purpose but also for evaluating the source materials in the breeding process.
We observed a certain differentiation of varieties according to the type of development (winter/spring). However, it should be noted that two clusters were formed by varieties of spring and winter type. The genetic distances between the 'Geros' and 'Aliot', 'Kliff' and 'Nelson' varieties were 3.16 and 3.32, respectively. Since available research data on the presence of any correlation between the marker and genes responsible for the type of plant development is not sufficient, it can be assumed that the presence or absence of certain allele by the markers under study may be related to the historical aspects of rapeseed breeding. Li et al. [11] differentiated 26 rape varieties using 11 SSR markers and found it more effective to use SSR markers compared to AFLP.
According to the research results, the differentiation of varieties according to their origin was revealed: the varieties of Ukrainian breeding ('Senator Liuks', 'Danhal' and 'Chornyi Veleten') were included in one group of clusters while foreign varieties ('NK Technik', 'Necropolis', 'Geros', 'Kliff' and 'Nelson') in the other one. However, we noted that 'Aliot' variety (Ukrainian) entered the same cluster together with a foreign spring variety. The value of genetic distances between them is 3.16. Such distribution can be explained by the involvement of genetic plasmas of high-yielding foreign varieties into the breeding process aimed at obtaining varieties with improved agronomic and economic features [31-32].
Conclusions
The research data on the allele status of microsatellite loci in winter and spring rapeseed varieties of Ukrainian and foreign origin show the polymorphism by the SSR markers Ra3-H09, Na12-A02, FIT0-063 and Na10-B07. The level of polymorphism averaged 51%. The number of polymorphic alleles was 24, which allowed us to differentiate genotypes using the studied markers. The determined genetic dis-
tances indicate that the 'Kliff' and 'Nelson' varieties are the most distant from other studied rapeseed varieties with a value of 3.32. In addition, 'Chornyi Veleten' is attributed to a separate group. The rapeseed varieties differ by at least one marker from each other, indicating the possibility of using a set of markers for their identification. This approach will allow to evaluate the breeding material for selection.
References
1. Reviron, M. P., Vartanian, N., Sallantin, M., Huet, J. C., Pernollet, J. C., & de Vienne, D. (1992). Characterization of a novel protein induced by progressive or rapid drought and salinity in Brassica napus leaves. Plant Physiol., 100(3), 1486-1493.
2. Sytnik, I. D., & Kliachenko, O. L. (2002). Brassica napus L. in culture in vitro. Ahrarna nauka i osvita [Agrarian Science and Education], 3(3-4), 15-18. [in Ukrainian]
3. Qu, C., Hasan, M., Lu, K., Liu, L., Zhang, K., Fu, F., ... Xu, X. (2015). Identification of QTL for seed coat colour and oil content in Brassica napus by association mapping using SSR markers. Can. J. Plant Sci., 95(2), 387-395. doi: 10.4141/CJPS2013-411
4. Mohammadi, P. P., Moieni, A., & Komatsu, S. (2012). Comparative proteome analysis of drought-sensitive and drought-tolerant rapeseed roots and their hybrid F1 line under drought stress. Amino Acids, 43(5), 2137-2152. doi: 10.1007/s00726-012-1299-6
5. Tlili, A., Tarhouni, M., Cerda, A., Louhaichi, M., & Neffati, M. (2018). Comparing yield and growth characteristics of four pastoral plant species under two salinity soil levels. Land Degrad. Dev., 29(9), 3104-3111. doi: 10.1002/ldr.3059
6. Munns, R. (2002). Comparative physiology of salt and water stress. Plant Cell Environ., 25(2), 239-250. doi: 10.1046/j.0016-8025.2001.00808.x
7. Yardanov, I., Velikova, V., & Tsonev, T. (2003). Plant responses to drought and stress tolerance. Bulg. J. Plant Physiol., Special Issue, 187-206.
8. Lowe, A. J., Moule, C., Trick, M. & Edwards, K. J. (2004). Efficient large-scale development of microsatellites for marker and mapping applications in Brassica crop species. Theor. Appl. Genet., 108(6), 1103-1112. doi: 10.1007/s00122-003-1522-7
9. Piquemal, J., Cinquin, E., Couton, F., Rondeau, C., Seignoret, E., Perret, D., ... Blanchard, P. (2005). Construction of an oilseed rape (Brassica napus L.) genetic map with SSR markers. Theor. Appl. Genet., 111(8), 1514-1523. doi: 10.1007/s00122-005-0080-6
10. Iniguez-Luy, F. L., Voort, A. V., & Osborn, T. C. (2008). Development of a set of public SSR markers derived from genomic sequence of a rapid cycling Brassica oleracea L. genotype. Theor. Appl. Genet., 117(6), 977-985. doi: 10.1007/ s00122-008-0837-9
11. Li, L., Wanapu, C., Huang, X., Huang, T., Li, Q., Peng, Y., & Huang, G. (2011). Comparison of AFLP and SSR for genetic diversity analysis of Brassica napus hybrids. J. Agr. Sci., 3(3), 101-110. doi: 10.5539/jas.v3n3p101
12. Channa, S. A., Tian, H., Wu, H. Q., & Hu, S. W. (2016). Analysis of genetic diversity among Rapeseed cultivars and breeding lines by SRAP and SSR molecular markers. Pak. J. Bot., 48(6), 2409-2422.
13. Aniskina, Yu. V., Shilov, I. A. & Havkinm, E. E. (2005). Using the microsatellite polymorphism analysis method to assess the genetic diversity of Brassica forms. In Okruzhayushchaya sreda i zdorov'e: mater. Vseros. nauch.-prakt. konf. molodykh uchenykh i spetsialistov [Environment and Health: Proc. of All-Russian scientific-practical Conf. of young scientists and specialists] (pp. 319-321). May 19-22, 2005, Suzdal, Russian Federation. [in Russian].
14. Geng, J., Javed, N., McVetty, P. B. E., Li, G., & Tahir, M. (2012). An integrated genetic map for Brassica napus derived from double
hapLoid and recombinant inbred popuLations. Hered. Genet., 1(1), 103. doi: 10.4172/2161-1041.1000103
15. JamaLi, S. H., Sadeghi, L., & Najafian, M. A MuLtipLex PCR assay for Discriminating CharLock from Rapeseed: ImpLications for Seed Testing. Biol. Forum Int. J., 9(2), 87-91.
16. Hasan, M., Seyis, F., Badani, A. G., Pons-Kühnemann, J., Friedt, W., Lühs, W., & Snowdon, R. J. (2006). AnaLysis of genetic diversity in the Brassica napus L. gene pooL using SSR markers. Genet. Resour. Crop Ev., 53(4), 793-802. doi: 10.1007/s10722-004-5541-2
17. Youssef, S. S., Moghaieb, R. E., EL-Mergawy, R. G., & EL-Sharkawy, A. M. (2006). Genetic markers associated with saLt toLerance in canoLa (Brassica napus L.). Arab. J. Biotech., 10(1), 143-154.
18. Satina, T. G. (2010). Tehnologiya genotipirovaniya na osnove mikrosatellitnogo analiza v selektsii rapsa (Brassica L.) [Genotyping technoLogy based on microsateLLite anaLysis in rapeseed breeding (Brassica L.)] (Extended Abstract of Cand. BioL. Sci. Diss.). ALL-Russian Research Institute of AgricuLturaL BiotechnoLogy, RAAS, Moscow, Russia [in Russian]
19. KLyachenko, O., & ShofoLova, N. (2015). Researching of stabiLity of morphogenic and unmorphogenic caLLus of winter rape (Brassica napus L.) against saLt stress. Naukovi dopovidi NUBiP Ukrainy [Scientific reports NULES of Ukraine], 50(1), 1-8.
20. Prysiazhniuk, L. M., MeLnyk, S. I., Shytikova, Yu. V., SihaLova, I. O., & Ivanytska, A. P. (2017). AppLication of SSR markers to differentiate new varieties of soybean (Glycine max (L.) Merr.). Plant Var. Stud. Prot., 13(3), 269-276 doi: 10.21498/25181017.13.3.2017.110709 [in Ukrainian]
21. Curn V., ZaLudova, J. (2007). Fingerprinting of oiLseed rape cuLtivars. Adv. Bot. Res., 45, 155-179. doi: 10.1016/s0065-2296(07)45006-6
22. Li, L. (2010). Characterization of genetic identities and relationships among Brassica napus using AFLP and SSR (Degree of Master of Science in BiotechnoLogy). Suranaree University of TechnoLogy, Nakhon Ratchasima, ThaiLand.
23. Soengas, P., Cartea, M. E., Francisco, M., Lema, M., & VeLasco, P. (2011). Genetic structure and diversity of a coLLection of Brassica rapa subsp. rapa L. reveaLed by simpLe sequence repeat markers. J. Agr. Sci., 149(5), 617-624. doi: 10.1017/ S002185961100013X
24. Wu, W., Zhou, B., Luo, D., Yan, H., Li, Y., & Kawabata, S. (2012). DeveLopment of simpLe sequence repeat (SSR) markers that are poLymorphic between cuLtivars in Brassica rapa subsp. rapa. Afr. J. Biotechnol., 11(11), 2654-2660. doi: 10.5897/AJB11.3307
25. Tkachyk, S. 0. (Ed.). (2016). Metodyka provedennia kvalifika-tsiinoi ekspertyzy sortiv roslyn na prydatnist do poshyrennia v Ukraini. Metody vyznachennia pokaznykiv yakosti produktsii roslynnytstva [ReguLations on the procedure and the conduct of qualification tests for suitability of crop varieties for dissemination in Ukraine. Methods of determining quaLity indices of crop products]. (2nd ed., rev.). Vinnytsia: NiLan-LTD. [in Ukrainian]
26. Ermantraut, E. R., Prysiazhniuk, 0. I., & Shevchenko, I. L. (2007). Statystychnyi analiz ahronomichnykh doslidnykh danykh v paketi STATISTICA 6.0 [StatisticaL anaLysis of agronomic study data using the Statistica 6.0 software suite]. Kyiv: PoLihrafKonsaLtynh. [in Ukrainian]
27. Drozdov, V. I. (2010). Instruktsiya po ispolzovaniyu paketa Statistica 6.0 [ManuaL for using Statistica 6.0]. Kursk: Izd-vo YuZGU. [in Russian]
28. Namorato, H., Miranda, G. V., de Souza, L. V., OLiveira, L. R., DeLima, R. 0., & Mantovani, E. E. (2009). Comparing BipLot MuLtivariate AnaLyses with Eberhart and RusseLL' method for genotype x environment interaction. Crop. Breed. Appl. Biot., 9(4), 299-307.
29. Everitt, B. S., Landau, S., Leese, M., & Stahl, D. (2011). Cluster Analysis. (5th ed.). Chichester: John WiLey & Sons Ltd. doi: 10.1002/9780470977811
30. Tommasini, L., BatLey, J., ArnoLd, G., Cooke, R., Donini, P., Lee, D., ... Edwards, K. (2003). The deveLopment of muLtipLex
simple sequence repeat (SSR) markers to complement distinctness, uniformity and stability testing of rape (Brassica napus L.) varieties. Theor. Appl. Genet., 106(6), 1091-1101. doi: 10.1007/s00122-002-1125-8
31. Sytnik, I. D., & Kliachenko, 0. L. (2010). Screening for source material rape for resistance to abiotic environmental factors. Bioresursy i pryrodokorystuvannia [Biological Resources and Nature Management], 2(1-2), 39-48. [in Ukrainian]
32. Kliachenko, 0. L., Sytnik, I. D., & Halchynska, 0. K. (2012). Ozymyi ta yaryi ripak. Biolohiia. Selektsiia. Biotekhnolohiia [Winter and spring rape. Biology. Selection. Biotechnology]. Kyiv: Fitosotsiotsentr. [in Ukrainian]
Використана литература
1. Reviron M. P., Vartanian N., Sallantin M. et al. Characterization of a novel protein induced by progressive or rapid drought and salinity in Brassica napus leaves. Plant Physiol. 1992. Vol. 100, Iss. 3. P. 1486-1493.
2. Ситт'к I. Д., Кляченко 0. Л. Brassica napus L. в культур1" in vitro. Аграрна наука i oceima. 2002. T. 3, № 3-4. C. 15-17.
3. Qu C., Hasan M., Lu K. et al. Identification of QTL for seed coat colour and oil content in Brassica napus by association mapping using SSR markers. Can. J. Plant Sci. 2015. Vol. 95, Iss. 2. P. 387-395. doi: 10.4141/CJPS2013-411
4. Mohammadi P. P., Moieni A., Komatsu S. Comparative proteome analysis of drought-sensitive and drought-tolerant rapeseed roots and their hybrid F1 line under drought stress. Amino Acids. 2012. Vol. 43, Iss. 5. P. 2137-2152. doi: 10.1007/s00726-012-1299-6
5. Tlili A., Tarhouni M., Cerda A. et al. Comparing yield and growth characteristics of four pastoral plant species under two salinity soil levels. Land Degrad. Dev. 2018. Vol. 29, Iss. 9. P. 3104-3111. doi: 10.1002/ldr.3059
6. Munns R. Comparative physiology of salt and water stress. Plant Cell Environ. 2002. Vol. 25, Iss. 2. P. 239-250. doi: 10.1046/ j.0016-8025.2001.00808.x
7. Yardanov I., Velikova V., Tsonev T. Plant responses to drought and stress tolerance. Bulg. J. Plant Physiol. 2003. Special Issue. P. 187-206.
8. Lowe A. J., Moule C., Trick M., Edwards K. J. Efficient large-scale development of microsatellites for marker and mapping applications in Brassica crop species. Theor. Appl. Genet. 2004. Vol. 108, Iss. 6. P. 1103-1112. doi: 10.1007/s00122-003-1522-7
9. Piquemal J., Cinquin E., Couton F. et al. Construction of an oilseed rape (Brassica napus L.) genetic map with SSR markers. Theor. Appl. Genet. 2005. Vol. 111, Iss. 8. P. 1514-1523. doi: 10.1007/s00122-005-0080-6
10. Iniguez-Luy F. L., Voort A. V., Osborn T. C. Development of a set of public SSR markers derived from genomic sequence of a rapid cycling Brassica oleracea L. genotype. Theor. Appl. Genet. 2008. Vol. 117, Iss. 6. P. 977-985. doi: 10.1007/s00122-008-0837-9
11. Li L., Wanapu C., Huang X. et al. Comparison of AFLP and SSR for genetic diversity analysis of Brassica napus hybrids. J. Agr. Sci. 2011. Vol. 3, Iss. 3. P. 101-110. doi: 10.5539/jas.v3n3p101
12. Channa S. A., Tian H., Wu H. Q., Hu S. W. Analysis of genetic diversity among Rapeseed cultivars and breeding lines by SRAP and SSR molecular markers. Pak. J. Bot. 2016. Vol. 48, Iss. 6. P. 2409-2422.
13. Анискина Ю. В., Шилов И. А., Хавкин Э. Е Использование метода анализа полиморфизма микросателлитов для оценки генетического разнообразия форм Brassica. Окружающая среда и здоровье : матер. Всерос. науч.-практ. конф. молодых ученых и специалистов (г. Суздаль, 19-22 мая 2005 г.). Суздаль, 2005. С. 319-321.
14. Geng J., Javed N., McVetty P. B. E. et al. An integrated genetic map for Brassica napus derived from double haploid and recombinant inbred populations. Hered. Genet. 2012. Vol. 1, Iss. 1. P. 103. doi: 10.4172/2161-1041.1000103
15. Jamali S. H., Sadeghi L., Najafian M. A Multiplex PCR assay for Discriminating Charlock from Rapeseed: Implications for Seed Testing. Biol. Forum Int. J. 2017. Vol. 9, Iss. 2. P. 87-91.
16. Hasan M., Seyis F., Badani A. G. et al. Analysis of genetic diversity in the Brassica napus L. gene pool using SSR markers. Genet. Resour. Crop Ev. 2006. Vol. 53, Iss. 4. P. 793-802. doi: 10.1007/s10722-004-5541-2
17. Youssef S. S., Moghaieb R. E., El-Mergawy R. G., El-Sharkawy A. M. Genetic markers associated with salt tolerance in canola (Brassica napus L.). Arab. J. Biotech. 2006. Vol. 10, Iss. 1. P. 143-154.
18. Сатина Т. Г. Технология генотипирования на основе микроса-теллитного анализа в селекции рапса (Brassica L.) : автореф. дис. ... канд. биол. наук : спец. 03.01.06 «Биотехнология» / Всерос. НИИ с.-х. биотехнологии. Москва, 2010. 21 с.
19. Кляченко 0. Л., Шофолова Н. В. Дост'дження слйкосл мор-фогенного i неморфогенного калюсу озимого р'паку (Brassica napus L.) проти сольового стресу. HayKoei donoeidi НУ-ЫП Украни. 2015. Т. 50, № 1. С. 1-8. URL: http://journals. uran.ua/index.php/2223-1609/article/view/116945/111011
20. Присяжнюк Л. М., Мельник С. I., Шилкова Ю. В. та iн. Вико-ристання SSR-маркерiв для диференц'ацА' нових сорлв соТ (Glycine max (L.) Merr.). Plant Var. Stud. Prot. 2017. Т. 13, № 3. С. 269-276. doi: 10.21498/2518-1017.13.3.2017.110709
21. Curn V., Zaludova J. Fingerprinting of oilseed rape cultivars. Adv. Bot. Res. 2007. Vol. 45. P. 155-179. doi: 10.1016/s0065-2296(07)45006-6
22. Li L. Characterization of genetic identities and relationships among brassica napus using AFLP and SSR : Degree of Master of Science in Biotechnology / Suranaree University of Technology, Nakhon Ratchasima, Thailand, 2010. 129 p.
23. Soengas P., Cartea M. E., Francisco M. et al. Genetic structure and diversity of a collection of Brassica rapa subsp. rapa L. revealed by simple sequence repeat markers. J. Agr. Sci. 2011. Vol. 149, Iss. 5. P. 617-624. doi: 10.1017/S002185961100013X
24. Wu W., Zhou B., Luo D. et al. Development of simple sequence repeat (SSR) markers that are polymorphic between cultivars in Brassica rapa subsp. rapa. Afr. J. Biotechnol. 2012. Vol. 11, Iss. 11. P. 2654-2660. doi: 10.5897/AJB11.3307
25. Методика проведення квалп'фшацп'йноТ експертизи сорлв рос-лин на придатт'сть до поширення в УкраТт. Методи визна-чення показник'в якосл продукцл рослинництва / за ред. С. 0. Ткачик. 2-ге вид., випр. и доп. В"|'нниця : Жлан-ЛТД, 2016. 160 с.
26. Ермантраут Е. Р. Присяжнюк 0. I., Шевченко I. Л. Статистич-ний анал1'з агроном'чних досл'дних даних в пакет STATISTICA 6.0. КиТв : Пол1'графКонсалтинг, 2007. 55 с.
27. Дроздов В. И. Инструкция по использованию пакета Statis-tica 6.0. Курск : Изд-во ЮЗГУ, 2010. 74 с.
28. Namorato H., Miranda G. V., de Souza L. V. et al. Comparing Biplot Multivariate Analyses with Eberhart and Russell' method for genotype x environment interaction. Crop. Breed. Appl. Biot. 2009. Vol. 9, Iss. 4. Р. 299-307.
29. Everitt B. S., Landau S., Leese M., Stahl D. Cluster Analysis. 5th ed. Chichester : John Wiley & Sons Ltd, 2011. 346 р. doi: 10.1002/9780470977811
30. Tommasini L., Batley J., Arnold G. et al. The development of multiplex simple sequence repeat (SSR) markers to complement distinctness, uniformity and stability testing of rape (Brassica napus L.) varieties. Theor. Appl. Genet. 2003. Vol. 106, Iss. 6. P. 1091-1101. doi: 10.1007/s00122-002-1125-8
31. Ситнш I. Д., Кляченко 0. Л. Скрит'нг вих'дного матер'алу р'паку на слйккть до аб'отичних фактор'в навколишнього середовища. Ыоресурси i природокористуеання. 2010. Т. 2, № 1/2. С. 39-48.
32. Кляченко 0. Л., Ситник I. Д., Гальчинська 0. К. Озимий та ярий р1'пак. Б"юлоп'я. Селекц'я. БЬтехнолопя. КиТв : Ф"|'тосо-ц'оцентр, 2012. 244 с.
YAK 633.853.494.577.213.3
KflflweHKO O. fl.1, npucfl№H№K fl. M.2*, 0o$ofloßa H. B.1, nicKOBa O. B.2 no.iMop$i3M copn'B pinaKy 03M-Moro Ta aporo (Brassica napus L.) 3a SSR MapKepaMM. Plant Varieties Studying and Protection. 2018. T. 14, № 4. C. 366-374. https://doi.org/10.21498/2518-1017.14.4.2018.151898
1HauioHanbHuuyiieepcumem öiopecypcie i npupodoKopucmyeaHHX ynpa'iiu, eyn. iepoie 06opoHU, 15, m. Kuie, 03041, YKpaiHa 2yHpaiHCbHuü iHcmumym eucnepmu3u copmiepocnuH, eyn. ieHepana PoduMueea, 15, m. Kui'e, 03041, ynpaina, *e-mail: [email protected]
MeTa. oö'hmtm reHeTMHHe pi3HoMamtTfl copTi'B pinaKy FIT0-063 BMABM.MCb a.e.i po3MipoM 258 Ta 273 n.H. 3 nacro-
3a flonoMoroio SSR-MapKepiB flna CTBopeHHa ce.eKöiMHoro tow 0,11 y copTiB Tepoc' Ta 'HopHMM Be.eTeHb' BiflnoBiflHo.
MaTepia.y i3 3acrocyBaHHAM Moro b KoMn.eKcHiM ce.eKöi'i HaMÖi.bmy Ki.bKicTb a.e.iB 6y.o oTpMMaHo 3a flonoMoroi
in vitro Ha nocyxo- Ta co.ecTiMKicTb. MeTOAM. n^P aHa.i3, MapKepy Na12-A02. BiflnoBiflHo flo oTpMMaHoro po3nofli.y
кластернии анал13. Результати. Наведено результати досл1'джень пол1морф1зму сорт1в р1паку на основ1 моле-кулярно-генетичних маркер1в. У результати анал1зу сор-т1в р1паку за досл1джуваними маркерами виявили 41 алель, тобто в середньому 10,3 алел1 на маркер. К1льк1сть пол1морфних локус1в за чотирма м1кросател1тними маркерами (Ra3-H09, Na12-A02, FITO-063 та Na10-B07) скла-дала 24 локуси. Р1вень пол1морф1зму для досл1джуваних сорт1в у середньому становив 51%: наИвищиИ р1вень (87%) в1дм1чениИ для маркера Na12-A02, наИнижчиИ (33%) - FIT0-063. В1дпов1дно до отриманого розпод1лу наИб1льшою частотою за SSR маркером Ra3-H09 вир1знялась алель розм1ром 117 п.н., яку 1дентиф1ковано у трьох сорт1в: 'Сенатор Люкс', 'Дангал' та 'ЧорниИ веле-тень'. Виявлено, що за маркером Ra3-H09 ун1кальним для досл1джуваних сорт1в виявились алел1 з частотою 0,06 та розм1рами 135 п.н. у сорту 'Ал1от' та 156 п.н. у сорту 'Кл1фф'. За маркером FIT0-063 1дентиф1ковано наИменшу к1льк1сть алел1в (5), при цьому розпод1л частот вар1ював в1д 0,11 до 0,33. Ун1кальними алелями за маркером
наИб1льше значення частоти (0,11) мали алел1 розм1ром 158 та 192 п.н. За маркером Na10-B07 з частотою 0,04 було 1дентиф1ковано три алеля. Вказан1 алел1 розм1рами 144, 156 та 194 п.н. виявили у сорт1в 'Кл1фф', 'Герос' та 'Нельсон'. У результат! кластерного анал1зу отримано чотири кластери: 'Сенатор Люкс' та 'Дангал', 'НК Техн1к' та 'НК Пе-трол', 'Герос' та 'Ал1от', 'Кл1фф' та 'Нельсон'. В1дм1чено, що сорт 'ЧорниИ велетень' не належить до жодного кластеру. Встановлено, що наИб1льш в1ддаленими виявились сорти 'Кл1фф' та 'Нельсон' 1з значенням генетичних дистанц1И 3.32. НаИб1льш под1бними за чотирма досл1джуваними SSR маркерами виявились сорти 1ноземно'1 селекц1'1 'НК Техн1к' та 'НК Петрол' з1 значенням генетичних дистанц1И м1ж ними 1.41. 1нш1 сорти мають в1дм1нност1 за щонаИменше одним маркером. Висновки. Застосування системи 1з чотирьох м1кросател1тних маркер1в забезпечуе оц1нку сортового р1зноман1ття р1паку для комплексно'1 селекц1'1 in vitro на посухо- та солест1Ик1сть.
Ключов1 слова: сортове р1зноман1ття; pinax; MiKpocameëimHi маркери; кластерный анат'з.
УДК 633.853.494.577.213.3
Кляченко 0. Л.1, Присяжнюк Л. М.2*, Шофолова Н. В.1, Писковая 0. В.2 Полиморфизм сортов рапса озимого и ярового (Brassica napus L.) по SSR маркерам // Plant Varieties Studying and Protection. 2018. T. 14, № 4. C. 366-374. https://doi.Org/10.21498/2518-1017.14.4.2018.151898
1Национальный университет биоресурсов и природопользования Украины, ул. Героев Обороны, 15, г. Киев, 03041, Украина Украинский институт экспертизы сортов растений, ул. Генерала Родимцева, 15, г. Киев, 03041, Украина, "e-mail: [email protected]
Цель. Оценить генетическое разнообразие сортов рап- ром 258 и 273 п.н. с частотой 0,11 у сортов 'Герос' и 'Чер-
са с помощью SSR маркеров для создания селекционного материала с применением его в комплексной селекции in vitro на засухо- и солеустойчивость. Методы. ПЦР анализ, кластерный анализ. Результаты. Приведены результаты исследований полиморфизма сортов рапса на основе молекулярно-генетических маркеров. В результате анализа сортов рапса по испытуемым маркерам обнаружили 41 аллель, то есть в среднем 10,3 аллелей на маркер. Количество полиморфных локусов по четырем микро-сателитным маркерам (Ra3-H09, Na12-A02, FIT0-063 и Na10-B07) составляло 24 локуса. Уровень полиморфизма изучаемых сортов в среднем составляет 51%: самый высокий уровень (87%) отмечен для маркера Na12-A02, самый низкий (33%) - FIT0-063. В соответствии с полученным распределением наибольшей частотой по SSR маркеру Ra3-H09 отличалась аллель размером 117 п.н., которую идентифицировано у трех сортов: 'Сенатор Люкс', 'Дангал' и 'Черный велетень'. Выявлено, что по маркеру Ra3-H09 уникальным для изучаемых сортов оказались аллели с частотой 0,06 и размерами 135 п.н. у сорта 'Алиот' и 156 п.н. у сорта 'Клифф'. По маркеру FIT0-063 идентифицировано наименьшее количество аллелей (5), при этом распределение частот варьировало от 0,11 до 0,33. Уникальными аллелями по маркеру FIT0-063 оказались аллели разме-
ный велетень' соответственно. Наибольшее количество аллелей было получено с помощью маркера Na12-A02. В соответствии с полученным распределением наибольшее значение частоты (0,11) было у аллелей размером 158 и 192 п.н. По маркеру Na10-B07 с частотой 0,04 было идентифицировано три аллеля. Указанные аллели размерами 144, 156 и 194 п.н. обнаружили у сортов 'Клифф', 'Герос' и 'Нельсон'. В результате кластерного анализа получено четыре кластера: 'Сенатор Люкс' и 'Дангал', 'НК Техник' и 'НК Петрол', 'Герос' и 'Алиот', 'Клифф' и 'Нельсон'. Отмечено, что сорт 'Черный велетень' не принадлежит ни к одному кластеру. Установлено, что наиболее удаленными оказались сорта 'Клифф' и 'Нельсон' со значением генетических дистанций 3.32. Наиболее подобными по четырем исследуемыми SSR маркерами оказались сорта иностранной селекции 'НК Техник' и 'НК Петрол' со значением генетических дистанций между ними 1.41. Другие сорта имеют различия по крайней мере по одному маркеру. Выводы. Таким образом, применение системы из четырех микросателлитных маркеров обеспечивает оценку сортового разнообразия рапса для комплексной селекции in vitro на засухо- и солеустойчивость.
Ключевые слова: сортовое разнообразие; рапс; мик-росателлитные маркеры; кластерный анализ.
Надтйшла/ Received 26.10.2018 Погоджено до друку/Accepted 11.12.2018
374 ISSN 2518-1017 PlANT Varieties STuDYING AND Protection, 2018, Т. 14, №4
