CC BY
43УДК/UDC 612.392.81:637.54:579.67 DOI 10.21323/2414-438X-2017-2-4-76-95
Оригинальная научная статья
КОНЦЕПТУАЛЬНЫЕ ПОДХОДЫ К ЭКСПРЕСС-ВЫЯВЛЕНИЮ CAMPYLOBACTER SPP. В МЯСЕ УБОЙНЫХ ЖИВОТНЫХ
Батаева Д.С.,* Минаев М.Ю., Юшина Ю.К., Соколова О.В., Зайко Е.В.
Федеральный научный центр пищевых систем им. В.М. Горбатова РАН, Москва, Россия
Ключевые слова: бактерии рода Campylobacter, говядина, птица, ПЦР. Аннотация
Современный подход формирования качества продуктов питания, основанный на стандартах ИСО серии 9000, указывает на необходимость внедрения систем менеджмента качества на перерабатывающих предприятиях. Согласно анализу баз данных научных публикаций Science Direct (by Scopus) и Web of Science установлено, что исследованию мяса убойных животных (кроме птицы) на наличие бактерий рода Campylobacter посвящено только 0,5-1,7 % публикаций. Приоритетным методом исследования является ПЦР. Разработана готовая к применению ПЦР тест-система для выявления Campylobacter spp. на основе подобраныхродоспецифичных праймеров к бактериям рода Campylobacter. Специфичность тест-системы установлена в отношении грамотрицательных бактерий родов Salmonella, Escherichia, Proteus, а также оксидазоположительных Aeromonas. Были подобраны родоспецифичные праймеры к бактериям рода Campylobacter и на их основе разработана готовая к применению ПЦР тест-система. Установлено, что подобранные праймеры имеют 100 % сходимость к геному бактерий рода Campylobacter, эффективность ПЦР составляет не менее 95 %, предел обнаружения не более 1 х 104 КОЕ/г. При оценке специфичности праймеров учитывалось, что бактерии рода Campylobacter могут находиться в консорциуме, обоснованным микробиомом желудочно-кишечного тракта, в основном с бактериями семейства Enterobacteriaceae и молочнокислыми бактериями. Однако среда обогащения Болтон является селективной и в процессе культивирования подавляет рост Грамположительных молочнокислых бактерий. Установлено, что подобранные праймеры обладают 100 % специфичностью и не дают ложноположитель-ных реакций с указанной группой микроорганизмов. Разработанная тест-система была успешно проверена в раунде сличительных испытаний в системе FEPAS и внедрена в лабораторную практику. Доказано что разработанную тест-систему можно использовать как при скрининге на этапах обогащения бактерий рода Campylobacter, так и при идентификации чистой культуры микроорганизма.
Original scientific paper
CONCEPTUAL APPROACHES TO THE RAPID DETECTION OF CAMPYLOBACTER SPP. IN MEAT OF SLAUGHTER ANIMALS
Dagmara S. Bataeva,* Mihail Yu. Minaev, Yuliya K. Yushina, Olga V. Sokolova, Elena V. Zajko
V.M. Gorbatov Federal Research Center for Food Systems of Russian Academy of Sciences, Moscow, Russia
Key words; of the genus Campylobacter, beef, poultry, PCR. Abstract
The modern approach to quality assurance of food products based on the ISO 9000 standards indicates the need for the implementation of quality management systems in processing plants. According to the analysis of scientific publication databases (Science Direct and Web of Science), it is established that only 0.5-1.7 % of publications are related to studying meat of slaughter animals (except for birds) concerning the presence of Campylobacter. The priority method of investigation is PCR. Ready-to-use PCR test system was developed for the detection of Campylobacter spp. on the basis of selected gene-specific primers to bacteria of Campylobacter genus. Specificity of the test system is established for Gram-negative bacteria of Salmonella, Escherichia, and Proteus genera, and for oxidase-positive Aeromonas. Gene-specific primers for Campylobacter were selected and ready-to-use PCR test system was developed on their basis. It was found that the selected primers have 100 % convergence to the genome of Campylobacter genus bacteria, the PCR efficiency is not less than 95 %, and the detection limit is not more than 1 х 104 CFU/g. When estimating the specificity of the primers, it was taken into account that the bacteria of Campylobacter genus may be incorporated in a consortium with intestine microbiome, mainly with Enterobacteriaceae and lactic acid bacteria. However, Bolton's enrichment medium is selective and, during the cultivation process, suppresses the growth of Gram-positive lactic acid bacteria. It was found that the selected primers were 100 % specific and did not give false positive reactions with this group of microorganisms. The developed test system was successfully validated in a cycle of qualitative tests in the FEPAS system and implemented into laboratory practice. It was proved that the developed test system may be used both in screening at the stages of Campylobacter enrichment and in identification of pure culture of the microorganism.
ДЛЯ ЦИТИРОВАНИЯ: Батаева Д.С., Минаев М.Ю., Юшина Ю.К., Соколова О.В., Зайко Е.В. Концептуальные подходы к экспресс-выявлению Сampylobacter spp. В мясе убойных животных. Теория и практика переработки мяса. 2017;2(4):76-95. DOI:10.21323/2414-438X-2017-2-4-76-95
FOR CITATION: Bataeva D.S., Minaev M.Yu., Yushina Yu.K., Sokolova O.V., Zajko E.V. Conceptual approaches to the rapid detection of Campylo-
bacter spp. in meat of slaughter animals. Theory and practice of meat processing. 2017;2(4):76-95. (In Russ.) DOI:10.21323/2414-438X-2017-2-4-76-95
Введение
Прогрессирующий мутагенез патогенных микроорганизмов пищевого происхождения представляет пандемическую опасность для современного мира. Проявляя стремительную изменчивость, как на генетическом, так и на фенотипическом уровне, патогены приобретают устойчивость к различным факторам воздействия, в т. ч. и окружающей среды. Это приводит к расширению ареала их распространения.
Ряд микроорганизмов в настоящее время являются наиболее опасными в связи с их широким распространением в природной среде, высокой выживаемостью и патогенностью. К таким микроорганизмам относят и бактерии семейства капнофильных эпсилон-протео-бактерий Campylobacterales, в частности бактерии рода Campylobacter и Helicobacter [1].
Кроме того, Всемирная Организация Здравоохранения выделяет среди патогенных микроорганизмов несколько наиболее опасных, с точки зрения возрастающей устойчивости, в число которых входят и бактерии рода Campylobacter [2].
В отчете ВОЗ «Глобальный взгляд на кампилобак-териоз» отмечено, что кампилобактериоз является недооцененным заболеванием. Частота инфицирования возбудителем этого заболевания населения стремительно растет. В отчете выделяют два вида, такие как C. jejuni и C. coli как наиболее опасные, несмотря на то что из 16 видов Campylobacter двенадцать считаются патогенными [3, 4].
Бактерии рода Campylobacter, во всем мире рассматриваются как наиболее распространённые пищевые патогены, вызывающие заболевание кампилобакте-риоз (вибриоз) со следующим патогенезом: кишечные инфекции, энтериты, бактериемию, колиты, септические артриты, гемоуремический синдром. В осложненных случаях может вызывать синдром Рейтера или Гийена-Барре. В отдельных случаях возможен летальный исход, в основном у групп населения, входящих в группу риска по причине ослабленного иммунитета. Согласно информационному бюллетеню ВОЗ, источником заражения соответственно и причинами га-строэнетритов обычно является мясо птицы, прошедшее недостаточную термообработку [5].
В 2007 году Международные Комиссии Codex Alimentarius Comission (CAC) и Codex Committee on Food Hygiene призвали к более тщательному изучению и контролю бактерий рода Salmonella и Campylobacter [6, 7].
Исследованиями 148 проб пищевых продуктов (листовые салаты, овощи, сырое молоко, мясо цыплят, куриные сырые субпродукты, индейка, перепела, говядина и смывы с различных поверхностей), проведенных в «ФИЦ питания и биотехнологии», установлена их контаминация и выявлено 50 штаммов бактерий рода Campylobacter, большая часть которых была представлена видом C. jejuni. Чаще всего в пище-
вые продукты кампилобактерии попадают в результате контаминации, в том числе с поверхности основного и вспомогательного оборудования. Campylobacter jejuni является наиболее патогенным представителем своего рода в связи широкой лекарственной устойчивостью к противомикробным препаратам, в т.ч. к хи-нолонам [8, 9].
Принимая во внимание, что птица (особенно перелетная) может быть переносчиком кампилобактерий, характер распространения этого патогена среди животных стремительный, и сложно контролируемый [4].
В связи с зоонозной природой патогена и широкой распространенностью, фактор риска заражения кампилобактериями сохраняется на любом предприятии, перерабатывающем мясо, особенно птицы. Также важно учитывать устойчивость этих бактерий к условиям окружающей среды. Кампилобактерии способны выживать в широком диапазоне температур от 4 до 43 °C. Из-за этой особенности их относят к термотолерантным микроорганизмам. Во влажных природных объектах (вода, навоз, почва, сено и проч.) при температуре 18-27 °C Campylobacter выживают более месяца; в продуктах животного происхождения при температуре 4 °C — 21 сутки, при 20 °C — не менее 12 недель. В инфицированных тканях кампилобактерии выживают до года. Однако, бактерии рода Campylobacter чувствительны к антибиотикам и дезинфицирующим средствам, а также к воздействию ультрафиолетовых лучей [10, 11].
По последним данным бактерии рода Campylo-bacter встречаются не только у птицы, но и почти всех теплокровных животных: крупный рогатый скот, свиньи, овцы, страусы, домашние животные (кошки, собаки). Путь передачи возбудителя кампилобактериоза чаще всего алиментарный. Дикие и перелетные птицы при испражнении кишечника инфицируют природные объекты. Заражение других животных происходит при поедании зараженной растительности. Среди домашнего скота достаточно широко распространен венерический путь передачи, со спермой зараженного самца. Локализуются кампилобактерии в основном в кишечнике, репродуктивных органах и в лимфатической системе [5, 12, 13, 14].
Учитывая патогенность кампилобактерий и характер заболевания людей в пищевой микробиологии используются различные подходы для обнаружения бактерий рода Campylobacter в объектах пищевой цепи человека и животных. Прежде всего, это классические методы микробиологической практики, которые описаны в ISO 10272-1:2006(en) Microbiology of food and animal feeding stuffs — Horizontal method for detection and enumeration of Campylobacter spp. — Part 1: Detection method, с учетом изменений внесенных в 2017 году. С момента публикации при определении кампилобактерий необходимо будет использовать ISO 10272-1:2017(en) Microbiology of the
food chain — Horizontal method for detection and enumeration of Campylobacter spp. — Part 1: Detection method [15]. Количественный и полуколичественный учет осуществляется по ISO 10272-2:2017 Microbiology of the food chain — Horizontal method for detection and enumeration of Campylobacter spp. — Part 2: Colony-count technique (Микробиология пищевой цепи — Горизонтальный метод обнаружения и подсчета Campylobacter spp. — Часть 2: Метод подсчета колоний), ISO/TS10272-3:2010 Microbiology of food and animal feeding stuffs — Horizontal method for detection and enumeration of Campylobacter spp. — Part 3: Semi-quantitative method (Микробиология пищевых продуктов и кормов для животных — Горизонтальный метод обнаружения и перечисления Campylobacter spp. — Часть 3: Полуколичественный метод). В России выявление и определение количества бактерий рода Campylobacter проводят в соответствии с тремя микробиологическими ГОСТами: ГОСТ ISO 10272-1-2013, ГОСТ ISO/TS10272-2-2013 и ГОСТ Р 55027-2012/ISO/TS10272-3:2010. Кроме классических методов, для обнаружения камбило-бактерий используют и альтернативные (быстрые) методы, например ПЦР-анализ в реальном времени и иммунохроматографические экспресс-тесты.
Анализ литературных источников показал, что научный интерес заостряется на определении и идентификации кампилобактерий в птице. В среднем на эти исследования приходится 98,3-99,5 % от общего числа исследований на кампилобактерии среди убойных животных. Причем более трети из них в последние годы проводились с применением ПЦР (Рис. 1). Исследований мяса убойных животных, за исключением птицы, на наличие кампилобактерий практически не проводились. Вероятнее всего на это повлиял низкий уровень выявляемости Campylobacter spp. в красном мясе, что может быть объяснимо разными подходами к отбору проб и пробоподготовки при исследовании мяса птицы и всех остальных убойных животных. Отбор проб и пробоподготовку мяса и мясной продукции проводят в соответствии с ISO 6887-2 из глубоких слоев и/или с поверхности. При этом отбор глубоких слоев осуществляют после обеззараживания поверхности объекта исследования. Все мясо убойных животных на патогенные микроорганизмы отбирается именно так. Как было сказано выше, бактерии рода Campylobacter не локализуются в мышечных тканях, а контаминируют ее при нутровке. В связи с этим отбор проб мяса должен осуществляться с не обеззараженной поверхности. Однако исследования мяса птицы в основном осуществлялся путем взятия смывов или ополаскиванием, что и способствовало высокой выявляемости искомого патогена.
Несмотря на очевидную необходимость ужесточения контроля Campylobacter spp. на предприятиях мясоперерабатывающей отрасли, диагностирование
кампилобактерий затруднительно. Это связано с их прихотливостью. Являясь капнофильными микроаэробными микроорганизмами, для роста и развития они требуют создания модифицированной газовой среды, с повышенным содержанием углекислого газа и сниженной концентрацией кислорода. Кроме этого, для наращивания биомассы необходимы специализированные питательные среды такие как, например, бульон Престона (Preston broth) или бульон Болтона (Bolton broth) на этапе предварительного обогащения и специализированные агаризованные среды (Мюлле-ра-Хинтона агар, Угольный агар), для выявления Cam-pylobacter fetus необходимы среды с использованием дебифринированной крови, такие как колумбийский агар с кровью. Это все делает анализ на выявление кампилобактерий материальнозатратным, длительным и сложным в исполнении.
dJBRARY
Рис. 1. Анализ публикационной активности по проблематике Campylobacter в международных базах цитирования за последние 10 лет
Наиболее перспективным методом для выявления кампилобактерий является ПЦР. В настоящее время при контроле бактерий рода Campylobacter методом ПЦР необходимо пользоваться методикой, описанной в МУК 4.2.2872-11. Преимущество методики заключается в отсутствии необходимости селекции и изоляции Campylobacter из пула микроорганизмов. Недостатком методики являлось отсутствие готовой к использованию тест-системы ПЦР для выявления Campylobacter.
Целью нашей работы являлась разработка полноценной ПЦР тест-системы для выявления бактерий рода Campylobacter в пищевой продукции.
Материалы и методы
Объектами исследования являлись тест-штаммы чистых культур патогенных микроорганизмов: Cam-pylobacter jejuni subspecies jejuni 70.2T; Salmonella enteri-
ca subsp. enterica serovar Typhimurium ATCC14028; Escherichia coli АТСС 25922; Proteus mirabilis ATCC35659; Aeromonas salmonicidaasl; образцы птицы («А», «В», «С») предположительно обсемененные бактериями рода Campylobacter; продукты амплификации штаммов; выделенные ДНК штаммов микроорганизмов.
При проведении исследования использовали микробиологический метод обнаружения бактерий рода Campylobacter согласно ИСО 10272:1. Первичное обогащение проводили в селективной жидкой среде Bolton broth (СМ 0983, OXOID) в две стадии. Первую стадию инкубирования проводили при температуре (37±2) °C в течение 4-6 ч, на второй стадии — при температуре (41,5±2) °C в течение (44±4) ч. После чего производили пересев на плотные селективные питательные среды (Preston agar и mCCD agar) и культивировали при температуре (41,5±2) °C в течение 44±4 ч в условиях модифицированной газовой атмосферы. Для создания модифицированной газовой атмосферы применяли коммерческие газогенераторы.
В результате культивирования получали изолированные колонии, которые идентифицировали с использованием коммерческих тест-систем api (Biomeri-uex, Франция).
Для проведения ПЦР, культуральную жидкость, полученную на этапе первичного обогащения использовали для получения биомассы клеток микроорганизмов и последующего выделения из нее ДНК. Для этого отбирали культуральную жидкость объемом 1,0 см3 в стерильные центрифужные пробирки и центрифугировали в течение 5 мин при 6,5 тыс. оборотах (Eppendorf). Полученный супернатант удаляли, получая концентрат биомассы. Принимая во внимание, что в концентрате могут находиться компоненты питательной среды, полученные образцы биомассы подвергали промывке. Для этого к декантанту добавляли стерильный физиологический раствор, суспендировали встряхиванием, после чего повторно центрифугировали при тех же режимах. Из полученного, после слива промывного физиологического раствора, концентрата выделяли ДНК.
Так же для проведения ПЦР проводили отбор типичных колоний с агаризованных селективных сред и готовили суспензию микроорганизмов с заданным титром в стерильном физиологическом растворе. Для определения титра микроорганизмов применяли ме-
тод сравнения со стандартом мутности № 1 McFarland (Biomeriuex, Франция), эквивалентным, 3 х 108 бактериальных клеток в 1 см3 суспензии. Полученную суспензию центрифугировали, получая концентрат биомассы микроорганизмов. Из полученного концентрата выделяли ДНК.
Согласно литературному поиску, бактерии рода Campylobacter способны взаимодействовать по принципу комменсализма или находится в консорциуме кишечного микробиома с другими патогенными микроорганизмами. В связи с этим при анализе генома Campylobacter проводили сравнение с бактериями родов Esherichia, Salmonella. Для проведения ПЦР в отношении этих микроорганизмов музейные культуры были рекультивированы на плотной питательной среде Trypton-soya agar (TSA), после чего создавали суспензию клеток с заданным титром в физиологическом растворе методом аналогичным тому, который использовали для получения суспензии клеток Campylobacter.
Для выделения ДНК подготавливали суспензию клеток объемом 50 мкл. Выделение ДНК проводили методом магнитных частиц на роботизированной станции MagNA Pure LC2.0 Instrument (Roche, Швейцария), используя набор для выделения ДНК MagNA Pure LC DNA Isolation Kit III (Roche, Швейцария).
Анализ генома и согласование дизайна комплиментарных праймеров к Campylobacter осуществляли с помощью программ Primer-BLAST (http://www.ncbi.nlm. nih.gov/tools/primer-blast/) и Oligo Analyzer 3.1 (http:// eu.idtdna.com/calc/analyzer).
Для получения фрагментов ДНК использованы универсальные праймеры (Табл. 1) и родоспецифич-ные праймеры (Табл. 2.) к гену 16S rDNA.
Выбранные родоспецифичные праймеры к гену 16S rDNA бактерий рода Campylobacter были использованы для проведения ПЦР в реальном времени. Условия и режимы проведения ПЦР реакции приведены в Табл. 3. Температуру плавления определяли in silico с применением интерактивной программы uMELTSM (https://dna.utah.edu/umelt/um.php).
Чистоту полученных ПЦР-продуктов (амплико-нов) проверяли методом электрофореза в 2 %-ном ага-розном геле с использованием TBE — буфера (Thermo Scientific, США). Для окрашивания ПЦР-продуктов использовали краситель SYBRGreen I (Силекс, Россия). Объем вносимого образца в каждую из трех лунок геля
Таблица 1. 16S rDNA праймеры, использованные для получения фрагментов ДНК бактерий рода Campylobacter
Forward primer TACGGGAGGCAGCAG Plus 15 2 16 54.37 66.67 3.00 2.00
Reverse primer CCGTCAATTCCTTTGAGTTT Minus 20 566 547 54.11 40.00 4.00 0.00
Product length 565
Таблица 2. Родоспецифичные праймеры к гену 16S rDNA бактерий рода Campylobacter, использованные для проведения ПЦР в реальном времени:
Forward primer GTTAAGTCCCGCAACGAGC Plus 19 463 481 59.21 57.89 4.00 2.00
Reverse primer GGCTGATCTACGATTACTAGCGA Minus 23 735 713 59.56 47.83 4.00 2.00
Product length
273
Вторую стадию колоночной очистки проводили с помощью набора MinElute Purification Kit (Qiagen, США) согласно протоколу. В колонку вносили 600 мкл образца, полученного после первичной очистки. Объем элюирующего буфера, вносимого на мембрану на второй стадии очистки, был увеличен, и составил 15 мкл.
Определение концентрации очищенных ПЦР-про-дуктов проводили фотометрическим методом с использованием фотометра Qubit 3.0 (Thermo Scientific, США) согласно протоколу к набору Qubit dsDNA HS Assay Kits (Thermo Scientific, США).
Результаты и обсуждение
Для генотипирования контрольного штамма Campylobacter jejuni subspecies jejuni 70.2T была выделена его ДНК и поставлена ПЦР с выбраными универсальными праймерами к гену 16S РНК прокариот. Сходимость выбранных форвард и реверс праймеров представлена на Рис. 2 и Рис. 3.
Из данных представленных на Рис. 2 и Рис. 3 видно, что форвард праймер обладает 100 % сходимостью с Campylobacter, а реверс праймер имеет сходимость на 95 %. В связи с тем, что реверс праймер не дает полную сходимость с Campylobacter был проанализирован системный мисматч участка несходимости. Результаты представлены на Рис. 4.
Расположение мисматча в 5'области праймера позволило использовать универсальные праймеры для получения продуктов амплификации для секвениро-вания.
В результате секвенирования, проведеного совместно с ЗАО «Евроген», очищенных фрагментов ДНК штамма Campylobacter jejuni subspecies jejuni 70.2T, была установлена его нуклеотидная последовательность
Sf{|iJCf№H producing jiyniflcirt'ilkinitiiiiKJ Seltci Ал StfKLnf №
Alififtwnli О
«а* tea» E <IM Ati»sti«i
Ci"i.Miaetrii.rt«ir*iMrs,„Rija7es юс.£и» анчп» зог *0T 10G% fliT 1(W%
I Cans ,к эайчг idiwu-vi г ■■ г;;iwwMSmi LMG 11761 ПК 1758?. iim?isH «нэп? 30.2 M7 101% i.sr 1004
Г ЫиаЛмшаг uuKwn о, i.ictairt CCUG S07M te™wa cmimi* зо i ВД? 10D% 1ST ни* CWISFSS:
¿iith^ja«f нажит Ev tculniuinifllia?-диВШ диияч ЭОЛ 10 7 1 Si 1D0% CP11SSH1
Г! i.ni strain FORi <№ c.-n; *is зог 112 101% 1ST 1ПЧ cjeaniHj
PI СШШ1Н1ИН»urn untoWill f^l™1 tt2 30.2 100% 0.5T matmi
j ' Сапи.Кый'г^ МШ siram lieii leSrtlKbij.TiUSimnfili mbHWHict Ml 30 2 100% l.ii 1МЧ Г*37ЖПЧ
Л Ciiratlabjaaf м vw iirsin 11АЫ1M (iMtwiufl RfU4hit окшяЛнйинкй JO? 302 101% 1ST 1004 ЯЗША1
i CstMr.lassutui mhi iliim 1tlMi одЩщщвд 302 uti 1<МЪ 1IKt% ItfSTiiTS 1
□ CunmliAa Jir i5 jni siraui J3IJS Ш г.эм am Л № W alirt. DvtiiKH«n 302 30.2 101% liT юн И&ЩгШ
П Ctmt^ofrrtf ши*»тие ^ yn. ip^'i FBriflvOfc ,ti5. «ПЯШ» if ЧП1 302 SOT iei% 1 ST 1M% CF-J^J'i.-
I ' taT-jjpi5saSirn.uratuSsp мш *irain FowtSoS ifij. tflmum» етганпв 30 2 sot 101% 1ST ioe% ОЧНСИМ
i Сатс,1Юэйрг i ni suast »«1 »»In at^jffM алтл ВПК1 "Г за г ilJ 101% ii? 100S емгшг t
i ; CmnloesairinrtfiliiinflClClse« еадкЬЙЯаИИ за tu 110% 0.51 100* СНИМИ 1
1 biraАЛаО* coll liiln ¡MffltfttinliKli «леи* 391 sot 101% AST ii»s CP519S77?
'^T'tttlflF ""ifcfJTHPH'H*- ifH«»*! ЯГИДИ^Дним» ДЦДЩ 302 in 101% fliT 1MK itffiKl
Рис. 2. Оценка специфичности форвард праймера для секвенирования
составлял 15 мкл. Для индукции излучения флуоресцирующего света из красителя использовали трансиллюминатор ЕТХ-Б26 (УПЬег Ьоигта^ Франция).
Таблица 3. Условия и режимы проведения ПЦР
Для первичной очистки фрагментов ДНК использовали набор Cleanup Standart (Евроген, Россия). Для этого на колонку наносили не более 200 мг агарозного геля и проводили очистку в соответствии с рекомендациями производителя согласно инструкции к набору с некоторыми изменениями. Для настоящего исследования было увеличено время центрифугирования на всех этапах с 30 с на 60 с; элюирующий раствор предварительно нагревали до 55 °C; после первичного добавления элюирующего буфера образцы выдерживали 5 мин. В результате получали три пробы равного объема, которые объединяли. Общий объем объединенной пробы составил 600 мкл.
SoquCiWi pradu^r^ ^niSunt а!|дп.тяп(1:
StlKl: АЛ Uiii SslMUd.D
¿1 Aligiimintl
ОеинрЬм Mi* SHU Tutil !«V II E value Willi Aitdirtit
1 CraMtaaiNinrtimfillHSUHitMuiaainiftatn* еиИншиа 4D1 tf.i 1DM 0 001 men l№371itf 1
1 "■ i■mcTitaliKlir 11НЖ11 rtuni lJiii-1 nLo и^лаЛ ■iO i 44 1 iCOii Л Ml FJFi7S572 1
UtHAffldCamailbanbrlli йэп! J liSFiLwc-ial RNi.atr,a папыmduv 4Л 1 W» ■0 001 Mm KCFjMBS 1
1 Jr ;i,ihiMij Ca>4D .in: Hh' е^ЬяС* DUGS fld 1Й ibauDH .can*. r.iHaiuiaitnct Mil 4Л.1 Mil D 0D1 1DCH EF531S3IM
сиииинш tkziBiBiN чштиишаиа 322 371 1 OOlf, в Я 1S% CFD17878 1
CinmlMiiMttMlrtiKivl»* МДМШЛПВПИ Я 2 3?? tpH OX m
Сinmtcaadsr ecu WA333. oorsilttt втаоп 322 302 wot ■3 И m WW31
Cmwtoaadircotl sir; riBPJtBl comrHU tiflo-is 122 319 100* a.* ж% CPliTiTi 1
■ 1 СаппЬВшМгшаййЮШанвМЬИпдПН 322 ill 11»* 0 я Si* CP0I7S65;
И Cvmfebadir tadii ваш Сй?70СоГВ. «те^Иа ИР1Й 322 34J юте fl J{ m СРВ10:DT 1
' y^nt'ifciiJdir «хт. »Vlin CJ677CK3B. аншгм 322 1Dt% в X »* очиняв 1
"hvib.woая»г tali tirw. OB11 »НИИ п«хиф| 312 31? l«% в if AS* cusisi^a.i
" Canloilouair larl №ЫЧ». ИМиШш 322 431 1004 tx wx CPM7TTJ 1
В СатиЧИatHf.au SM1t?4-ЛчеИИ ошлп 322 ?97 IDtK «X M* СР1Ю77Т7 1
Cvrmfг rjdjc'p* uett 1144 еыкша я я кц 322 459 10BS ox 96« CPMTT3S 1
' 1 CiMC.HSJt! ! LW3 ИШ. »mnlili MMfll 31.2 394 IMS в is m штпш
Cifli ,HSa<Jsr juij Jfitia.iul LUG 7ЧГ?, tiTl""!1 322 -Lfl-T IOOH OJC awm 1
I CIML- ,iioJC!-- ■ ;ujviiimiut LJJG i 137J. юл\гi?it а*ла:пе 312 ¿fii mt% 131 m еярттт? 1
Pi CsnwvtoiM!* M nit« «лAlUf UUG 1tTW. amtiKli ВИОЛ! 312 3?t ПК tat ОЧИТТИ.1
Рис. 3. Оценка специфичности реверс праймера для секвенирвания Campylobacter
СагпрцШЬа:!« col 5l-an BG2T(B, compJete genome tml in г «-CFfltHTH i и™1ь:1й5834 щцп^тгигмй-лпр;;!
МнИЦИЦШИИ« Mtti Я-,: . L
SiDPI (rpfLi l^rnklljn
зишш_im унят**,)
tHltf
Slunt US
Ouirv
1 рвншн I'. нищI ■
nil 111П -111 i =:
lllibii CCjTrTiTj iiTTToi^jTTT ll^iEJE
Рис. 4. Системный мисматч универсального реверс праймера
и подтверждена видовая принадлежность исследуемого штамма. Это позволило использовать его в качестве положительного контроля при разработке родоспеци-фичной к Campylobacter spp. ПЦР тест-системы.
При подборе родоспецифичных праймеров по базе данных NCBI была выбрана более консервативная последовательность 16S rDNA ITS, т.к. конститутивные гены Campylobacter (housekeeping genes) обладают высокой видовой специфичностью. Результаты изучения сходимости подобранных родоспецифичных форвард и реверс праймеров по отношению к различным видам бактерий рода Campylobacter представлены на Рис. 5 и Рис. 6.
Из представленных данных видно, что выбранные родоспецифичные праймеры обладают 100 % сходимостью с геномом бактерий рода Campylobacter.
Рис. 5. Сходимость родоспецифичного форвард праймера к геному бактерий рода Campylobacter
Рис. 6. Сходимость родоспецифичного реверс праймера к геному бактерий рода Campylobacter
Для расчета чувствительности и эффективности ПЦР реакции с родоспецифичными праймерами была проведена ПЦР с использованием ряда десятикратных разведений ДНК. Результаты чувствительности прай-меров представлены на Рис. 7.
Рис. 7. Результаты чувствительности родоспецифических прай-меров для Campylobacter
Проанализировав данные представленные на Рис. 7, пятое разведение ДНК было принято за низший предел обнаружения метода ПЦР, эквивалентной 1х104 бактериальных клеток в 1 см3 суспензии.
Полученные результаты ПЦР в реальном времени коррелируют с расчетными данными и подтверждают 100 %-ную специфичность подобранных праймеров к бактериям рода Campylobacter. Эффективность ПЦР составляет не менее 95 % (Рис. 8).
Рис. 8. Кривая расчетной эффективности ПЦР реакции
Для определения уникальности ПЦР реакции проведена серия сравнительных экспериментов с применением микроорганизмов, которые могут обнаруживаться в пробах наряду с Campylobacter (Рис. 9). Наиболее часто встречаются ассоциаты микробиома кампилобактерий с бактериями родов Salmonella и Es-herichia. В связи с этим представляло интерес провести ПЦР исследование с выбранными родоспеци-фичными праймерами в отношении бактерий родов Salmonella и Esherichia
Анализ данных, полученных в результате ПЦР (Рис. 9) показал, что выбранные праймеры дают положительную реакцию на бактерии родов Salmonella и Esherichia. Следовательно, специфичность реакции при использовании данных праймеров не подтвердилась.
Рис. 9. Результаты ПЦР исследования с применением универсальных родоспецифичных праймеров
Для подбора специфичных праймеров, участок 16S ДНК Campylobacter был выровнен на гомологичные участки 16S ДНК бактерий родов Salmonella, Esherichia и Aeromonas (Рис. 10).
В результате выравнивания было установлено, что реверс праймер имеет всего два мисматча в отношении гомологичных участков ДНК бактерий, расположенных в 5' области праймера. Данная последовательность не обладает должной специфичностью, в связи с чем, при её использовании тест-система будет давать ложноположительной реакции.
Во избежание получения ложноположительной реакции, было принято решение сдвинуть область комплементарного связывания праймера по 3' области с позиции 1338 на 16 базовых пар нуклеотидов в позицию 1322 (Рис. 11).
Из представленных данных видно, что новый реверс праймер имеет 3 мисматча в отношении гомологичных участков ДНК бактерий Salmonella, Escherichia и Aeromonas, расположенных в 3' области праймера, отвечающей за специфичный отжиг.
Для подтверждения специфичности ПЦР реакции с новыми подобранными праймерами после выравнивания гомологичных участков ДНК была проведена постановка ПЦР с бактериями родов Salmonella, Escherichia и Campylobacter (Рис. 12).
Отмечено, что новые подобранные праймеры обладают специфичностью по отношению к бактериям рода Salmonella и Escherichia. Полученные результаты апмлификации позволяют утверждать, что использование новых подобранных праймеров исключает ошибку диагностики при дифференциации рода Cam-pylobacter от бактерий родов Salmonella и Escherichia.
Принимая во внимание, что Campylobacter может встречаться в смешанной культуре с бактериями родов Proteus и Aeromonas, была проведена сравнительная межродовая диагностика путем постановки ПЦР с выбранными праймерами (Рис. 13).
rfiTSMitaitip ........- gi;
Рис. 10. Выравнивание гомологичных участков ДНК бактерий родов Salmonella, Escherichia, Aeromonas и Campylobacter содержащих участок отжига универсального реверс праймера
Е**72Ш£атр.....0*-з
Рис. 11. Выравнивание гомологичных участков ДНК бактерий родов Salmonella, Escherichia, Aeromonas и Campylobacter содержащих участок отжига реверс праймера
Рис. 12. Результаты амплификации Campylobacter jejuni, Salmonella и Escherichia coli
Рис. 13. Результаты амплификации Campylobacter jejuni, Aeromonas salmonicida и Proteus mirabilis
Данные представленные на рисунке, доказывают, что выбранные праймеры обладают высокой специфичностью в отношении бактерий рода Aeromonas и Proteus.
Для оценки диагностических возможностей разработанной ПЦР тест-системы была проведена серия сличительных испытаний с традиционным микробиологическим методом выявления бактерий рода Cam-pylobacter.
Как видно из данных ПЦР исследования, представленных на Рис. 14, только проба «В» дала положительную реакцию амплификации, что свидетельствует о наличии в ней бактерий рода Campylobacter. Пробы «А» и «С» дали отрицательную реакцию при проведении ПЦР, что подтверждает отсутствие Campylobacter spp.
Параллельно с ПЦР-анализом было проведено исследование проб «А», «В» и «С» культуральным мето-
Рис. 14. Кривые амплификации Campylobacter jejuni (положительный контроль) и зашифрованных образцов «А», «В» и «С»
дом. В результате культивирования этих проб и последующей биохимической идентификации, бактерии рода Campylobacter были обнаружены только в пробе «В».
Результаты, полученные при проведении сличительных испытаний разными методами, показали полную сходимость культурального и ПЦР метода, что позволяет использовать разработанную ПЦР тест-систему в лабораторной практике.
Выводы
В результате проведенных исследований были отработаны подходы к выбору генов-мишеней, обладающих разрешающей способность в пределах рода Campylobacter. Были изучены характеристики
Introduction
Progressing mutagenesis in pathogenic microorganisms of food origin is of serious pandemic hazard to modern world. Showing rapid variability, both at the genetic and phenotypic levels, pathogens become resistant to various factors including environmental ones. This leads to expansion of their distribution area.
A number of microorganisms are currently the most dangerous ones due to their wide distribution in nature, high survival and pathogenicity. Such microorganisms include the family of capnophilic epsilon-proteobacteria, Campylobacterales, in particular bacteria of Campylobacter and Helicobacter genera [1].
In addition, the World Health Organization identifies several most dangerous pathogenic microorganisms in terms of increasing resistance including bacteria of Campylobacter genus [2].
праймеров для определения кампилобактерий, в результате чего были подобраны родоспецифичные праймеры к бактериям рода Campylobacter на основе которых была разработана готовая к применению ПЦР тест-система для выявления Campylobacter spp. Была проведена оценка специфичности, точности и эффективности проводимой ПЦР. Разработанная тест-система была верифицирована в раунде международных сличительных испытаний FEPAS. Установлено, что данная тест-система может быть использована для экспресс диагностики бактерий рода Campylobacter в мясе убойных животных. Полученные результаты подтверждены микробиологическим референс-методом.
The WHO report «Global Look at Campylobacterio-sis» noted that campylobacteriosis is an underestimated disease. The frequency of infection with pathogenic agent of this disease is growing rapidly in the population. The report identifies two species, C. jejuni and C. coli, as the most dangerous ones, despite the fact that twelve out of 16 Campylobacter species are considered pathogenic [3, 4].
Bacteria of Campylobacter genus are regarded worldwide as the most common food pathogens that cause cam-pylobacteriosis (vibriosis) with the following pathogenesis: intestinal infections, enteritis, bacteremia, colitis, septic arthritis, hemolytic-uremic syndrome. In complicated cases, they may cause Reiter's syndrome or Guillain-Barre syndrome. In some cases, a lethal outcome is possible, mainly in the populations at risk because of weakened immunity. According to the WHO newsletter, usually the source of
infection and the cause of gastroenteritis is poultry meat that has undergone insufficient heat treatment [5].
In 2007, international Codex Alimentarius Commission (CAC) u Codex Committee on Food Hygiene stated the need for more careful study and control of Salmonella and Campylobacter genera bacteria [6, 7].
Studies of 148 food samples (lettuce, vegetables, raw milk, chicken meat, chicken raw by-products, turkey, quail, beef and washouts from various surfaces) carried out by «FIC of nutrition and biotechnology» detected their contamination and identified 50 strains of Campylobacter genus bacteria, most of which were represented by C. jejuni species. Most often, campylobacteria present in food due to contamination including contamination from the surface of the main and additional equipment. Campylobacter jejuni is the most pathogenic representative of the genus because of wide-range drug resistance to antimicrobial drugs including quinolones [8, 9].
Taking into account that birds (especially migratory birds) may be the carriers of campylobacteria, the dissemination of this pathogen among animals is rapid and difficult to control [4].
In connection with the zoonotic nature of the pathogen and widespread prevalence, the risk factor for campylobacte-ria infection persists at any meat processing plant, especially at poultry processing plants. It is also important to consider the resistance of these bacteria to environmental conditions. Campylobacteria can survive in a wide temperature range of 4 to 43 °C. Because of this property, they are referred to as ther-motolerant microorganisms. In wet natural objects (water, manure, soil, hay, etc.) at a temperature of 18-27 °C, Campylobacter survive for more than a month. In products of animal origin at a temperature of 4 °C, Campylobacter survive for 21 days, and at 20 °C for at least 12 weeks. In infected tissues, campylobacteria survive up to a year. However, the bacteria of Campylobacter genus are susceptible to antibiotics and disinfectants, as well as to exposure to ultraviolet rays [10, 11].
According to the latest information, bacteria of Cam-pylobacter genus are found not only in birds, but also in almost all warm-blooded animals: cattle, pigs, sheep, ostriches, domestic animals (cats, dogs). The path of transmission of campylobacteriosis causing pathogen is most often alimentary. Wild and migratory birds infect natural objects during defecation. Infection of other animals occurs when eating contaminated vegetation. Among livestock, the venereal transmission with the sperm of infected male is fairly widespread. Campylobacteria are distributed mainly in the intestines, reproductive organs and in lymphatic system [5, 12, 13, 14].
Considering the pathogenicity of campylobacteria and the nature of human disease, food microbiology uses different approaches to detect bacteria of Campylobacter genus in food and animal feed chain objects. First of all, these are the classical methods of microbiological practice, which are described in ISO 10272-1:2006 (en) Microbiology of food and animal feeding stuffs — Horizontal method for
detection and enumeration of Campylobacter spp. — Part 1: Detection method, with changes made in 2017. Soon, when determining campylobacteria, it will be necessary to use ISO 10272-1:2017 (en) Microbiology of the food chain — Horizontal method for detection and enumeration of Campylobacter spp. — Part 1: Detection method [15], when it will be published. Quantitative and semi-quantitative determination is carried out according to ISO 10272-2:2017 Microbiology of the food chain — Horizontal method for detection and enumeration of Campylobacter spp. — Part 2: Colony-count technique, ISO/TS10272-3:2010 Microbiology of food and animal feeding stuffs — Horizontal method for detection and enumeration of Campylobacter spp. — Part 3: Semi-quantitative method. In Russia, the detection and quantification of Campylobacter genus bacteria is carried out in accordance with three microbiological GOSTs: GOST ISO 10272-1-2013, GOST ISO/TS10272-2-2013 and GOST R55027-2012/ISO/TS10272-3:2010. In addition to traditional methods of campylobacteria detection, alternative (rapid) methods are used, for example real-time PCR analysis and immunochromatographic rapid tests.
Literature analysis showed that scientific interest was focused on determination and identification of campylo-bacteria in poultry. On average, these studies account for 98.3-99.5 % of the total number of studies on campylo-bacteria among slaughter animals. And more than a third of them, in recent years, have been carried out using PCR (Figure 1). Studies of slaughter animal meat concerning the presence of campylobacteria almost were not carried out (with the exception of poultry). Most likely this was due to the low detection rate of Campylobacter spp. in red meat, which can be explained by different approaches to sampling and sample preparation in the studies of poultry and all other slaughter animals. Sampling and sample preparation of meat and meat products are carried out in accordance with ISO 6887-2 from deep layers and/or from surface. In this case, the collection of deep layers is carried
WoS
3/ Science Direct
«LIBRARY
Figure 1. Analysis of publications concerning the problems of Campylobacter in international citation databases for the last 10 years
out after disinfection of the surface of investigation object. All the meat of slaughter animals intended for pathogenic microorganism testing is collected this way. As it was indicated above, the bacteria of Campylobacter genus are not distributed in the muscle tissues, and contaminate it during evisceration. Thus, meat sampling should be carried out from non-disinfected surface. However, poultry meat studies were mainly carried out using washouts, which contributed to the high detection of the target pathogen.
Despite the obvious need for stricter control of Campylobacter spp. at the enterprises in meat-processing industry, the determination of campylobacteria is difficult. This is due to their fastidious nature. They are capnophilic micro-aerobic microorganisms; for growth and development they require the creation of modified atmosphere with a high content of carbon dioxide and a reduced concentration of oxygen. In addition, specialized nutrient media, such as Preston broth or Bolton broth, in the pre-enrichment stage, and specialized agar medium (Mueller-Hinton agar, Coal agar) are needed for biomass gain. To identify Campylobacter fetus, media with de-buffered blood are needed, such as Colombian blood agar. It makes the identification of campylobacteria material-consuming, time-consuming and difficult to perform.
The most promising method for identifying campylo-bacteria is PCR. Currently, when controlling bacteria of Campylobacter genus by PCR, it is necessary to use the technique described in MUK 4.2.2872-11. The advantage of the technique is the absence of the need for selection and isolation of Campylobacter from a pool of microorganisms. The disadvantage of the technique is a lack of ready-to-use PCR test system for Campylobacter detection.
The purpose of this work was to develop a complete PCR test system for the detection of Campylobacter genus bacteria in food products.
Materials and methods
The study objects were pure culture strains of pathogenic microorganisms: Campylobacter jejuni subspecies jejuni 70.2T; Salmonella enterica subsp. enterica serovar Typhimurium ATCC14028; Escherichia coli АТСС 25922; Proteus mirabilis ATCC35659; Aeromonas salmonicida; poultry samples («A», «B», «C») presumably contaminated with bacteria of Campylobacter genus; products of strain amplification; isolated DNA of microbial strains.
The study used a microbiological method for the detection of Campylobacter genus bacteria according to ISO 10272:1. Primary enrichment was carried out in a selective liquid medium, Bolton broth (CM 0983, OXOID), in two stages. The first stage of incubation was carried out at a temperature of (37 ± 2) °C for 4-6 hours and the second stage at a temperature of (41.5 ± 2) °C during (44 ± 4) h. After that, inoculation into selective culture media (Preston agar and mCCD agar) and incubation at a temperature of (41.5 ± 2) °C for 44 ± 4 h were carried out under the modified atmosphere conditions. To create modified atmosphere, commercial gas generators were used.
As a result of incubation, isolated colonies were obtained, which were identified using api commercial test systems (Biomeriuex, France).
For PCR, the culture fluid obtained in the primary enrichment step was used to obtain biomass of the microorganism cells and subsequent isolation of DNA. For this, a 1.0 cm3 of culture liquid was transferred into sterile centrifuge tubes and centrifuged for 5 minutes at 6,500 rpm (Eppendorf). The resulting supernatant was removed to obtain biomass concentrate. Taking into account that the components of the nutrient medium may be present in the concentrate, the obtained biomass samples were subjected to washing. Therefore, a sterile saline solution was added to the decantate, suspended by shaking, and then re-centrifuged under the same conditions. DNA was isolated from the obtained concentrate after draining the washing saline solution.
For PCR, typical colonies were also selected from selective agar media and a suspension of microorganisms with a given titer in a sterile saline solution were prepared. To determine the titer of microorganisms, the method of comparison with McFarland turbidity standard No. 1 (Biomeriuex, France, equivalent to 3x108 bacterial cells per 1 cm3 of suspension) was used. The resulting suspension was centrifuged to obtain biomass concentrate. DNA was isolated from the resulting concentrate.
According to a literature search, the bacteria of Cam-pylobacter genus are able to interact in accordance with commensalism principle or are in consortium of intestinal microbiome with other pathogenic microorganisms. In this connection, during the analysis of Campylobacter genome, a comparison was made with the bacteria of Esch-erichia and Salmonella genera. To carry out PCR for these microorganisms, the museum cultures were re-cultured on a solid nutrient medium, Trypton-soya agar (TSA), and cell suspension with a given titer in saline solution was prepared be the method similar to that used to prepare a suspension of Campylobacter cells.
For DNA isolation, 50 ^l of cell suspension was prepared. DNA extraction was performed by magnetic particles method on MagNA Pure LC2.0 Instrument (Roche, Switzerland) using MagNA Pure LC DNA Isolation Kit III (Roche, Switzerland).
Genome analysis and matching of the design of complimentary primers to Campylobacter were performed using Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/) and Oligo Analyzer 3.1 (http://eu.idtdna. com/calc/analyzer) software.
To obtain DNA fragments, universal primers (Table 1) and gene-specific primers (Table 2) to 16S rDNA gene were used.
Selected gene-specific primers to the 16S rDNA gene of Campylobacter genus bacteria were used for real-time PCR. The conditions and modes of PCR reaction are given in Table 3. The melting point was determined in silico using interactive program uMELTSM (https://dna.utah.edu/ umelt/um.php).
Table 1. 16S rDNA primers used to obtain DNA fragments of Campylobacter genus bacteria
Forward primer TACGGGAGGCAGCAG Plus 15 2 16 54.37 66.67 3.00 2.00
Reverse primer CCGTCAATTCCTTTGAGTTT Minus 20 566 547 54.11 40.00 4.00 0.00
Product length 565
Table 2. Gene-specific primers to 16S rDNA gene of Campylobacter ^enus bacteria used for real-time PCR:
Forward primer GTTAAGTCCCGCAACGAGC Plus 19 463 481 59.21 57.89 4.00 2.00
Reverse primer GGCTGATCTACGATTACTAGCGA Minus 23 735 713 59.56 47.83 4.00 2.00
Product length
The purity of the obtained PCR products (amplicons) was checked by electrophoresis in a 2 % agarose gel using TBE buffer (Thermo Scientific, USA). To stain the PCR products, SYBRGreen I stain (Sileks, Russia) was used. The volume of the sample added to each of the three gel wells was 15 ^l. For the induction of fluorescent light from the stain, ETX-F26 transilluminator (Vilber Lourmat, France) was used.
For the primary purification of DNA fragments, Cleanup Standard kit (Eurogen, Russia) was used. For this, 200 mg or less of agarose gel was applied to the column and purification was carried out according to the manufacturer's recommendations and kit instructions, with some modifications. In this study, the centrifugation time was increased at all stages from 30 to 60 seconds; the eluting solution was preheated to 55 °C; after the initial addition of the elution buffer, the samples were aged for 5 minutes. As a result, three samples of equal volume were obtained, which were pooled. The total volume of the pooled sample was 600 ^l.
The second stage of column purification was carried out using MinElute Purification Kit (Qiagen, USA) according to the protocol. 600 ^l of the sample obtained after the initial purification was added to the column. The volume of the eluting buffer added to the membrane in the second purification step was increased to 15 ^l.
The concentration of purified PCR products was determined by photometric method using Qubit 3.0 photometer (Thermo Scientific, USA) according to the Qubit dsDNA HS Assay Kits protocol (Thermo Scientific, USA).
Results and discussion
To genotype the control strain, Campylobacter jejuni subspecies jejuni 70.2T, its DNA was isolated and PCR reaction was carried out with the selected universal primers to 16S prokaryotic RNA gene. The convergence of the selected forward and reverse primers is shown in Figure 2 and Figure 3.
Data presented in Figure 2 and Figure 3 indicate that the forward primer is 100 % convergent with Campylobacter, and the reverse primer has a convergence of 95 %. Due to the fact that the reverse primer is not fully convergent with Campylobacter, a systemic mismatch of the divergence site was analyzed. The results are shown in Figure 4.
The location of the mismatch in the 5' region of primer allowed the use of universal primers to obtain amplification products for sequencing.
273
Table 3. Conditions and modes of PCR reaction
When PCR fragments are generated for further sequencing:
Composition of the reaction mixture: PCR conditions
Q5 PCR buffer x 2.0 12,5 ^l 98 120
Water 7 ^l Denaturation
Prmix 3 ^l 54 30
DNA 2 ^l 72 20
Eva-green stain 0,5 ^l 98 15
30 cycles
When performing real-time PCR:
Composition of the reaction mixture:
PC x 2.5 Water Prmix DNA Eva-green stain Taq-polymerase
10 ^l 15 ^l 3 ^l 2 ^l 0,4 ^l 0,4 ^l
PCR conditions 95 400
60 40
95 15
40 cycles
As a result of sequencing carried out together with ZAO «Eurogen» of purified DNA fragments of Campylobacter jejuni subspecies jejuni 70.2T strain, its nucleotide sequence was established and the species specificity of the strain under investigation was confirmed. This allowed to use the strain as a positive control in the development of gene-specific Campylobacter spp. PCR test system.
When selecting gene-specific primers in NCBI database, a more conservative 16S rDNA ITS sequence was selected, because the constitutive genes of Campylobacter (housekeeping genes) possess high species specificity. The results of the convergence study of the selected gene-specific forward and reverse primers to various species of Campylobacter genus bacteria are presented in Figure 5 and Figure 6.
From the data presented, it is clear that the selected gene-specific primers are 100 % convergent with the genome of Campylobacter genus bacteria.
To calculate the sensitivity and efficiency of PCR reaction with the gene-specific primers, PCR was performed using a series of ten-fold dilutions of DNA. The results of the primer sensitivity are presented in Figure 7.
Based on the analysis of the data presented in Figure 7, the fifth DNA dilution was taken as the lower limit of detection for PCR method, equivalent to 1x104 bacterial cells in 1 cm3 of suspension.
The results obtained in real-time PCR correlate with the calculated data and confirm the 100 % specificity of the selected primers for Campylobacter genus bacteria. The efficiency of PCR is not less than 95 % (Figure 8).
SC(|lJtnCfll pTOduCifiQ Sj^nMunt ^ÜCjrilTl'E-l'ltS. Sflttl id: büüü SifKLUf 0
ü Alljlftwnli 0
Qffcn^ici Mb «а* аса» Оииу E .ULM kbm
ü"i.i«aetriim«ir*iMra,„Rija7es юпсиг* дампа зог «ОТ 10С% fliT 1И% сйтфМ
; йкппш* iairtMim ff: aajauwMSmi LMG 11714 ttr-ifcJJIG 175Я_ еипЛШ «лот» 30.? И7 1t»% Ш 1004 Шйжу
Г СилаЛмапег миип^п к laaafe ÖtaJO S07M te™wa cmimi* зоз ВД7 10D% tu IM*
Ciim^pidif iauiuira &f ICMÜIMTI ямJJJ7_ ЕСЧС^Ч «««nil 10 7 1ST SKI* CP11SSH1
Г! Г^р- г- .iiiartpr i« . ,ai slraia FOftC fijf sa -лг * is «pst* 30? 11? 1MW 0.57 1004 CPS1723i1
Fl £)in(UBS(SiГ Ii um amln IIKÖlfSi^stmil RKUpMf .fartH в^омлса 30.2 100% 1.57 106* mann
i ' Cinu.KMdpr^MnisiTiin 11И7 ISS(1lKb0.Ti»iRH4nfni cainaiseairtnip 30? 30? 100% 0.H 1004
Л CsmunlaSiaar и um йгКп Ч1АЫ1M Шиит RfU Am емНааЫн! 30? 30? 101% 0J7 1004 ЯЗША1
i " dmöilflejdar 11Ш Ifta лЬмотйй ПШлн! Elnlil' ^tiVill'i зог uti 1404 ft (7 um* ltf37!ST3 1
СагииНйатг is-.ni alraui J377S 113 r.aoj am л Ю1Л лиг ■шийлниапса 303 30? 100% 0i7 юн 1^26221
П CW44M>td(ri*Ufltim>9e iimiaiMi№FD«fflJOS № anol<i* 0И1ИП1 30? 307 100% ft 57 1M% iPSÜJ'i.-
; ' tiTjjri5aadern.uiutuSsp Mni *irain FowtSoS ifij. tfliram» яганла 30? 30 7 10i% 0 57 100% CPtSiOTBI
L. tiTc.inJaUpr;"iini5uasb »«1 at»ln at^jffäi олшл ИЛ1 "Г 30? tu 100% OiJ 100% СИН045 t
И СжтШвыааг i(4M*lMinf<C1C13H2 ечжЬЙЯВЯН aoj 1011% ft.5! [DO* СНИМИ1
Г öiraАЛасИг U» аипинайиал!«!? атяШШИШ! 30 2 50 7 1WJ% 0S7 100* CP5l9S77t
=ama^aBaaprc,nii,ciaiaiiini3uasoc.nn,fnj^iuin«j,iisi^7iSZM™e!«-aana'Ti( 30 2 111 101% 157 1«* ощиш
Figure 2. Estimation of the specificity of the forward primer for Campylobacter sequencing
SoquiMii« pradu^r^ ignifiortt a!ign.Tionfv
Selad. £fi IJflflt SsHeitd о ii AJiy'iniHrtb
Daaeiipben
... С jjn rife a atl w. и мШЧК иМиипДЯШ дям.ыДа! Агадр-а п ДжпрЛайзсПгтт, ДаиМЗИД 1« пЕомцда! ЙЫЛ fljnp_jart'al 1ВВЦЕЛСД ID UwiiHiiMdCJr-.ibliibTilfSE йэа< i IgSniMMi-ialHNa.aJn': pnntfjinmn; E Uivmtiir?!; С a"ia .штлМ' w; п-ir? О ГДЕ - sr-s -iffl paastTut к m .-?n« с - im aar г *
Gamp>1abatSw call sfran compietegenome
fammm im £POi?97S u™m:l695S34 uumirr ui HUrimJ II
Itmn ltlllimullHMIi««»m TlMXilA
a?.; t>(tt [i«} 14/50(95*)_creo(o%) piu^WL«
ijjtrv 1 CCOTCUJTOCI. I Afl. *
stjtL iiiisif nraiirrmnTTTfiasTTr n^is:;
Figure 4. System mismatch of the universal reverse primer
To determine unique character of PCR reaction, a series of comparative experiments was performed using microorganisms that may be detected in samples along with
o
Hau Stfll» Tatil !«V ff e valija Harn Atttfirtit
Jl>1 411 1DO* 0 001 MC% HFi7!S7i t
■iO 1 40 1 im* 0 001 100-ii FJFi7S57J 1
401 40 1 W» 0011 10№ KCFj«Bi 1
401 40.1 im* 0M1 100% EF531S3IM
333 371 100* 03( 1S% СРВ 171878 1
333 33« im* 131 m CP01T8T?1
3?3 302 100% 030 5i% CPtfWJl
373 319 100* O.Ji CP8I7187I 1
333 371 loo* o» OS* СР0178ВЯ
333 344 юте 0 J{ »% CPB10:B7 1
3?3 344 100% OiS 55% cpma^ 1
312 372 ion 0.21 54%
3?3 432 100% 030 5i% CPM7778 1
3?3 237 UM 0.30 94% CP (№7777 1
312 450 11104 0.25 54% CPM77JS 1
31.2 390 j»% 0 Л 54% аййши
312 492 100% 030 54% CPP0777J, 1
312 IOOK 031 54% OFiJrJi.^
312 370 0.21 54% CS4»7m.l
Campylobacter (Figure 9). The most common are the associates of campylobacteria microbiome with the bacteria of Salmonella and Escherichia genera. In this connection, it was interesting to conduct a PCR study with the selected gene-specific primers for Salmonella and Escherichia.
The analysis of the data obtained from PCR reaction (Figure 9) showed that the selected primers give a positive reaction to the bacteria of Salmonella and Escherichia genera. Therefore, the specificity of the reaction when using these primers was not confirmed.
CMicttoaadcrcpli игншс
U Cjinpvl'oiacltrjcmblfjn JV1Z74-ooripim unarm
:... ^"ipyicaaclprciHi Ыгапулззз. итсЦЦ otniynj
С SJif .Trader con ire n gFM В?. <Ж1Г№
С Сдчгс-.'эв.МисвП iiftniTiLiai. g^.MHi
_ сдчг,Lcaлиг!" ■ .11 яч1я Ы57ТСКЭВ. к": nar:ai-4.
С Самс.изадргспИыгалОЩ: cotwip палата
С Сд'лс.топэаег lan кш jru. cstic№ а«пэ1Г:р
□ g*ic .Гиларг Ufi R'JUTfl f. {0ИСЮ? ддпсп-.f
Li CiMf .tertr I it. мета ПШ5. itntfy ? саг-:-у П s li.W 34379. gar-ialala twtwi
□ CiaitJcaanEMvi^u™ «rntmm L4G 11ТД& c-malpla №.ин;
Figure 3. Estimation of the specificity of the reverse primer for Campylobacter sequencing
Figure 5. Convergence of the gene-specific forward primer to the genome of Campylobacter genus bacteria
Figure 6. Convergence of the gene-specific reverse primer to the genome of Campylobacter genus bacteria
m
f
f l
f
/
"T /
Figure 7. Sensitivity results of the gene-specific primers for Campy-lobacter
Figure 8. The curve of the calculated efficiency of PCR reaction
For the selection of specific primers, Campylobacter 16S DNA regions was aligned with homologous regions of 16S DNA from the bacteria of Salmonella, Escherichia and Aeromonas genera (Figure 10).
As a result of the alignment, it was found that the reverse primer has only two mismatches for homologous regions of bacterial DNA located in the 5' region of the primer. This sequence does not have proper specificity, so when it is used, the test system will give a false positive reaction.
Figure 9. Results of PCR study using the universal gene-specific primers
To avoid false positive reactions, it was decided to move the complementary primer-binding region of the 3' region by 16 base pairs of nucleotides from the position 1338 to the position 1322 (Figure 11).
From the data presented, it is clear that the new reverse primer has 3 mismatches for homologous DNA regions of Salmonella, Escherichia and Aeromonas bacteria located in the 3' primer region responsible for the specific annealing.
To confirm the specificity of PCR reaction with the new selected primers, after homologous DNA regions were aligned, PCR reaction was performed with the bacteria of Salmonella, Escherichia and Campylobacter genera (Figure 12).
It is noted that the new selected primers are specific for the bacteria of Salmonella and Escherichia genera. The obtained results of the amplification allow to state that the use of the new selected primers excludes a diagnostic
rfHTJSJlitJiiKf
Figure 10. Alignment of homologous DNA regions from the bacteria of Salmonella, Escherichia, Aeromonas and Campylobacter genera containing the universal reverse primer annealing site
Figure 11. Alignment of homologous DNA regions from the bacteria of Salmonella, Escherichia, Aeromonas and Campylobacter genera containing the reverse primer annealing site
Figure 12. Amplification results for Campylobacter jejuni, Salmonella and Escherichia coli
Figure 13. Amplification results for Campylobacter jejuni, Aeromonas salmonicida and Proteus mirabilis
error in the differentiation of Campylobacter genus from the bacteria of Salmonella and Escherichia genera.
Taking into account that Campylobacter may occur in a mixed culture with Proteus and Aeromonas genera, a comparative intergeneric diagnosis was carried out by performing PCR with the selected primers (Figure 13).
The data presented in the figure prove that the selected primers have high specificity for the bacteria of Aeromonas and Proteus genera.
To evaluate the diagnostic capabilities of the developed PCR test system, a series of comparative test with a traditional microbiological method for Campylobacter genus bacteria detection were carried out.
As it is seen from the PCR study data presented in Figure 14, only sample «B» gave a positive amplification reaction, which indicates the presence of Campylobacter genus bacteria. Samples «A» and «C» gave a negative reaction during PCR, which confirms the absence of Campylobacter spp.
Figure 14. Amplification curves for Campylobacter jejuni (positive control) and coded samples «A», «B», and «C»
In parallel with PCR analysis, samples «A», «B», and «C» were analyzed by the cultural method. As a result of incubation of these samples and subsequent biochemical identification, bacteria of Campylobacter genus were detected only in sample «B».
The results obtained during the comparative tests by different methods showed the complete convergence of the cultural method and PCR, which makes it possible to use the developed PCR test system in laboratory practice.
Conclusions
As a result of the conducted studies, approaches to the selection of target genes within the Campylobacter genus were developed. The characteristics of primers for the determination of campylobacteria were studied, which resulted in the selection of gene-specific primers to bacteria of Campylobacter genus, on the basis of which a ready-to-use PCR test system for the detection of Campylobacter spp. was developed. An assessment of PCR specificity, accuracy and effectiveness was made. The developed test-system was verified in a cycle of FEPAS international comparative tests. It is established that this test system may be used for the rapid detection of Campylobacter genus bacteria in meat of slaughter animals. The results obtained are confirmed by microbiological reference method.
БИБЛИОГРАФИЧЕСКИЙ СПИСОК
1. Campbell, B.J., Engel, A.S., Porter, M.L., Takai, K. (2006). The versatile e-proteobacteria: Key players in sulphidic habitats. Nature Reviews Microbiology, 4(6), 458-468.
2. ВОЗ публикует список бактерий, для борьбы с которыми срочно требуется создание новых антибиотиков. Центр СМИ ВОЗ. [Интернет ресурс: http://www.who.int/mediacentre/ news/releases/2017/bacteria-antibiotics-needed/ru/ Дата обращения 29.10.2017].
3. The global view of Campylobacteriosis. Report of an expert consultation, (2012). Utrecht, Netherlands 9-11 July. — 136 р.
4. Altekruse, S.F., Stern, N.J., Fields, P.I., Swerdlow, D.L. (1999). Campylobacter jejuni — an emerging foodborne pathogen. Emerging Infectious Disease, 5(1), 28-35.
5. Кампилобактериоз. Информационный бюллетень ВОЗ. [Интернет ресурс: http://www.who.int/mediacentre/fact-sheets/fs255/ru/. Дата обращения 29.10.2017].
6. Microbiological Risk Assessment Series. Salmonella and Campylobacter in chicken meat. (2009). Meeting report FAO and WHO.
7. Codex Alimentarius CAC/GL 78-2011, (2011) Guidelines for the Control of Campylobacter and Salmonella in Chicken Meat.
8. Ефимочкина, H.P., Быкова, И.Б., Стеценко, В.В., Минаева, Л.П., Пичугина, Т.В., Маркова, Ю.М., Короткевич, Ю.В., Козак, С.С., Шевелева, С.А. (2016). Изучение характера контаминации и уровней содержания бактерий рода Campylobacter в отдельных видах пищевой продукции. Вопросы питания, 85(5), 52-59.
9. Little, C.L., Richardson, J.F., Owen, R.J., de Pinna, E., Threlfall, E.J. (2008). Campylobacter and Salmonella in raw red meats in the United Kingdom: Prevalence, characterization and antimicrobial resistance pattern, 2003-2005. Food microbiology, 25(3), 538-543.
10. Бессарабов Б.Ф., Вашутин А.А., Воронин Е.С. и др. Под ред. А. А. Сидорчука (2007). Инфекционные болезни животных. М., КолосС.—671 с. ISBN978-5-9532-0301-2
11. Dikeman, M., Devine, C. (2014). Encyclopedia of Meat Sciences. Second Edition. Cambridge, Academic Press. — 1525 р. ISBN: 978-012384731-7;978-012384734-8
12. Bojanic, K., Midwinter, A.C. Marshall, J.C., Rogers, L.E., Biggs, P.J., Acke, E. (2017) Isolation of сampylobacter spp. from dient-оwned dogs and cats, and retail raw meat pet food in the Manawa-tu, New Zealand. Zoonoses Public Health, 64(6). 438-449.
13. Groff, A.C.M., Kirinus, J.K., Sa e Silva, M., Machado, G., Costa, M.M., Vargas, A.P.C. (2010). Polymerase chain reaction for the diagnosis of bovine genital campylobacteriosis. Pesquisa Veterinaria Brasileira, 30(12), 1031-1035.
14. Chaban, B., Clin, S., Hendrick, S., Waldner, C., Hill, J.E. (2012). Evaluation of a Campylobacter fetus subspecies venerealis real-
time quantitative polymerase chain reaction for direct analysis of bovine preputial samples. Canadian Journal of Veterinary Research, 76(3), 166-173.
15. Он-лайн библиотека стандартов ISO [Интернет ресурс: https://www.iso.org/obp/ui/#iso: std: iso:10272:-1: ed-2: v1: en Дата обращения 20.10.017].
REFERENCES
1. Campbell, B.J., Engel, A.S., Porter, M.L., Takai, K. (2006). The versatile e-proteobacteria: Key players in sulphidic habitats. Nature Reviews Microbiology, 4(6), 458-468.
2. WHO publishes list of bacteria for which new antibiotics are urgently needed. Media center of WHO. [Electronic resource: http://www.who.int/mediacentre/news/releases/2017/bacte-ria-antibiotics-needed/ru/ Access date 29.10.20l7].
3. The global view of Campylobacteriosis. Report of an expert consultation, (2012). Utrecht, Netherlands 9-11 July.—136 p.
4. Altekruse, S.F., Stern, N.J., Fields, P.I., Swerdlow, D.L. (1999). Campylobacter jejuni — an emerging foodborne pathogen. Emerging Infectious Disease, 5(1), 28-35.
5. Campylobacter. Fact sheet. WHO. [Electronic resource: http://www.who.int/mediacentre/factsheets/fs255/ru/. Access date 29.10.2017].
6. Microbiological Risk Assessment Series. Salmonella and Campylobacter in chicken meat. (2009). Meeting report FAO and WHO.
7. Codex Alimentarius CAC/GL 78-2011, (2011) Guidelines for the Control of Campylobacter and Salmonella in Chicken Meat.
8. Efimochkina, N.R., Bykova, I.B., Stetsenko V.V., Minae-va L.P., Pichugina T.V., Markova Yu.M., Korotkevich Yu.V., Kozak S.S., Sheveleva S.A. (2016). Study of the nature of contamination and levels of bacteria of the genus Campylobacter in certain types of food products. Voprosy pitaniya, 85(5), 52-59. (in Russian).
9. Little, C.L., Richardson, J.F., Owen, R.J., de Pinna, E., Threlfall, E.J. (2008). Campylobacter and Salmonella in raw red meats in the United Kingdom: Prevalence, characterization and antimicrobial resistance pattern, 2003-2005. Food microbiology, 25(3), 538-543.
10. Bessarabov B.F., Vashutin A.A., Voronin Ye.S. and other. Infectious diseases of animals. Moscow.: KolosS.—671 p. (in Russian).
11. Dikeman, M., Devine, C. (2014). Encyclopedia of Meat Sciences. Second Edition. Cambridge: Academic Press. — 1525 p. ISBN: 978-012384731-7;978-012384734-8
12. Bojanic, K., Midwinter, A.C. Marshall, J.C., Rogers, L.E., Biggs, P.J., Acke, E. (2017) Isolation of Campylobacter spp. from client-owned dogs and cats, and retail raw meat pet food in the Manawatu, New Zealand. Zoonoses Public Health, 64(6). 438449.
13. Groff, A.C.M., Kirinus, J.K., Sa e Silva, M., Machado, G., Costa, M.M., Vargas, A.P.C. (2010). Polymerase chain reaction for the diagnosis of bovine genital campylobacteriosis. Pesquisa Veterinaria Brasileira, 30(12), 1031-1035
14. Chaban, B., Chu, S., Hendrick, S., Waldner, C., Hill, J.E. (2012). Evaluation of a Campylobacter fetus subspecies venerealis realtime quantitative polymerase chain reaction for direct analysis of bovine preputial samples. Canadian Journal of Veterinary Research, 76(3), 166-173.
15. Online Browsing Platform ISO [Electronic resource: https:// www.iso.org/obp/ui/#iso: std: iso:10272:-1: ed-2: v1: en Access date 20.10.017].
СВЕДЕНИЯ ОБ АВТОРАХ
Принадлежность к организации
Батаева Дагмара Султановна — кандидат технических наук, доцент, руководитель направления микробиологии, ведущий научный сотрудник лаборатории «Гигиена производства и микробиология», Федеральный научный центр пищевых систем им. В.М. Горбатова РАН 109316, г. Москва, ул. Талалихина, 26 Тел: +7-495-676-60-11 E-mail: d.bataeva@fncps.ru *автор для контактов
Минаев Михаил Юрьевич — кандидат технических наук, руководитель ПЦР направления, ведущий научный сотрудник в лаборатории «Гигиена производства и микробиология», Федеральный научный центр пищевых систем им. В.М. Горбатова РАН 109316 г. Москва, ул. Талалихина 26, Тел.: +7-495-676-60-11 E-mail: m.minaev@fncps.ru
Юшина Юлия Константиновна — кандидат технических наук, руководитель лаборатории «Гигиена производства и микробиология», Федеральный научный центр пищевых систем им. В.М. Горбатова РАН 10931, г. Москва, ул. Талалихина, 26 Тел. +7-495-676-91-26 E-mail: yu.yushina@fncps.ru
Соколова Ольга Вячеславовна — кандидат технических наук, младший научный сотрудник лаборатории «Гигиена производства и микробиология», Федеральный научный центр пищевых систем им. В.М. Горбатова РАН 109316 г. Москва, ул. Талалихина 26, Тел.: +7-495-676-60-11 E-mail: o.sokolova@fncps.ru
Зайко Елена Викторовна — старший лаборант лаборатории «Гигиена производства и микробиологии», Федеральный научный центр пищевых систем им. В.М. Горбатова РАН 109316 г. Москва, ул. Талалихина 26, Тел.: +7-495-676-60-11 E-mail: e.zaiko@ fncps.ru
Критерии авторства
Ответственность за работу и предоставленные сведения несут все авторы.
Все авторы в равной степени участвовали в этой работе. Батаева Д.С. разрабатывала научно-методические подходы к проведению работ, определяла объем исследований, анализировала полученные данные, выполняла описательную часть и корректировала после подачи в редакцию
Минаев М.Ю. проводил подбор праймеров для постановки ПЦР, анализировал полученные данные
Юшина Ю.К. анализировала полученные данные, проводила описательную частью работы
Соколова О.В. проводила обзор и анализ литературы, выполняла описательную часть
Зайко Е.В. отбирала объекты исследования, выполняла микробиологический и ПЦР анализ.
Авторы в равных долях имеют отношение к написанию рукописи и одинаково несут ответственность за плагиат
Конфликт интересов
Авторы заявляют об отсутствии конфликта интересов.
Поступила 15.11.2017
AUTHOR INFORMATION Affiliation
Dagmara S. Bataeva — candidate of technical sciences, docent, Head of the Direction of Microbiology, leading scientific worker of the Laboratory«Hygiene of production and microbiology» V.M. Gorbatov Federal Research Center for Food Systems of Russian Academy of Sciences
109316, Moscow, Talalikhina str., 26 Tel.: +7-495-676-60-11 E-mail: d.bataeva@fncps.ru ^corresponding author
Mikhail Yu. Minaev— candidate of technical sciences, a head of the Molecular diagnostic division, leading scientific worker of the Laboratory«Hygiene of production and microbiology» V.M. Gorbatov Federal Research Center for Food Systems of Russian Academy of Sciences
109316, Moscow, Talalikhina str., 26 Tel.: +-495-676-60-11 E-mail: m.minaev@fncps.ru
Yulia K. Yushina — candidate of technical sciences, docent, Head of the Laboratory «Hygiene of production and microbiology», V.M. Gorbatov Federal Research Center for Food Systems of Russian Academy of Sciences
109316, Talalikhina str. 26, Tel.: +7-495-676-91-26 E-mail: yu.yushina@fncps.ru
Olga V. Sokolova — candidate of technical sciences, junior researcher
worker of the Laboratory«Hygiene of production and microbiology»
V.M. Gorbatov Federal Research Center for Food Systems of Russian
Academy of Sciences
109316, Moscow, Talalikhina str., 26
Tel.: +7-495-676-60-11
E-mail: o.sokolova@fncps.ru
Elena V. Zaiko—senior research technician ofthe Laboratory«Hygiene of production and microbiology» V.M. Gorbatov Federal Research Center for Food Systems of Russian Academy of Sciences 109316, Moscow, Talalikhina str., 26 Tel.: +7-495-676-60-11 E-mail: e.zaiko@ fncps.ru
Contribution
All authors bear responsibility for the work and presented data. All authors made an equal contribution to the work. Dagmara S. Bataeva developed scientific and methodological approaches to work, determined the scope of research, analyzed the data obtained, performed the narrative and corrected it after submitting to the editorial office.
Mikhail Yu. Minaev conducted the selection of primers for the production of PCR, analyzed the data obtained
Yulia K. Yushina analyzed the obtained data, conducted descriptive part of the work
Olga V. Sokolova conducted a review and analysis of the literature, carried out the descriptive part
Elena V. Zaiko selected research objects, carried out microbiological and PCR analysis.
The authors were equally involved in writing the manuscript and bear the equal responsibility for plagiarism.
Conflict of interest
The authors declare no conflict of interest.
Received 15.11.2017
