Научная статья на тему 'Уровень мРНК cd16a и cd16b как потенциальный иммунологический маркер при колоректальном раке'

Уровень мРНК cd16a и cd16b как потенциальный иммунологический маркер при колоректальном раке Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
127
31
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
CD16A / FCGR3A / CD16B / FCGR3B / МРНК / КОЛОРЕКТАЛЬНЫЙ РАК / MRNA / COLORECTAL CANCER

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Красногорова Н.В., Новиков Д.В., Фомина С.Г., Алясова А.В., Магомедов М.А.

Цель исследования оценить уровни мРНК генов, кодирующих CD16А (FCGR3A) и CD16B (FCGR3B), в периферической крови и опухолях больных колоректальным раком (КРР).Материалы и методы. В исследование включили 66 больных КРР, проходивших лечение в Нижегородском областном клиническом онкологическом диспансере. Группа сравнения состояла из 111 доноров крови из Нижегородского областного центра крови имени Н.Я. Климовой. Определение относительных уровней мРНК в образцах периферической крови и опухолях проводили методом обратной транскрипции полимеразной цепной реакции в реальном времени.Результаты. В периферической крови больных КРР уровень мРНК FCGR3A и FCGR3B был статистически значимо ниже, чем у здоровых лиц. Сниженный уровень сохранялся через 7-10 дней после операции. Нормированный уровень мРНК FCGR3A в крови и опухолях больных КРР, а также в крови здоровых доноров в несколько раз превышал уровень мРНК FCGR3В. На II стадии развития опухоли у больных КРР уровень мРНК FCGR3A и FCGR3В статистически значимо понижался, но по мере прогрессии опухоли нормализовался. Умеренная степень дифференцировки опухоли также характеризовалась падением уровня мРНК тестированных генов, при высокой степени дифференцировки наблюдалась направленность к падению. Сниженный уровень мРНК FCGR3A и FCGR3В в крови больных обнаруживался при отсутствии метастазов. В образцах опухолей мРНК FCGR3A тестировалась в 95,5% случаев, мРНК FCGR3В 68,2%. Прогрессирование КРР сопровождалось повышением уровня мРНК FCGR3A в опухолях, уровень мРНК FCGR3В не менялся. Обнаружена положительная корреляционная связь уровня мРНК FCGR3A с уровнем мРНК TNF и FOXP3, что свидетельствует о возможной вовлеченности FCGR3A в регуляцию хронического воспаления в опухолях больных КРР.Заключение. В крови и образцах опухолей обнаружены изменения уровня мРНК генов, кодирующих молекулы CD16A (FCGR3A) и CD16B (FCGR3A). Результаты свидетельствуют о потенциальной возможности использования данных показателей в качестве мониторинговых иммунологических маркеров при КРР.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Красногорова Н.В., Новиков Д.В., Фомина С.Г., Алясова А.В., Магомедов М.А.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

The CD16A and CD16B mRNA level as potential immunological marker in colorectal cancer

The purpose of this study is to evaluate mRNA levels of genes encoding CD16A (FCGR3A) and CD16B (FCGR3B) in peripheral blood and tumors of colorectal cancer patients (CRC).Materials and methods. The study included 66 CRC patients from Nizhny Novgorod Regional Clinical Oncology Center and 111 people without cancer as a comparison group from Nizhny Novgorod Regional Blood Center named after N.Ya. Klimova. The mRNA relative levels in peripheral blood and tumor was detected by reverse transcription real-time polymerase chain reaction. The mRNA levels correlation and association with CRC clinical characteristics were assessed by statistic methods.Results. The study suggests that in the peripheral blood of CRC patients the levels of mRNA FCGR3A and FCGR3B were statistically significantly lower than in healthy individuals. The mRNA levels remained low at 7-10 days after surgery. The FCGR3A mRNA normalized level in the blood and tumors of CRC patients, as well as in the blood of healthy individuals, was several times higher than the FCGR3B mRNA level. At the II stage of tumor development in CRC patients, the FCGR3A and FCGR3B mRNA levels were statistically significantly decreased, but as the tumor progressed is normalized. Moderate degree of tumor differentiation was also characterized by a drop in mRNA levels of the tested genes. Reduced FCGR3A and FCGR3B mRNA levels in the blood of patients were observed in the absence of metastases. In tumor samples, FCGR3A mRNA was tested in 95.5% of cases, FCGR3B mRNA in 68.2% of cases. Progression of CRC was accompanied by an increase in FCGR3A mRNA level in tumors, the FCGR3B mRNA level did not change. Positive correlation of FCGR3A mRNA level with TNF and FOXP3 mRNA levels was found, which indicates the possible involvement of FCGR3A in the regulation of chronic inflammation in tumors of CRC patients.Conclusion. Changes in mRNA levels of genes encoding CD16A (FCGR3A) and CD16B (FCGR3A) molecules were detected in blood and tumor samples. The results indicate the potential for their use as monitoring immunological markers in CRC.

Текст научной работы на тему «Уровень мРНК cd16a и cd16b как потенциальный иммунологический маркер при колоректальном раке»

УДК 616.348/.35-006.6-097

https://doi.org: 10.20538/1682-0363-2019-1-220-227

Уровень мРНК CD16A и CD16B как потенциальный иммунологический маркер при колоректальном раке

Красногорова Н.В.1, Новиков Д.В.1, Фомина С.Г.1, Алясова А.В.2, Магомедов М.А.3, Новиков В.В.1, Караулов А.В.4

1 Национальный исследовательский Нижегородский государственный университет (ННГУ) имени Н.И. Лобачевского Россия, 603950, г. Нижний Новгород, пр. Гагарина, 23

2 Приволжский исследовательский медицинский университет (ПИМУ) Россия, 603005, г. Нижний Новгород, пл. Минина и Пожарского, 10/1

3 Нижегородский областной клинический онкологический диспансер (НОКОД) Россия, 603081, г. Нижний Новгород, шоссе Анкудиновское, 1

4 Первый Московский государственный медицинский университет (МГМУ) им. И.М. Сеченова (Сеченовский университет)

Россия, 119991, г. Москва, ул. Трубецкая, 8/2 РЕЗЮМЕ

Цель исследования - оценить уровни мРНК генов, кодирующих CD16A (FCGR3A) и CD16B (FCGR3B), в периферической крови и опухолях больных колоректальным раком (КРР).

Материалы и методы. В исследование включили 66 больных КРР, проходивших лечение в Нижегородском областном клиническом онкологическом диспансере. Группа сравнения состояла из 111 доноров крови из Нижегородского областного центра крови имени Н.Я. Климовой. Определение относительных уровней мРНК в образцах периферической крови и опухолях проводили методом обратной транскрипции - полимеразной цепной реакции в реальном времени.

Результаты. В периферической крови больных КРР уровень мРНК FCGR3A и FCGR3B был статистически значимо ниже, чем у здоровых лиц. Сниженный уровень сохранялся через 7-10 дней после операции. Нормированный уровень мРНК FCGR3A в крови и опухолях больных КРР, а также в крови здоровых доноров в несколько раз превышал уровень мРНК FCGR3В. На II стадии развития опухоли у больных КРР уровень мРНК FCGR3A и FCGR3В статистически значимо понижался, но по мере прогрессии опухоли нормализовался. Умеренная степень дифференцировки опухоли также характеризовалась падением уровня мРНК тестированных генов, при высокой степени дифферен-цировки наблюдалась направленность к падению. Сниженный уровень мРНК FCGR3A и FCGR3В в крови больных обнаруживался при отсутствии метастазов. В образцах опухолей мРНК FCGR3A тестировалась в 95,5% случаев, мРНК FCGR3В - 68,2%. Прогрессирование КРР сопровождалось повышением уровня мРНК FCGR3A в опухолях, уровень мРНК FCGR3В не менялся. Обнаружена положительная корреляционная связь уровня мРНК FCGR3A с уровнем мРНК TNF и FOXP3, что свидетельствует о возможной вовлеченности FCGR3A в регуляцию хронического воспаления в опухолях больных КРР.

Заключение. В крови и образцах опухолей обнаружены изменения уровня мРНК генов, кодирующих молекулы CD16A (FCGR3A) и CD16B (FCGR3A). Результаты свидетельствуют о потенциальной возможности использования данных показателей в качестве мониторинговых иммунологических маркеров при КРР.

Ключевые слова: CD16A, FCGR3A, CD16B, FCGR3B, мРНК, колоректальный рак.

Н Караулов Александр Викторович, e-mail: drkaraulov@mail.ru.

Конфликт интересов. Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.

Источник финансирования. Поддерживается Проектом повышения конкурентоспособности ведущих российских университетов среди ведущих мировых научно-образовательных центров.

Соответствие принципам этики. Исследование одобрено комиссией по биотике ННГУ имени Н.И. Лобачевского (протокол № 7 от 28.09.2018 г.).

Для цитирования: Красногорова Н.В., Новиков Д.В., Фомина С.Г., Алясова А.В., Магомедов М.А., Новиков В.В., Караулов А.В. Уровень мРНК CD16A и CD16B как потенциальный иммунологический маркер при колоректальном раке. Бюллетень сибирской медицины. 2019; 18 (1): 220-227. https://doi. org: 10.20538/1682-0363-2019-1-220-227.

УДК 616.348/.35-006.6-097

https://doi.org: 10.20538/1682-0363-2019-1-220-227

The CD16A and CD16B mRNA level as potential immunological marker in colorectal cancer

Krasnogorova N.V.1, Novikov D.V.1, Fomina S.G.1, Alyasova A.V.2, Magomedov MA.3, Novikov V.V.1, Karaulov A.V.4

1 National Research Nizhny Novgorod State University N.I. Lobachevsky (UNN) 23, Gagarin Av, Nizhny Novgorod, 603950, Russian Federation

2 Privolzhsky Research Medical University (PRMU)

10/1, Minin and Pozharsky Sq, Nizhny Novgorod, 603005, Russian Federation

3 Nizhny Novgorod Regional Clinical Oncology Center

1 Ankudinovskoe Sh, Nizhny Novgorod, 603081, Russian Federation

4 Sechenov First Moscow Medical University

8/2, Trubetskoy Str, Moscow, 119991, Russian Federation

ABSTRACT

The purpose of this study is to evaluate mRNA levels of genes encoding CD16A (FCGR3A) and CD16B (FCGR3B) in peripheral blood and tumors of colorectal cancer patients (CRC).

Materials and methods. The study included 66 CRC patients from Nizhny Novgorod Regional Clinical Oncology Center and 111 people without cancer as a comparison group from Nizhny Novgorod Regional Blood Center named after N.Ya. Klimova. The mRNA relative levels in peripheral blood and tumor was detected by reverse transcription real-time polymerase chain reaction. The mRNA levels correlation and association with CRC clinical characteristics were assessed by statistic methods.

Results. The study suggests that in the peripheral blood of CRC patients the levels of mRNA FCGR3A and FCGR3B were statistically significantly lower than in healthy individuals. The mRNA levels remained low at 7-10 days after surgery. The FCGR3A mRNA normalized level in the blood and tumors of CRC patients, as well as in the blood of healthy individuals, was several times higher than the FCGR3B mRNA level. At the II stage of tumor development in CRC patients, the FCGR3A and FCGR3B mRNA levels were statistically significantly decreased, but as the tumor progressed is normalized. Moderate degree of tumor differentiation was also characterized by a drop in mRNA levels of the tested genes. Reduced FCGR3A and FCGR3B mRNA levels in the blood of patients were observed in the absence of metastases. In tumor samples, FCGR3A mRNA was tested in 95.5% of cases, FCGR3B mRNA in 68.2% of cases. Progression of CRC was accompanied by an increase in FCGR3A mRNA level in tumors, the FCGR3B mRNA level did not change. Positive correlation of FCGR3A mRNA level with TNF and FOXP3 mRNA levels was found, which indicates the possible involvement of FCGR3A in the regulation of chronic inflammation in tumors of CRC patients.

Conclusion. Changes in mRNA levels of genes encoding CD16A (FCGR3A) and CD16B (FCGR3A) molecules were detected in blood and tumor samples. The results indicate the potential for their use as monitoring immunological markers in CRC.

Key words: CD16A, FCGR3A, CD16B, FCGR3B, mRNA, colorectal cancer.

Conflict of interest. The authors declare the absence of obvious and potential conflicts of interest related to the publication of this article.

Source of financing. Supported by the Project to increase the competitiveness of leading Russian universities among the world's leading research and educational centers.

Conformity with the principles of ethics. The study was approved by the bioethics commission under UNN (Protocol No. 7 of 28.09.2018).

For citation: Krasnogorova N.V., Novikov D.V., Fomina S.G., Alyasova A.V., Magomedov M.A., Novi-kov V.V., Karaulov A.V. The CD16A and CD16B mRNA level as potential immunological marker in colorectal cancer. Bulletin of Siberian Medicine. 2019; 18 (1): 220-227. https://doi.org: 10.20538/16820363-2019-1-220-227.

ВВЕДЕНИЕ

Низкоаффинные рецепторы Fc-фрагментов иммуноглобулинов G III типа (CD16, FCGR3) кодируются у человека двумя генами: FCGR3A и FCGR3B. Экспрессия белка CD16A (FCGR3A) характерна для натуральных киллеров. Дополнительно CD16A обнаруживается на мембране моноцитов, тканеспецифичных макрофагов, yST-лимфоцитов и дендритных клеток. Белок CD16B (FCGR3B) является молекулярным маркером нейтрофилов. Также CD16B на низком уровне экспрессируется на базофилах и выявляется на эозинофилах после индукции интерфероном у [1]. Оценка экспрессии мембранных молекул CD16 используется для определения популяци-онного состава клеток периферической крови и их функционального состояния при различных, в том числе онкологических заболеваниях. Так, при колоректальном раке (КРР) показано, что фенотипическая оценка содержания CD16+-клеток может быть использована для прогноза выживаемости больных и предсказания ответа на химиотерапию [2]. Однако на транскрипционном уровне детального изучения экспрессии FCGR3A и FCGR3B генов в периферической крови и опухолях больных КРР не проводилось.

Целью исследования явилась оценка уровня мРНК генов, кодирующих CD16A (FCGR3A) и CD16B (FCGR3B), в периферической крови и опухолях больных КРР.

МАТЕРИАЛЫ И МЕТОДЫ

Исследован биологический материал от 66 больных КРР, проходивших лечение в ГБУЗ НО «Нижегородский областной клинический

онкологический диспансер». Для сравнения использовали периферическую кровь от 111 здоровых доноров, полученную из «Нижегородского областного центра крови имени Н.Я. Климовой». От каждого участника было получено информированное согласие на включение в исследование.

Все исследуемые образцы смешивали с равным объемом консервирующего раствора (4 М гуанидин тиоционат, 100 мМ цитрат натрия и 0,1%-й Triton X-100) и хранили при -20 °С до использования. Выделение нуклеиновых кислот проводили методом, предложенным в работе P. Chomczynski и N. Sacchi [3]. Комплементарную ДНК синтезировали с использованием обратной транскриптазы M-MLV (ЗАО «Силекс», Россия) согласно рекомендации производителя. Определение относительного уровня мРНК FCGR3 и фактора некроза опухоли (TNF) проводили с применением полимеразной цепной реакции (ПЦР) в реальном времени с использованием амплификаторов DTlite 4 (ООО «ДНК-Технология», Россия) и CFX96 Touch™ (BioRad, США) в следующих температурных режимах: 94 °C -10 мин, 50 циклов ПЦР 94 °C - 20 с, 60 °C - 20 с, 72 °C - 20 с. Для мРНК FOXP3 использовали следующие условия: 94 °C - 10 мин, 50 циклов ПЦР 94 °C - 30 с, 55 °С - 30 с, 72 °С - 30 с. Реакционная смесь содержала 70 мМ трис-HCl, pH 8,3, 16 мМ (NH4)2SO4, 2 мМ MgCl2, 2,5 единицы активности HotTaq-полимеразы (ЗАО «Силекс», Россия), 0,8 мМ дезоксинуклеозидтрифосфатов и по 0,4 нМ каждого из олигонуклеотидов (ЗАО «Синтол», Россия), последовательность которых представлена в табл. 1.

Т а б л и ц а 1 Т a b l e 1

Структура олигонуклеотидов Oligonucleotides structure

Ген Gene Олигонуклеотид Oligonucleotide Первичная структура (5'—3') Primary structure (5'-3')

FCGR3A или/or B FAB GCTCTGCTACTTCTAGTTTCA

FCGR3A RA CACTGTCCTTCTCGAGCACC

FCGR3B RB CACTGTCCTTCTCAAGCACG

FCGR3A или/or B FAB Z ROX-CTGTGGTGTTCCTGGAGCCTCAATGGTA-BHQ-2

UBC UBC F GCACAGCTAGTTCCGTCGCA

UBC R GAAGATCTGCATTGTCAAGT

UBC Z Cy5-ATTTGGGTCGCAGTTCTTGTTTGTGGAT-RTQ-2

YWHAZ YW F TGCAATGATGTACTGTCTCT

YW R ACTGATCGACAATCCCTTTC

YW Z Cy5-ATTACTACCGTTACTTGGCTGAGGTTGCC-BHQ-2

TNF TNF F CTCTTCTCCTTCCTGATCGTG

TNF R TTGAGGGTTTGCTACAACATGG

TNF Z ROX-AGAGTTCCCCAGGGACCTCTCTCTAATC-BHQ-2

FOXP3 FOXP3F GAGAAGCTGAGTGCCATGCA

FOXP3 R GGAGCCCTTGTCGGATGAT

FOXP3Z FAM- TGCCATTTTCCCAGCCAGGTGG-BHQ-1

Уровни мРНК рассчитывали по формуле AACt с учетом эффективности реакции [4]. Нормировку уровней мРНК в периферической крови проводили относительно уровня мРНК убиквитина С (UBC), в ткани опухолей - относительно среднего геометрического уровней мРНК (UBC) и тирозин 3-монооксигеназы/триптофан 5-монооксигеназы активационного протеина зета (YWHAZ).

Статистическую обработку данных выполняли методами статистики с помощью компьютерных программ Statistica, версия 8.0 (StatSoft Inc., США) и GraphPad Prism, версия 5.0 (GraphPad Software, США). Исследованные количественные показатели представлены в виде Ме (Q1-Q3), где Ме - медиана, Q1 - нижний квартиль (25%), (Q3)-верхний квартиль (75%). Для сравнения двух независимых групп по количественным признакам применяли двусторонний критерий Манна - Уит-ни (U), при сравнении трех и более независимых групп использовали критерий Краскела - Уолли-са (H). Различия между группами считали статистически значимыми при р < 0,05. Для установления связей между уровнями мРНК рассчитывали коэффициент корреляции Спирмена r.

РЕЗУЛЬТАТЫ

Определение относительного уровня мРНК генов FCGR3A и FCGR3B в периферической крови доноров и больных КРР показало, что она детектировалась во всех исследованных образ-

цах. Уровень мРНК FCGR3A и FCGR3B в крови первичных больных КРР был статистически значимо ниже, чем у доноров в среднем в 1,5 раза (p < 0,05). Сниженные уровни сохранялись через 7-10 дней после резекции опухоли. Нормированный уровень мРНК FCGR3A у больных КРР и доноров был в среднем в три раза выше уровня мРНК FCGR3B (рис.).

У мужчин, больных КРР, обнаруживалось статистически значимое снижение уровня мРНК FCGR3B в 1,8 раза (р = 0,022) по сравнению со здоровыми мужчинами и отмечалась направленность к снижению уровня мРНК FCGR3A. У женщин, больных КРР, наблюдали лишь тенденцию к снижению уровня мРНК обоих исследуемых генов.

При сопоставлении уровня мРНК FCGR3A и FCGR3B в периферической крови у больных КРР в зависимости от особенностей течения заболевания выявлялся сходный характер их изменений. Так, у больных с высокодифференцированными и умеренно дифференцированными опухолями обнаруживался пониженный уровень мРНК FCGR3A и FCGR3B. У больных с низкодифференцированны-ми опухолями уровень экспрессии тестированных генов в периферической крови был выше и достигал нормальных значений. Обнаружено, что на III, IV стадиях заболевания уровень мРНК FCGR3A и FCGR3B в крови больных КРР находился в пределах нормы, на II стадии был статистически значимо ниже, чем у доноров.

« _

К си

Сц >

S ^

S <3

к >5

QJ 2

« Он

0,25

0,20 -

0,15

0,10

0,05

0,00

FCGR3A *

FCGR3B *

Рисунок. Уровень мРНК FCGR3A и FCGR3B в периферической крови: 1 - доноров (n = 111), 2 - больных КРР при поступлении в стационар и 3 - после оперативного вмешательства (n = 42). * р < 0,05

Figure. The FCGR3A and FCGR3B mRNA level in peripheral blood: 1 - donors, (n = 111), 2 - patients with CRC at admission in hospital (n = 54), 3 - after surgery (n = 42). * р < 0.05

При этом необходимо отметить, что на I стадии также выявлялся нормальный уровень мРНК тестированных генов. В случае прорастания опухоли в мышечную оболочку (Т2) уровни мРНК обоих генов в крови больных соответствовали нормальным значениям. Дальнейшее прорастание опухоли (Т3) сопровождалось статистически значимым падением уровня мРНК FCGR3A и FCGR3B (p < 0,05), а на стадии Т4 в крови боль-

ных опять регистрировались их уровни, соответствующие таковым у здоровых доноров.

При отсутствии регионарных метастатических узлов уровень мРНК FCGR3A и FCGR3B был статистически значимо ниже нормы в 2,0 и 2,6 раза соответственно (^ < 0,05). Появление регионарных метастатических узлов (N1 и N2) приводило к увеличению уровней мРНК тестируемых генов до нормальных значений. Наличие отдаленных метастазов также сопровождалось нормальным уровнем мРНК FCGR3A и FCGR3B. На 7-10-й день после удаления опухоли статистически значимых различий в уровне мРНК FCGR3A и FCGR3B у одних и тех же больных при поступлении в стационар и после оперативного вмешательства не обнаруживалось.

При исследовании уровня мРНК FCGR3A и FCGR3B в опухолях больных КРР частота обнаружения составила 95,5% (63/66) и 68,2% (45/66) соответственно. При этом медиана уровня мРНК FCGR3A превышала медиану уровня мРНК FCGR3B в 12,2 раза. Уровень мРНК FCGR3A и FCGR3B в опухолях больных разного возраста, пола и с разной степенью дифференцировки опухоли статистически значимо не отличались. На I стадии отмечался наименьший уровень мРНК FCGR3A, который обнаруживал направленность к повышению, и на IV стадии превышал исходную величину в 3,5 раза (р = 0,04). Наиболее высокий уровень мРНК FCGR3A выявлялся у больных с множественными метастазами в лимфатические узлы. В отличие от мРНК FCGR3A уровень мРНК FCGR3В в опухолях не обнаруживал статистически значимых изменений на разных стадиях КРР и в зависимости от наличия и отсутствия метастазов (табл. 2).

Т а б л и ц а 2 Т a b l e 2

Уровень мРНК FCGR3A и FCGR3B в периферической крови и опухолях больных колоректальным раком, Ме (Qj—Q3)

The FCGR3A and FCGR3B mRNA levels in peripheral blood and tumors of colorectal cancer patients, Me (Qj-Q3)

Параметр Characteristic Категория Category Кол-во больных Number of patients Уровень мРНК в крови Blood mRNA levels Уровень мРНК в опухолях Tumor mRNA levels

кровь blood опухоль tumor FCGR3A FCGR3B FCGR3A FCGR3B

Степень дифференцировки Differentiation degree Высокая High 8 6 0,087* (0,035-0,121) 0,031 (0,014-0,058) 0,018 (0,012-0,151) 0,002 (0-0,374)

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Умеренная Moderate 27 35 0,080*4 (0,040-0,160) 0,026Ч (0,015-0,061) 0,063 (0,029-0,270) 0,015 (0-0,090)

Низкая Low 5 5 0,169 (0,128-0,274) 0,056 (0,040-0,067) 0,057 (0,011-0,103) 0,001 (0-0,040)

Стадия заболевания Stage of the disease I 6 6 0,105 (0,036-0,211) 0,037 (0,014-0,063) 0,018 (0,014-0,034) 0,002 (0-0,113)

П р о д о л ж е н и е т а б л. 2 E n d o f t a b l e 2

Параметр Characteristic Категория Category Кол-во Number больных of patients Уровень мРНК в крови Blood mRNA levels Уровень мРНК в опухолях Tumor mRNA levels

кровь blood опухоль tumor FCGR3A FCGR3B FCGR3A FCGR3B

II 18 18 0,044Ч (0,032-0,109) 0,016Ч (0,012-0,038) 0,098 (0,015-0,433) 0,022 (0-0,107)

III 6 24 0,096 (0,048-0,175) 0,040 (0,017-0,053) 0,059 (0,023-0,171) 0,001 (0-0,026)

IV 8 11 0,130 (0,088-0,271) 0,042 (0,030-0,113) 0,063** (0,028-0,106) 0,012 (0-0,035)

Размер опухоли Tumor size Т2 7 4 0,169 (0,037-0,277) 0,056 (0,015-0,067) 0,038 (0,020-0,115) 0,012 (0,002-0,324)

Т3 21 20 0,076Ч (0,033-0,095) 0,023Ч (0,013-0,037) 0,178 (0,033-0,598) 0,008 (0-0,077)

Т4 13 4 0,151 (0,051-0,195) 0,034 (0,022-0,064) 0,171 (0,046-0,674) 0,018 (0-0,083)

Метастазы в лимфатические узлы Lymph nodes metastases N0 31 11 0,052Ч (0,037-0,169) 0,025Ч (0,014-0,056) 0,235 (0,046-0,837) 0,053 (0-0,123)

N1 8 13 0,096 (0,062-0,206) 0,040 (0,022-0,069) 0,039 (0,019-0,129) 0,012 (0-0,026)

N2 2 4 0,118 (0,080-0,156) 0,032 (0,026-0,037) 0,593*** (0,284-1,359) 0 (0-0,165)

Отдаленные метастазы Distant metastases M0 35 24 0,055Ч (0,037-0,160) 0,024 Ч (0,014-0,044) 0,148 (0,0313-0,531) 0,018 (03-0,088)

M1 6 4 0,153**** (0,0973-0,342) 0,051**** (0,0313-0,150) 0,090 (0,0183-1,235) 0,080 (0,0013-0,167)

* статистически значимые различия в сравнении с низкодифференцированными опухолями. ** статистически значимые различия в сравнении с I стадией. *** статистически значимые различия в сравнении с N1. **** статистически значимые различия в сравнении с M0. Ч статистически значимые различия в сравнении с донорами крови.

* statistically significant differences compared with low differentiated tumors. ** statistically significant differences compared with I stage. *** statistically significant differences compared with N1. **** statistically significant differences compared with M0. 4 statistically significant differences compared with blood donors.

Для оценки связи между провоспалительным окружением клеток опухоли и уровнем экспрессии мРНК FCGR3 у 58 больных КРР определяли относительный уровень мРНК TNF и FOXP3. Уровень мРНК FCGR3A значимо позитивно коррелировал с уровнями мРНК FOXP3 (r = 0,31; р = 0,02) и TNF (r = 0,35; р = 0,09). Связи уровня мРНК FCGR3В с уровнем мРНК TNF и FOXP3 не обнаружено.

ОБСУЖДЕНИЕ

Развитие КРР сопровождается множественными нарушениями в состоянии иммунной системы, в том числе в количестве клеток, экспрессирую-щих CD16A и CD16B. На фоне тенденции к повышению числа натуральных киллеров, являющихся основными носителями CD16A, в периферической крови регистрируется снижение их функциональной активности [5]. Кроме того, наблюдается повышение числа CD16B+ нейтрофилов в периферической крови [6]. В соответствии с полученными нами данными, в клетках крови больных КРР обнаруживается ярко выраженная направленность

к падению экспрессии обоих генов, кодирующих изоформы СБ16. Наиболее глубокое подавление активности тестированных генов регистрировалось на II стадии КРР. Поздние стадии сопровождались нормализацией уровней мРНК. При этом более выраженные нарушения были выявлены у больных мужского пола, что отражает гендерные различия в картине иммунологических сдвигов при КРР [7]. Полученные данные являются дополнением к картине иммунологических нарушений, связанных с развитием иммуносупрессии при КРР, и демонстрируют снижение клетками крови экспрессии генов, кодирующих СБ16Л и СБ16Б. Различия в уровне мРНК FCGR3A и FCGR3B на разных стадиях заболевания потенциально могут быть использованы в мониторинговых целях.

Как в периферической крови, так и в опухолях нормированный уровень экспрессии гена FCGR3A многократно превышал уровень экспрессии FCGR3В. Опухоли характеризовались более высоким соотношением уровня экспрессии FCGR3A и FCGR3B. Это может быть связано или с незначи-

тельной инфильтрацией опухолей нейтрофилами, или с эффектом гибели нейтрофилов в опухолевом микроокружении путем нетоза, который, как недавно продемонстрировано, реализуется с участием CD16B [8]. Прогрессирование КРР сопровождалось повышением в опухолях уровня мРНК FCGR3A, но не FCGR3B. Положительная корреляционная связь уровня мРНК FCGR3A с уровнем мРНК TNF и FOXP3 отражает вероятную вовлеченность экспрессии FCGR3A в регуляцию хронического воспаления в опухолях больных КРР. Ранее нами также была обнаружена корреляция уровня мРНК FCGR3A с экспрессией в опухолях больных КРР генов IL2Ra, MUC1, ICAM1, а также провоспалительного цитокина IL-32 [9].

Ранее показано, что увеличение процентного содержания активированных РОХРЗ-позитивных Т-регуляторных клеток, инфильтрующих опухоль, ассоциировано с присутствием регионарных и отдаленных метастазов у больных КРР [10], а уровень мРНК FOXP3 увеличен в опухолях больших размеров [11]. В нашем исследовании уровень мРНК FCGR3A также был повышен в опухолях больных с множественными регионарными метастазами, что указывает на вероятную связь высокого уровня мРНК FCGR3A с прогрессиро-ванием опухолевого процесса.

ЗАКЛЮЧЕНИЕ

Нормированный уровень мРНК FCGR3A в крови и опухолях больных КРР, а также в крови здоровых доноров в среднем в несколько раз превышал уровень мРНК FCGR3B. На II стадии КРР уровень мРНК FCGR3A и FCGR3B понижались, но по мере прогрессирования опухоли нормализовались. Сниженный уровень мРНК FCGR3A и FCGR3B в крови больных наблюдался при отсутствии метастазов. Прогрессирование КРР сопровождалось повышением в опухолях уровня мРНК FCGR3A, уровень мРНК FCGR3B не менялся. Обнаружена положительная корреляционная связь уровня мРНК FCGR3A с уровнем мРНК TNF и FOXP3, что свидетельствует о возможной вовлеченности FCGR3A в регуляцию хронического воспаления в опухолях больных КРР. Результаты свидетельствуют о потенциальной возможности использования при КРР уровня мРНК FCGR3A и FCGR3B в качестве иммунологического маркера в мониторинговых целях.

ЛИТЕРАТУРА / REFERENŒS

1. Gillis C., Gouel-Cheron A., Jonsson F., Bruhns P. Contribution of human FcyRs to disease with evidence from

human polymorphisms and transgenic animal stud-

ies. Front. Immunol. 2014; 5: 254. DOI: 10.3389/fim-mu.2014.00254.

2. Schauer D., Starlinger P., Alidzanovic L., Zajc P., Maier T., Feldman A., Padickakudy R., Buchberger E., Elleder V., Spittler A., Stift J., Pop L., Gruenberger B., Gruenberger T., Brostjan C. Chemotherapy of colorectal liver metastases induces a rapid rise in intermediate blood monocytes which predicts treatment response. Oncoimmunology. 2016; 5 (6): e1160185. DOI: 10.1080/2162402X.2016.1160185.

3. Chomczynski P., Sacchi N. The single-step method of RNA isolation by acid guanidinium thiocyanate-phe-nol-chloroform extraction: twenty-something years on. Nature protocols. 2006; 1 (2): 581-585. DOI: 10.1038/ nprot.2006.83.

4. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-AACT Method. Methods. 2001; 25 (4): 402-408. DOI: 10.1006/meth.2001.1262.

5. Rocca Y.S., Roberti M.P., Julia E.P., Pampena M.B., Bruno L., Rivero S., Huertas E., Sanchez Loria F., Pairola A., Caignard A., Mordoh J., Levy E.M. Phenotypic and functional dysregulated blood NK cells in colorectal cancer patients can be activated by cetuximab plus IL-2 or IL-15. Front. Immunol. 2016; 7: 413. DOI: 10.3389/fim-mu.2016.00413.

6. Shaul M.E., Fridlender Z.G. Cancer related circulating and tumor-associated neutrophils - subtypes, sources and function. FEBS J. 2018 (в печати). DOI: 10.1111/febs.14524.

7. Klein S.L., Flanagan K.L. Sex differences in immune responses. Nat. Rev. Immunol. 2016; 16 (10): 626-638. DOI: 10.1038/nri.2016.90.

8. Millrud C.R., Kagedal A., Kumlien Georen S., Winqvist O., Uddman R., Razavi R., Munck-Wikland E., Cardell L.O. NET-producing CD16hi«h CD62Ldim neutrophils migrate to tumor sites and predict improved survival in patients with HNSCC. Int. J. Cancer. 2017; 140 (11): 25572567. DOI: 10.1002/ijc.30671.

9. Новиков Д.В., Фомина С.Г., Гурина Н.Н., Перен-ков А.Д., Красногорова Н.В., Шумилова С.В., Луков-никова Л.Б., Новиков В.В., Караулов А.В. Корреляция экспрессии MUC1, ICAM1, IL32, FcyR3A и FoxP3 в опухолевых очагах больных раком молочной железы. Клиническая лабораторная диагностика. 2017; 62 (1): 35-39. [Novikov D.V., Fomina S.G., Gurina N.N., Peren-kov A.D., Krasnogorova N.V., Shumilova S.V., Lukovni-kova L.B., Novikov V.V., Karaulov A.V. The correlation of expression of MUC 1, ICAM 1, IL 32, FcyR3A and FoxP3 in tumor nidus of patients with breast cancer. 2017; 62 (1): 35-39 (in Russ.)].

10. Lin Y.C., Mahalingam J., Chiang J.M., Su P.J., Chu Y.Y., Lai H.Y., Fang J.H., Huang C.T., Chiu C.T., Lin C.Y. Activated but not resting regulatory T cells accumulated in tumor microenvironment and correlated with tumor progression in patients with colorectal cancer. Int. J. Cancer. 2013; 132 (6): 1341-1350. DOI: 10.1002/ijc.27784.

11. Ganapathi S.K., Beggs A.D., Hodgson S.V., Kumar D.

Expression and DNA methylation of TNF, IFNG and nificance. Br. J. Cancer. 2014; 111 (8): 1581-1589. DOI:

FOXP3 in colorectal cancer and their prognostic sig- 10.1038/bjc.2014.477.

Вклад авторов

Красногорова Н.В. - выполнение практической части исследования, разработка дизайна, анализ и интерпретация данных, написание рукописи статьи. Новиков Д.В. -разработка концепции и дизайна, проверка критически важного интеллектуального содержания. Фомина С.Г. - получение данных. Новиков В.В. - проверка интеллектуального содержания, окончательное утверждение для публикации рукописи. Алясова А.В. - значительный вклад в концепцию статьи. Магомедов М.А. -значительный вклад в концепцию статьи. Караулов А.В. -проверка интеллектуального содержания, окончательное утверждение для публикации рукописи.

Authors contribution

Krasnogorova N.V. - carrying out of the research, design, analysis and interpretation of the data, drafting of the manuscript. Novikov D.V. - conception and design, critical revision of the manuscript for important intellectual content. Fomina S.G. - acquisition of the data. Novikov V.V. -critical revision of the manuscript for important intellectual content, final approval of the manuscript for publication. Alyasova A.V. - significant contribution to the conception of the manuscript. Magomedov M.A. - significant contribution to the conception of the manuscript. Karaulov A.V. - critical revision of the manuscript for important intellectual content, final approval of the manuscript for publication.

Сведения об авторах

Красногорова Наталья Викторовна, аспирант, кафедра молекулярной биологии и иммунологии, мл. науч. сотрудник, научно-образовательный центр «Физика твердотельных наноструктур», ННГУ им. Н.И. Лобачевского, г. Нижний Новгород. ORCID iD 0000-0002-8800-4553.

Новиков Дмитрий Викторович, канд. биол. наук, доцент, вед. науч. сотрудник, научно-образовательный центр «Физика твердотельных наноструктур», ННГУ им. Н.И. Лобачевского, г. Нижний Новгород. ORCID iD 0000-0001-9320-2151.

Фомина Светлана Григорьевна, канд. биол. наук, ст науч. сотрудник, научно-образовательный центр «Физика твердотельных наноструктур», ННГУ им. Н.И. Лобачевского, г. Нижний Новгород. ORCID iD 0000-0003-38983228.

Алясова Анна Валерьевна, д-р мед. наук, профессор, кафедра онкологии, ПИМУ, г. Нижний Новгород. ORCID iD 0000-0003-2621-0359.

Магомедов Магомед Абдулгапурович, хирург-онколог, НОКОД, г. Нижний Новгород. ORCID iD 0000-0002-2578-197X.

Новиков Виктор Владимирович, д-р биол. наук, профессор, зав. кафедрой молекулярной биологии и иммунологии, ННГУ им. Н.И. Лобачевского, г. Нижний Новгород. ORCID iD 0000-0002-0880-6565.

Караулов Александр Викторович, д-р мед. наук, профессор, академик РАН, лаборатория иммунопатологии, Институт молекулярной медицины; кафедра клинической иммунологии и аллергологии, Первый МГМУ им. И.М. Сеченова, г. Москва. ORCID iD 0000-0002-1930-5424.

(*) Караулов Александр Викторович, e-mail: drkaraulov@mail.ru.

Поступила в редакцию 13.10.2018 Подписана в печать 17.12.2018

Authors information

Krasnogorova Natalya V., PhD Student, Department of Molecular Biology and Immunology, Junior Researcher, Research and Education Centre for Physics of Solid State Nanostructures, UNN, Nizhny Novgorod, Russian Federation. ORCID iD 0000-0002-8800-4553.

Novikov Dmitry V., PhD, Assistant Professor, Leading Researcher, Research and Education Centre for Physics of Solid State Nanostructures, UNN, Nizhny Novgorod, Russian Federation. ORCID iD 0000-0001-9320-2151.

Fomina Svetlana G., PhD, Senior Researcher, Research and Education Centre for Physics of Solid State Nanostructures, UNN, Nizhny Novgorod, Russian Federation. ORCID iD 0000-0003-3898-3228.

Alyasova Anna V., DM, Professor, Oncology Department, PRMU, Nizhny Novgorod, Russian Federation. ORCID iD 0000-0003-2621-0359.

Magomedov Magomed A., Surgeon-Oncologist, Nizhny Novgorod Regional Clinical Oncology Center, Nizhny Novgorod, Russian Federation. ORCID iD 0000-0002-2578-197X.

Novikov Viktor V., DBSc, Professor, Head of the Department of Molecular Biology and Immunology, UNN, Nizhny Novgorod, Russian Federation. ORCID iD 0000-00020880-6565.

Karaulov Alexander V., DM, Professor, Academician of the Russian Academy of Sciences, Laboratory for Immunopathology, Department of Clinical Immunology and Allergy, Sechenov First Moscow Medical University, Moscow, Russian Federation. ORCID iD 0000-0002-1930-5424.

(*) Karaulov Alexander V., e-mail: drkaraulov@mail.

ru.

Received 13.10.2018 Accepted 17.12.2018

i Надоели баннеры? Вы всегда можете отключить рекламу.