Научная статья на тему 'МАТРИЧНЫЕ РНК ГЕНОВ FCGR3A И FCGR3BКАК МОНИТОРИНГОВЫЕ МАРКЕРЫ ТЕЧЕНИЯСВЕТЛОКЛЕТОЧНОГО РАКА ПОЧКИ (ПИЛОТНОЕ ИССЛЕДОВАНИЕ)'

МАТРИЧНЫЕ РНК ГЕНОВ FCGR3A И FCGR3BКАК МОНИТОРИНГОВЫЕ МАРКЕРЫ ТЕЧЕНИЯСВЕТЛОКЛЕТОЧНОГО РАКА ПОЧКИ (ПИЛОТНОЕ ИССЛЕДОВАНИЕ) Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
50
16
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
МОНИТОРИНГОВЫЕ МАРКЕРЫ РАКА ПОЧКИ / МРНК ГЕНА FCGR3А / МРНК ГЕНА FCGR3В

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Алясова А.В., Амоев З.В., Школа О.О., Новиков Д.В., Селиванова С.Г.

Цель исследования - оценить возможности мРНК генов, кодирующих белки CD16a (FCGR3A) и CD16b (FCGR3B) в образцах опухоли больных раком почки, охарактеризовать течение опухолевого процесса во взаимосвязи с клинико-морфологическими факторами. Материалы и методы. В работе использовали 125 образцов опухоли пациентов с гистологически подтвержденным диагнозом рака почки T1-4N0-1M0-1. Для выделения нуклеиновых кислот применяли метод Chomczynski, Sacchi. Уровни мРНК генов определяли с помощью полимеразной цепной реакции с обратной транскрипцией и рассчитывали по формуле ΔΔCt с учетом эффективности реакции. Результаты. мРНК гена FCGR3A выявлена во всех исследованных образцах опухолевой ткани, напротив, мРНК гена FCGR3В встречалась только в 92,0% случаев (115/125). В опухолях, классифицированных как рТ1, содержание мРНК гена FCGR3А было статистически значимо ниже, чем в образцах опухолей размером рТ3. Отмечено статистически значимое повышение содержания мРНК обоих генов по мере увеличения степени злокачественности новообразования, а также в случаях появления отдаленных метастазов. Наличие опухолевого тромба в системе нижней полой вены сопровождалось статистически значимым повышением содержания мРНК гена FCGR3А. Заключение. Выявленные взаимосвязи повышения количества мРНК гена FCGR3А и в некоторых случаях - мРНК гена FCGR3В с рядом клинико-морфологических факторов в образцах опухолевой ткани у больных светлоклеточным раком почки позволяют рассматривать уровень мРНК этих генов в качестве новых мониторинговых биомаркеров.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Алясова А.В., Амоев З.В., Школа О.О., Новиков Д.В., Селиванова С.Г.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

MESSENGER RNA OF FCGR3A AND FCGR3B GENES AS MONITORING MARKERS OF CLEAR CELL RENAL ADENOCARCINOMA (A PILOT STUDY)

The aim of the study was to assess the capabilities of mRNA genes encoding CD16a (FCGR3A) and CD16b (FCGR3B) in tumor samples from patients with renal cancer, and characterize the tumor process in relation to clinical and morphological factors. Materials and Methods. We used 125 tumor samples from patients with a histologically confirmed diagnosis of renal cancer T1-4N0-1M0-1. A method described by Chomczynski and Sacchi was used to isolate nucleic acids. The mRNA levels were determined using a reverse transcription polymerase chain reaction and calculated according to ΔΔCt formula, taking into account the reaction efficiency. Results. mRNA of the FCGR3A gene was detected in all tumor tissue samples under study; in contrast, mRNA of the FCGR3B gene was found only in 92.0% (115/125) of cases. In tumors classified as pT1, the mRNA content of the FCGR3A gene was significantly lower than that in tumor samples of pT3 size. There was the significant increase in the mRNA content of both genes with an increase in tumor grade, as well as in the cases with distant metastases. The presence of a tumor thrombus in the inferior vena cava system was accompanied by a significant increase in the mRNA content of the FCGR3A gene. Conclusion. In tumor tissue samples from patients with clear cell renal cancer, the predominant production of the FCGR3A mRNA was observed in comparison with the FCGR3B mRNA. The revealed relationship of an increased amount of the FCGR3A mRNA and, in some cases, the FCGR3B mRNA with a number of clinical and morphological factors enables to consider the mRNA level of the genes as new monitoring biomarkers.

Текст научной работы на тему «МАТРИЧНЫЕ РНК ГЕНОВ FCGR3A И FCGR3BКАК МОНИТОРИНГОВЫЕ МАРКЕРЫ ТЕЧЕНИЯСВЕТЛОКЛЕТОЧНОГО РАКА ПОЧКИ (ПИЛОТНОЕ ИССЛЕДОВАНИЕ)»

ЕНЕИия

почки (пилотное исследование)

A.В. Алясова, д.м.н., профессор кафедры онкологии, лучевой терапии и лучевой диагностики1; З.В. Амоев, к.м.н., врач-уролог2;

О.О. Школа, аспирант кафедры молекулярной биологии и иммунологии3; Д.В. Новиков, к.б.н., ведущий научный сотрудник4; С.Г. Селиванова, к.б.н., старший научный сотрудник4;

B.В. Новиков, д.б.н., профессор кафедры молекулярной биологии и иммунологии3; ведущий научный сотрудник4; зав. лабораторией иммунохимии4

приволжский исследовательский медицинский университет, пл. Минина и Пожарского, 10/1, Н. Новгород, 603005;

2Приволжский окружной медицинский центр ФМБА России, ул. Ильинская, 11, Н. Новгород, 603109; Национальный исследовательский Нижегородский государственный университет им. Н.И. Лобачевского, пр. Гагарина, 23, Н. Новгород, 603950;

"Нижегородский НИИ эпидемиологии и микробиологии им. академика И.Н. Блохиной Роспотребнадзора, ул. Малая Ямская, 71, Н. Новгород, 603950

Цель исследования — оценить возможности мРНК генов, кодирующих белки CD16a (FCGR3A) и CD16b (FCGR3B) в образцах опухоли больных раком почки, охарактеризовать течение опухолевого процесса во взаимосвязи с клинико-морфологическими факторами.

Материалы и методы. В работе использовали 125 образцов опухоли пациентов с гистологически подтвержденным диагнозом рака почки T1-4N0-1M0-1. Для выделения нуклеиновых кислот применяли метод Chomczynski, Sacchi. Уровни мРНК генов определяли с помощью полимеразной цепной реакции с обратной транскрипцией и рассчитывали по формуле AACt с учетом эффективности реакции.

Результаты. мРНК гена FCGR3A выявлена во всех исследованных образцах опухолевой ткани, напротив, мРНК гена FCGR3B встречалась только в 92,0% случаев (115/125). В опухолях, классифицированных как рТ|, содержание мРНК гена FCGR3A было статистически значимо ниже, чем в образцах опухолей размером рТ3. Отмечено статистически значимое повышение содержания мРНК обоих генов по мере увеличения степени злокачественности новообразования, а также в случаях появления отдаленных метастазов. Наличие опухолевого тромба в системе нижней полой вены сопровождалось статистически значимым повышением содержания мРНК гена FCGR3A.

Заключение. Выявленные взаимосвязи повышения количества мРНК гена FCGR3A и в некоторых случаях — мРНК гена FCGR3B с рядом клинико-морфологических факторов в образцах опухолевой ткани у больных светлоклеточным раком почки позволяют рассматривать уровень мРНК этих генов в качестве новых мониторинговых биомаркеров.

Ключевые слова: мониторинговые маркеры рака почки; мРНК гена FCGR3A; мРНК гена FCGR3B.

Как цитировать: Alyasova A.V., Amoev Z.V., Shkola O.O., Novikov D.V., Seiivanova S.G., Novikov V.V. Messenger RNA of FCGR3A and FCGR3B genes as monitoring markers of clear cell renal adenocarcinoma (a pilot study). Sovremennye tehnologii v medicine 2022; 14(3): 22, https://doi.org/10.17691/stm2022.14.3.03

English

Messenger RNA of FCGR3A and FCGR3B Genes as Monitoring Markers of Clear Cell Renal Adenocarcinoma (a Pilot Study)

A.V. Alyasova, MD, DSc, Professor, Department of Oncology, Radiation Therapy and Radiation Diagnostics1; Z.V. Amoev, MD, PhD, Urologist2;

Для контактов: Алясова Анна Валерьевна, e-mail: alyasovaav68@mail.ru

O.O. Shkola, PhD Student, Department of Molecular Biology and Immunology3;

D.V. Novikov, PhD, Leading Researcher4;

S.G. Selivanova, PhD, Senior Researcher4;

V.V. Novikov, DSc, Professor, Department of Molecular Biology and Immunology3; Leading Researcher4;

Head of the Laboratory of Immunochemistry4

1Privolzhsky Research Medical University, 10/1 Minin and Pozharsky Square, Nizhny Novgorod, 603005, Russia;

2Volga District Medical Centre of Federal Medical Biological Agency of Russia, 14 Ilyinskaya St., Nizhny Novgorod,

603109, Russia;

3National Research Lobachevsky State University of Nizhni Novgorod, 23 Prospekt Gagarina, Nizhny Novgorod,

603950, Russia;

4Blokhina Scientific Research Institute of Epidemiology and Microbiology of Nizhny Novgorod,

Federal Service for Surveillance on Consumer Rights Protection and Human Wellbeing (Rospotrebnadzor),

71 Malaya Yamskaya St., Nizhny Novgorod, 603950, Russia

The aim of the study was to assess the capabilities of mRNA genes encoding CD16a (FCGR3A) and CD16b (FCGR3B) in tumor samples from patients with renal cancer, and characterize the tumor process in relation to clinical and morphological factors.

Materials and Methods. We used 125 tumor samples from patients with a histologically confirmed diagnosis of renal cancer T1-4N0-1M0-1. A method described by Chomczynski and Sacchi was used to isolate nucleic acids. The mRNA levels were determined using a reverse transcription polymerase chain reaction and calculated according to AACt formula, taking into account the reaction efficiency.

Results. mRNA of the FCGR3A gene was detected in all tumor tissue samples under study; in contrast, mRNA of the FCGR3B gene was found only in 92.0% (115/125) of cases. In tumors classified as pT1, the mRNA content of the FCGR3A gene was significantly lower than that in tumor samples of pT3 size. There was the significant increase in the mRNA content of both genes with an increase in tumor grade, as well as in the cases with distant metastases. The presence of a tumor thrombus in the inferior vena cava system was accompanied by a significant increase in the mRNA content of the FCGR3A gene.

Conclusion. In tumor tissue samples from patients with clear cell renal cancer, the predominant production of the FCGR3A mRNA was observed in comparison with the FCGR3B mRNA. The revealed relationship of an increased amount of the FCGR3A mRNA and, in some cases, the FCGR3B mRNA with a number of clinical and morphological factors enables to consider the mRNA level of the genes as new monitoring biomarkers.

Key words: monitoring renal cancer markers; mRNA of FCGR3A gene; mRNA of FCGR3B gene.

Введение

Почечно-клеточный рак составляет 80-85% от новообразований почки и 2-3% — от всех злокачественных новообразований [1]. Несмотря на успехи в диагностике, хирургическом и лекарственном его лечении, клинический исход остается неудовлетворительным [2]. Одной из причин этого является отсутствие биомаркеров, позволяющих контролировать течение заболевания и индивидуализировать лечение [3].

В процессе опухолевого роста важная роль принадлежит иммунной системе организма, контролирующей развитие новообразования и распространение метастазов [4]. В иммунном ответе на опухоль участвуют натуральные киллеры ^К-клетки), ней-трофилы, моноциты/макрофаги. В мониторинговых целях может использоваться оценка экспрессии генов FCGR3A и FCGR3B, кодирующих белки CD16a и CD16b. Экспрессия белка CD16a характерна для натуральных киллеров. Дополнительно CD16a обнаруживается на мембране моноцитов, тканеспецифичных макрофагов, у§ Т-лимфоцитов и дендритных клеток [5, 6]. Белок CD16b является молекулярным маркером нейтрофилов [7]. Кроме того, CD16b на низком уровне экспрессируется на базофилах и выявляется на эози-нофилах после индукции IFN-Y [2].

Оценка экспрессии мембранных молекул CD16 используется для определения популяционного состава клеток периферической крови и их функционального состояния при онкологических заболеваниях. Имеется весьма ограниченная информация о взаимосвязи между уровнями мРНК генов, кодирующих CD16a (FCGR3A) и CD16b (FCGR3B) в опухоли, и клинико-морфологическими факторами, определяющими течение рака, в том числе рака почки. Однако детального изучения экспрессии генов FCGR3A и FCGR3B на транскрипционном уровне не проводилось.

Цель исследования — оценить возможности мРНК генов, кодирующих белки CD16a (FCGR3A) и CD16b (FCGR3B) в образцах опухолей больных раком почки, охарактеризовать течение опухолевого процесса во взаимосвязи с клинико-морфологиче-скими факторами.

Материалы и методы

В работе использовали 125 образцов опухолей пациентов с гистологически подтвержденным диагнозом рака почки Т^^^Мд^. Образцы опухолевой ткани были получены в ходе выполнения оперативного вмешательства — нефрэктомии или резекции почки. Среди обследованных было 63,2% мужчин (79/125) и

Таблица 1

Последовательность олигонуклеотидов, использованных для постановки реакции

Структура олигонуклеотидов

Ген Олигонуклеотид Первичная структура (5'—3')

Uni-F CAGCTGGCATGCGGACTGA

FCGR3A RA-R CACTGTCCTTCTCGAGCACC

FAB Z ROX-CTGTGGTGTTCCTGGAGCCTCAATGGTA-BHQ-2

Uni-F CAGCTGGCATGCGGACTGA

FCGR3B RB-R CACTGTCCTTCTCAAGCACG

FAB Z ROX-CTGTGGTGTTCCTGGAGCCTCAATGGTA-BHQ-2

UBC F GCACAGCTAGTTCCGTCGCA

Убиквитин С UBC R TGCATTGTCAAGTGACGAT

UBC Z CY5-ATTTGGGTCGCAGTTCTTGTTTGTGGAT-BHQ-2

36,8% женщин (46/125), средний возраст больных — 60,2 года. У 44,0% участников исследования (55/125) новообразование почки соответствовало T1, у 6,4% (8/125) — T2, у 49,6% (62/125) — T3. Степень злокачественности опухоли по Fuhrman: GI — 16,8% (21/125) пациентов; GII — 17,6% (22/125); GIII — 57,6% (72/125); GIV — 8% (10/125). Поражение регионарных лимфоузлов выявлено в 17,6% случаев (22/125), наличие отдаленных метастазов — в 40,3% (31/125): в надпочечники — 22,6% (7/31); легкие — 29,0% (9/31); кости — 25,8% (8/31); печень — 22,6% (7/31). Наличие опухолевого тромба в системе нижней полой вены отмечено в 25,6% наблюдений (32/125).

Объемы диагностики и лечения больных раком почки соответствовали рекомендуемым алгоритмам по диагностике и лечению злокачественных новообразований, утвержденным Минздравом России. Исследование проведено в соответствии с Хельсинкской декларацией (2013) и одобрено Этическим комитетом Приволжского окружного медицинского центра ФМБА России. От каждого пациента получено информированное согласие.

Для выделения нуклеиновых кислот применяли метод Chomczynski, Sacchi [8]. Комплементарную ДНК синтезировали с использованием обратной транскрип-тазы M-MLV («Силекс», Россия) согласно рекомендации производителя. Определение относительного уровня мРНК генов FCGR3A и FCGR3B проводили с применением полимеразной цепной реакции (ПЦР) в реальном масштабе времени, с использованием ам-плификаторов CFX96 Touch (Bio-Rad, США) в течение 1 ч 15 мин по следующей программе: 94,0°С — 2 мин (42 цикла ПЦР по 20 с); 60,0°С — 20 с; 72,0°С — 20 с. Реакционная смесь содержала: 4,1 мкл Н2О (биди-стиллят); 1,5 мкл 10х буфера; 1,2 мкл MgCl2; 1,2 мкл дезоксинуклеозидтрифосфатов (dNTP); 0,2 мкл HotTaq-полимеразы («Силекс») и по 1,8 мкл каждого из олигонуклеотидов («Синтол», Россия), последовательность которых представлена в табл. 1.

Уровни мРНК рассчитывали по формуле AACt с учетом эффективности реакции [9]. Нормировку их

осуществляли относительно уровня мРНК убиквитина С (иВС).

Статистическую обработку результатов проводили с помощью программ Statistica V. 8.0. Проверку гипотезы о соответствии распределения полученных вариантов нормальному распределению осуществляли с помощью критерия Шапиро-Уилка. Для определения количественных показателей подсчитывали медиану (Ме| квартили Q1 (25%) и Q3 (75%). Для сравнения двух независимых групп по количественным признакам применяли дву_ сторонний критерий Манна-Уитни,

для сравнения трех и более независимых групп — критерий Краскела-Уоллиса. Различия между группами считали статистически значимыми при р<0,05.

Результаты и обсуждение

Проведенные исследования показали, что мРНК гена FCGR3A выявляется во всех исследованных образцах опухолевой ткани. Напротив, мРНК гена FCGR3В встречалась только в 92,0% случаев (115/125). Содержание мРНК гена FCGR3A в опухоли было в 2,2 раза выше (р<0,05), чем FCGR3В (табл. 2).

Таким образом, развитие рака почки сопровождалось преимущественной активацией экспрессии гена FCGR3A, что может свидетельствовать о высокой степени инфильтрации опухоли, в первую очередь NK-клетками.

Уровень мРНК гена FCGR3A в образцах опухоли мужчин был выше, чем у женщин, в 1,2 раза (р>0,05) (см. табл. 2). Гендерные различия иммунологических показателей приводятся и в литературе, например у больных колоректальным раком [10, 11]. Содержание мРНК гена FCGR3В в обеих группах статистически значимо не различалось.

У больных с опухолями, классифицированными как

Таблица 2

Содержание мРНК генов FCGR3A и FCGR3B у больных раком почки (Me [25%; 75%])

Группы мРНК FCGR3A мРНК FCGR3B

Мужчины, n=79 0,269 [0,147; 0,413] 0,102 [0,021; 0,187]

Женщины, n=46 0,219 [0,137; 0,314]# 0,128 [0,037; 0,233]

Всего, n=125 0,238 [0,144; 0,379] 0,109 [0,026; 0,208]*

Примечания. Различия статистически значимы (р<0,05): * — при сравнении содержания мРНК генов РОБНЗА и РООНЗВ; # — при сравнении содержания мРНК гена РОБНЗА у мужчин и женщин.

Таблица 3

Содержание мРНК генов FCGR3A и FCGR3В у больных раком почки в зависимости от размера первичного очага и степени злокачественности опухоли (Me [25%; 75%])

Группы мРНК FCGR3A мРНК FCGR3В

Размер:

рТ1, п=55 (1) 0,199 [0,103; 0,298] 0,091 [0,026; 0,175]

рТ2, п=8 (2) 0,462 [0,241; 0,503] 0,046 [0,010; 0,081]*

рТз, п=62 (3) 0,305 [0,193; 0,450] 0,147 [0,034; 0,406]

Р1-3<0,05

Степень

злокачественности:

GI, п=21 (4) 0,147 [0,082; 0,229] 0,099 [0,063; 0,166]

011, п=22 (5) 0,227 [0,144; 0,316] 0,076 [0,020; 0,178]

Р4-5<0,05

^3111, п=72 (6) 0,379 [0,239; 0,530] 0,126 [0,002; 0,598]

Р4-6<0,05

014 п=10 (7) 0,439 [0,404; 0,763] 0,435 [0,207; 0,737]

р4-7<0,05 р4-7<0,05

* — различия статистически значимы при сравнении содержания мРНК генов FCGR3A и FCGR3В внутри группы рТ2 (р<0,05).

рТ1, содержание мРНК гена РОвИЗА было статистически значимо ниже (р<0,05), чем в образцах пациентов, имевших опухоли размером рТ3, — в 1,5 раза (табл. 3). Отличий в уровнях мРНК гена РОвИЗВ у лиц, имеющих различные размеры первичного очага, не обнаружено (р>0,05). Следует отметить существование статистически значимых различий количества мРНК этих генов в образцах опухолей, классифицируемых как рТ2, где уровень мРНК гена РОвИЗА превышал содержание мРНК гена РОвИЗВ в 10 раз (р<0,05). В образцах опухолей, относящихся к рТ1 и рТ3, содержание тестированных мРНК генов РОвИЗА и РОвИЗВ не различалось (р>0,05), а уровень мРНК гена РОвИЗА был выше содержания мРНК гена РОвИЗВ только в 2,2 и 2,0 раза соответственно.

Обращает на себя внимание разнонаправленный характер изменений уровней мРНК этих генов в данных группах (см. табл. 3). По-видимому, содержание мРНК гена РОвИЗА является более чувствительным маркером роста первичной опухоли, чем количество мРНК гена РОвИЗВ. В литературе имеются сведения о возможной вовлеченности РОвИЗА в регуляцию хронического воспаления в опухолях больных колоректальным раком [10]. Нельзя исключить подобные механизмы участия РОвИЗА в патогенезе рака почки.

В исследовании проведена оценка содержания мРНК генов РОвИЗА и РОвИЗВ в опухолях с разной степенью злокачественности (0З). При GII уровень мРНК гена РОвИЗА воз-

растал в 1,5 раза (р<0,05) по сравнению с его значением в образцах больных с опухолями GI, при GШ — в 2,6 (р<0,05), при GIV — в 2,9 раза (р<0,05) соответственно (см. табл. 3). Количество мРНК гена РОвИЗВ в образцах опухолей GIV увеличивалось в 4,4 раза (р<0,05) по сравнению с ее содержанием в образцах новообразований GI.

Полученные результаты свидетельствуют, что изменения исследуемых мРНК носят однонаправленный характер, связанный с ростом содержания как мРНК гена РОвИЗА, так и мРНК гена РОвИЗВ по мере увеличения степени злокачественности опухоли. Выявленные различия содержания мРНК этих генов у больных с опухолями разной степени злокачественности указывают, что по мере увеличения злокачественности новообразования нарастает напряженность иммунного ответа, что не оптимально для торможения опухолевого роста. Предположительно это связано с участием самой опухоли в процессах экспрессии мембранных белков на поверхности иммунокомпетентных клеток [12]. Кроме того, вполне вероятно, что по мере роста размеров первичного новообразования или повышения его степени злокачественности происходит нарастание степени выраженности воспалительных процессов в окружающих тканях, которое сопровождается привлечением в опухоль различных лейкоцитарных клеток, в том числе нейтрофилов, NK-клеток и макрофагов.

Наличие или отсутствие метастазов в регионарных лимфоузлах не сопровождалось статистически значимыми различиями количества мРНК генов РОвИЗА и РОвИЗВ в образцах опухолевой ткани у пациентов (р>0,05). Напротив, при появлении отдаленных метастазов уровень мРНК гена РОвИЗА был в 1,7 (р<0,05), а содержание мРНК гена РОвИЗВ — в 1,2 раза выше (р<0,05), чем у лиц, не имевших вторичных очагов поражения (табл. 4).

В случае наличия опухолевого тромба в системе нижней полой вены содержание мРНК гена РОвИЗА возрастало по сравнению с показателями лиц, у которых тромб не выявлялся, в 1,7 раза (р<0,05). Количество мРНК гена РОвИЗВ статистически значимо не различалось в обеих этих группах.

Таблица 4

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Содержание мРНК генов FCGR3A и FCGR3В у больных раком почки в зависимости от наличия отдаленных метастазов и опухолевых тромбов ^ [25%; 75%])

Группы мРНК FCGR3A мРНК FCGR3В

Метастазов нет, п=94 (1) 0,226 [0,138; 0,330] р1-2<0,05 0,102 [0,033; 0,190] р1-2<0,05

Метастазы есть, п=31 (2) 0,376 [0,185; 0,433] 0,126 [0,015; 0,219]

Наличие тромба, п=32 (3) 0,381 [0,217; 0,485] 0,127 [0,036; 0,305]

Отсутствие тромба, п=93 (4) 0,221 [0,135; 0,314] Р3-4<0,05 0,102 [0,024; 0,188]

Выявление отдаленных метастазов и/или опухолевых тромбов в системе нижней полой вены относится к неблагоприятным факторам прогноза [13-15]. Можно предположить, что повышенная инфильтрация опухоли нейтрофилами и NK-клетками наблюдается в более прогностически неблагоприятных случаях. Натуральные киллеры играют ключевую роль в защите от злокачественных или вирус-инфицированных клеток [16]. Они могут быть «специфически активированы» через определенные Fc-рецепторы, которые экспрессируются на их клеточной поверхности, в том числе FcyRШA, передающие активирующие сигналы внутрь клетки. После активации Fc-рецепторов антителами, связанными с клетками-мишенями, способны лизировать клетки-мишени без прайминга и секретировать цитокины, такие как гамма-интерферон [17, 18]. По-видимому, высокий уровень мРНК гена РООНЗА в этих условиях связан с повышенной экспрессией FcyRШa, направленной на активацию и потому в особо прогностически неблагоприятных ситуациях наблюдается повышение уровня мРНК гена РООНЗВ.

Связи между инфильтрацией почечно-клеточной карциномы клетками иммунной системы и клинико-па-тологическими характеристиками остаются до настоящего времени неясными и активно изучаются. Состав опухоль-инфильтрирующих лейкоцитов весьма ге-терогенен. К лейкоцитам, инфильтрирующим опухоль, относят лимфоциты (CD8+ Т-клетки, ТИ-клетки, В-лимфоциты), дендритные клетки, опухоль-ассо-циированные макрофаги, нейтрофилы, N^1^™. Относительно реже встречаются Т1|2- и регуляторные Т-клетки, что предполагает преобладание провоспа-лительного профиля. С помощью масс-спектрометрии относительно недавно показано, что превалирует популяция Т-лимфоцитов, затем следуют опухоль-ас-социированные макрофаги, осуществляющие FcYR-опосредованный фагоцитоз, N^1^™, В-клетки, дендритные клетки и нейтрофилы [19]. В опухолевом микроокружении наряду с Т-регуляторами находятся инфильтрирующие опухоль супрессорные миелоид-ные клетки, которые блокируют развитие эффективного иммунного ответа [20].

Еще одним типом иммунных клеток, вносящим вклад в опухолевую иммуносупрессию, являются опухоль-ассоциированные макрофаги [21]. Показано, что отсутствие ответа на ингибиторы тирозинкина-зы связано с повышением количества в опухолевых очагах активированных опухоль-ассоциированных макрофагов [19]. Установлено, что опухоль-ассоции-рованные NK-клетки имеют пониженную экспрессию CD16, но их количество в процентном отношении в 8 раз превышает содержание этих же клеток в крови. При этом известна очень высокая вариабельность количества NK-клеток у разных больных, по-видимому, зависящая от течения опухолевого процесса и влияющая на опухолевое микроокружение [22]. Показано, что степень инфильтрации NK-клетками

и экспрессия маркеров (CD16 и цитотоксинов) определяют функциональную способность NK-клеток, инфильтрирующих почечно-клеточную карциному, и могут быть использованы для характеристики подгрупп почечно-клеточного рака [23]. Обнаружены положительные корреляции между содержанием макрофагов, стадией опухоли и степенью злокачественности новообразования. Кроме того, выявлено, что ассоциированные с опухолью нейтрофилы способствуют прогрессированию новообразования через ограничение противоопухолевого иммунитета, воздействуя на местное воспаление, ангиогенез и лимфангиогенез [24]. Полученные нами результаты свидетельствуют о повышении уровня экспрессии генов, кодирующих CD16a в NK-клетках, макрофагах, CD16b — в нейтрофилах и соответствуют представленным в литературных источниках данным.

Заключение

В образцах опухолевой ткани у больных светло-клеточным раком почки происходит преимущественная продукция мРНК гена FCGR3A в сравнении с мРНК гена FCGR3B. Содержание мРНК гена FCGR3A возрастает при наличии клинико-морфологических признаков неблагоприятного прогноза заболевания: повышения степени злокачественности новообразования, появления отдаленных метастазов, опухолевого тромба в системе нижней полой вены.

Содержание мРНК гена FCGR3A в опухолевой ткани больных более подвержено количественным изменениям, связанным с выявлением неблагоприятных прогностических факторов, чем уровень мРНК гена FCGR3B. Однако в случаях опухолей низкой степени дифференцировки или при появлении вторичных очагов поражения продукция мРНК гена FCGR3B возрастает по сравнению с ее значением в более прогностически благоприятных ситуациях.

Уровень экспрессии мРНК гена FCGR3A и в некоторых случаях — мРНК гена FCGR3B в ткани опухоли у больных раком почки позволяет говорить о прогностическом значении этих генов в оценке течения заболевания.

Источники финансирования. Исследование выполнено по инициативе и с использованием средств авторов.

Конфликт интересов. Авторы не имеют конфликта интересов.

Литература/References

1. Siegel R.L., Miller K.D., Jemal A. Cancer statistics, 2018. CA Cancer J Clin 2018; 68(1): 7-30, https://doi. org/10.3322/caac.21442.

2. Barata P.C., Rini B.I. Treatment of renal cell carcinoma: current status and future directions. CA Cancer J Clin 2017; 67(6): 507-524, https://doi.org/10.3322/caac.21411.

3. Zhang S., Zhang E., Long J., Hu Z., Peng J., Liu L.,

Tang F., Li L., Ouyang Y., Zeng Z. Immune infiltration in renal cell carcinoma. Cancer Sci 2019; 110(5): 1564-1572, https:// doi.org/10.1111/cas.13996.

4. Giraldo N.A., Becht E., Vano Y., Sautes-Fridman C., Fridman W.H. The immune response in cancer: from immunology to pathology to immunotherapy. Virchows Arch 2015; 467(2): 127-135, https://doi.org/10.1007/s00428-015-1787-7.

5. Gillis C., Gouel-Cheron A., Jonsson F., Bruhns P. Contribution of human FcyRs to disease with evidence from human polymorphisms and transgenic animal studies. Front Immunol 2014; 5: 254, https://doi.org/10.3389/ fimmu.2014.00254.

6. Wang E., Adams S., Stroncek D.F., Marincola F.M. Human leukocyte antigen and human neutrophil antigen systems. In: Hematology. Silberstein L.E., Anastasi J., Hoffman R., Benz E.J., Heslop H., Weitz J. (editors). Elsevier; 2018: p. 1721-1737, https://doi.org/10.1016/b978-0-323-35762-3.00113-x.

7. Bhatnagar N., Ahmad F., Hong H.S., Eberhard J., Lu I.N., Ballmaier M., Schmidt R.E., Jacobs R., Meyer-Olson D. FcyRNI (CD16)-mediated ADCC by NK cells is regulated by monocytes and FcyRII (CD32). Eur J Immunol 2014; 44(11): 3368-3379, https://doi.org/10.1002/eji.201444515.

8. Chomczynski P., Sacchi N. The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: twenty-something years on. Nat Protoc 2006; 1(2): 581-585, https://doi.org/10.1038/nprot.2006.83.

9. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-aact method. Methods 2001; 25(4): 402-408, https://doi. org/10.1006/meth.2001.1262.

10. Красногорова Н.В., Новиков Д.В., Фомина С.Г., Алясова А.В., Магомедов М.А., Новиков В.В., Караулов А.В. Уровень мРНК CD16A и CD16B как потенциальный иммунологический маркер при колоректальном раке. Бюллетень сибирской медицины 2019; 18(1): 220-227, https://doi. org/10.20538/1682-0363-2019-1-220-227.

Krasnogorova N.V., Novikov D.V., Fomina S.G., Alyasova A.V., Magomedov M.A., Novikov V.V., Karaulov A.V. The CD16A and CD16B mRNA level as potential immunological marker in colorectal cancer. Bulleten' sibirskoj mediciny 2019; 18(1): 220-227, https://doi.org/10.20538/1682-0363-2019-1-220-227.

11. Klein S.L., Flanagan K.L. Sex differences in immune responses. Nat Rev Immunol 2016; 16(10): 626-638, https:// doi.org/10.1038/nri.2016.90.

12. Головизнин М.В. Вмешательство раковых клеток в процессы созревания и селекции Т-лимфоцитов как фактор опухолевой прогрессии. Иммунология 2001; 6: 4-10.

Goloviznin M.V. Intervention of cancer cells in the processes of maturation and selection of T-lymphocytes as a factor in tumor progression. Immunologia 2001; 6: 4-10.

13. Давыдов М.И., Матвеев В.Б., Полоцкий Б.Е., Матвеев Б.П., Носов Д.А. Хирургическое лечение метастазов рака почки в легких. Российский онкологический журнал 2003; 4: 15-18.

Davydov M.I., Matveev V.B., Polotsky B.E., Matveev B.P., Nosov D.A. Surgical treatment of renal carcinoma metastases to the lungs. Rossijskij onkologiceskij zumal 2003; 4: 15-18.

14. Serena G., Gonzalez J., Gaynor J.J., Salerno T., Verzaro R., Ciancio G. Pulmonary tumor embolization as early manifestation in patients with renal cell carcinoma and tumor thrombus: perioperative management and outcomes. J Card Surg 2019; 34(10): 1018-1023, https://doi.org/10.1111/ jocs.14182.

15. Manso M., Pacheco-Figueiredo L., Santos-Silva A., Silva J., Silva C., Cruz F. Renal cell carcinoma with venous thrombus: should surgery be offered when metastasis is present at diagnosis? Urol Int 2018; 101(4): 387-390, https:// doi.org/10.1159/000493510.

16. Vivier E., Tomasello E., Baratin M., Walzer T., Ugolini S. Functions of natural killer cells. Nat Immunol 2008; 9: 503-510, https://doi.org/10.1038/ni1582.

17. Campbell K.S., Hasegawa J. Natural killer cell biology: an update and future directions. J Allergy Clin Immunol 2013; 132(3): 536-544, https://doi.org/10.1016/jjaci.2013.07.006.

18. Wang W., Erbe A.K., Hank J.A., Morris Z.S., Sondel P.M. NK cell-mediated antibody-dependent cellular cytotoxicity in cancer immunotherapy. Front Immunol 2015; 6: 368, https://doi.org/10.3389/fimmu.2015.00368.

19. Hakimi A.A., Voss M.H., Kuo F., Sanchez A., Liu M., Nixon B.G., Vuong L., Ostrovnaya I., Chen Y.B., Reuter V., Riaz N., Cheng Y., Patel P., Marker M., Reising A., Li M.O., Chan T.A., Motzer R.J. Transcriptomic profiling of the tumor microenvironment reveals distinct subgroups of clear cell renal cell cancer — data from a randomized phase III trial. Cancer Discov 2019; 9(4): 510-525, https://doi.org/10.1158/2159-8290.cd-18-0957.

20. Díaz-Montero C.M., Rini B.I., Finke J.H. The immunology of renal cell carcinoma. Nat Rev Nephrol 2020; 16(12): 721-735, https://doi.org/10.1038/s41581-020-0316-3.

21. Gabrilovich D.I., Nagaraj S. Myeloid-derived suppressor cells as regulators of the immune system. Nat Rev Immunol 2009; 9(3): 162-174, https://doi.org/10.1038/nri2506.

22. Guan Y., Chambers C.B., Tabatabai T., Hatley H., Delfino K.R., Robinson K., Alanee S.R., Ran S., Torry D.S., Wilber A. Renal cell tumors convert natural killer cells to a proangiogenic phenotype. Oncotarget 2020; 11(26): 25712585, https://doi.org/10.18632/oncotarget.27654.

23. Schleypen J.S., Baur N., Kammerer R., Nelson P.J., Rohrmann K., Gröne E.F., Hohenfellner M., Haferkamp A., Pohla H., Schendel D.J., Falk C.S., Noessner E. Cytotoxic markers and frequency predict functional capacity of natural killer cells infiltrating renal cell carcinoma. Clin Cancer Res 2006; 12(3 Pt 1): 718-725, https://doi.org/10.1158/1078-0432. ccr-05-0857.

24. Xu W., Jiang X., Guan C., Gu M. The prognostic and predictive value of tumor infiltrating macrophage and neutrophil in patient with clear cell renal cell carcinoma: tumor infiltrating lymphocytes in renal cell carcinoma. Medicine (Baltimore) 2020; 99(46): e23181, https://doi.org/10.1097/ md.0000000

i Надоели баннеры? Вы всегда можете отключить рекламу.