CC BY
45
Pazilov Abduvakhid, Gaibnazarova Feruza, Kuchbaev Abdurakhim, Karimova Khabiba, Gulistan state University, 4 microdistrict, Gulistan, Uzbekistan E-mail: [email protected]
Variability and speciation in the Central Asian land mollusks kind Psendonapeus (Gastropoda, Pulmonata, Bulminidae)
Abstract: A study of intraspecific variation Central Buliminidae, types of Ps. albiplicatus, Ps. Sogdianus, the study of variability and clarify their taxonomy using molecular genetic techniques, as well as possible options for the speciation of these molluscs.
Keywords: Molecular genetic, marker, poltitpicheskie, genetic, landscape, Adyrna, konhological, matrix, amplification, primer elongation, denaturation, Sange, nucleotide.
Among the Central Asian Bulinidae race Psendonapeus provide an example of an amazing diversity of species, from the 64 species found in the region of 40 species or 62.5 % belong to this genus. Species diversity is undoubtedly a result of intense speciation, which in some cases can be observed currently. For example, over the past 20-25 years (Uvalieva, 1990, Kuznetsov, 1999, Pazilov, Asimov, 2003, Shileiko, Rymzhanov 2013) genus Pseudonapaeus refilled more than 10 new species for science.
The rapid completion of this kind of new species for science shows that the genus Pseudonapaeus in Central Asia is still poorly understood — taxonomy, biology, ecology, variability, and others.
It should be noted that the nature of the variability of the Central Asian Buliminidae analyzed a number of researchers [4; 9; 6; 7], but most of the researchers were limited to a statement of facts and a description of the variability of devices each form to the conditions of specific habitats, and why path and new forms practically unable attention.
In the last decade, along with traditional research methods to identify species used not only morphological and anatomical features, but also the data of biochemical and genetic studies. The increasing use of obtained molecular genetic techniques, with which, now established a DNA bank of valuable, rare and endangered species of animals and plants. Research on the intraspecific variability of stored objects, clarify contentious issues of taxonomy and classification, the development of techniques of genetic certification populations and study the genetic stability of stored ex situ taxa.
Intraspecific variation Central Buliminidae using molecular genetic markers is not yet known. Available works kind regards Chon-drula common within Europe [8; 1]and others.
Carrying out the molecular genetic studies poltitpicheskih species is very important, as it allows to evaluate how intraspecific polymorphism and create a typical "genetic passport" for the animal species in order to maintain and preserve biodiversity.
The aim of this work is an example of widespread species of Ps. albiplicatus, Ps. sogdianus study variability and clarify their taxonomy using molecular genetic techniques, as well as possible options for the speciation of these molluscs.
Material and methods
The material for this study were the charges authors conducted from 2007 to 2015 in Ugam, Chatkal, Fergana and Pskem, mountain ranges. Collection of material produced by the method ofA. Shileiko (1978, 1984). Material collected by hand in order to maximize tight and uniform research area, with a maximum coverage of the diversity of landscapes and habitats. To determine the number of types of
quantitative surveys conducted. This large species, larger than 10 mm. were counted with an area of 1 to 3 m., smaller species from the area were taken into account 0.25 sq. m. Live shellfish harvested in wet weather in adyr areas early in the morning until the dew has dried (at that time the majority of shellfish leads an active life, and they are easier to observe). In mountainous areas, most snails are active all day, so the material can be collected at any time of the day.
Determination of species belonging conducted by konho-logicheskim signs and reproductive system [9].
The isolated DNA was used as template for PCR amplification. Separately in each individual leg muscles clam isolated DNA using the DNA Tissue kit (Macherey-Nagel, Germany). DNA was dissolved in buffer were stored at — 20 °C. Fragments (18S) ribo-somal DNA were obtained in the polymerase chain reaction (PCR) using primers and 18Sd6 28Sr2. PCR was performed as follows: Step 1 — DNA denaturation at 95 °C for 3 minutes; Step 2 — DNA denaturation at 93 °C — 20 seconds; Step 3 — Annealing of primers at 55 °C — 30 seconds; Stage 4 — elongation at 72 °C — 2 min.; 5 stage — the chain elongation at 72 °C — 10 min. Steps 2 through 4 were repeated cyclically 35 times.
PCR — products were purified from impurities using gel electrophoresis and used to determine the nucleotide sequences of the Sanger method.
DNA sequencing was performed at the center of collective use "Genome" reagent kit using ABI PRISM® BigDye ™ Terminator v. 3.1 reaction products followed by analysis on an automatic sequencer ABI PRISM 3100-Avant (Applied Biosystems) (Moscow, Russia).
Analysis of the nucleotide sequences was performed using the software package MEGA5, alignment and comparison of sequences — using the method and Clustal W. Bioedit.
Research results and discussion
Both studied species are very widespread in Central Asia. It is found in the foothills and mountainous areas at an altitude of 1200-2500 m. above sea level. m. It lives among the thickets of grass, in coarse scree, among thickets of bushes, it prefers areas with loose soil.
Pseudonapaeus albiplicatus extremely variable species, variability konhologichesih signs of shell are as follows. For example, on the left bank of the river. Ugam, the neighborhood with. Khumsan, southern slopes of the hills of loose scree, basal parts of herbs in mollusks shell height of 13.5 mm., conical-cylindrical shape, a thick-walled (Fig. 1, A) p. Turns 7, well-convex. The last turnover of the mouth is raised very slightly. The height of the last whorl 2 times less than the height of the shell. Coating consists of horny background
and light radial Motley, developed to varying degrees. The sculp- oval usecheno-, places to attach it connected well developed corn, ture consists of massive blunt sharp edges. Mouth slightly oblique, equipped with a wide brim lip and moderate turn away.
A B CD
Fig. 1. Psendonapeus albiplicatus. A neighborhood of a. Humana (on the left bank of the river Ugam.); B- surroundings with. Hazratishah (Chartak district of Namangan region); B T- gorge. Piyazdy-sai (Chatkal range)
ABC Fig. 2. Variability shell Psendonapaeus sogdiana: A tract of Urta-Chuck (Nuratau hr.); B, near-c. Vodul (Alai Mts.)
Shellfish inhabiting the southern slopes of the hills of the lower parts of the plant suffrutescent, neighborhood s. Hazratishah (Chartak district of Namangan region) has the following differences from the first population: shell height of10 mm., oval-conical shape, shiny; coloration is brown background and developed in varying degrees of light radial Motley; the mouth of the attachment points are not connected; on the palatal wall are slightly prominent tubercle development of the tooth, which, when the shell is rotated to the left clearly visible (Fig. 1, B).
In Chatkal Ridge, Gorge. Piyazdy-say, the southern slope of the hills, among the bushes, live two forms, one large sink (height 17-18 mm.), thick-walled, oval-cylindrical shape; coloration is brown background and developed radial streaks; the mouth of the truncated-oval, his place of attachment is not connected (Fig. 1, B), another shell of medium size (height 10-12 mm.), fusiform shape, the color, light radial streaks developed so much that you can probably talk about the white shell (Fig. 1, D).
Psendonapaeus sogdianus upholstered in coarse scree, often in the steppe areas of the foothills, among herbaceous vegetation, sink very volatile as the Ps. albiplicatus. For example, living in coarse scree (Fig. 2, A) on the northern slope of the tract Urta-Chuck (Nurata Ridge), in mollusk shells oval-cylindrical shape, shiny, speed 6, convex, the last turnover of the mouth of the lift height of his 1.5 times the height of the half shells. Height 13 mm. shells. Painting horn (three embryonic turn light brown). Sculpture — embryonic turns smooth, and the rest with irregular radial wrinkles.
Mouth slightly skewed, the place of its attachment close together and connected to the thin corn, edge much to turn away.
On the Alai Range, not far from the. Vodul, southern slopes, on the lower parts of the stems subshrub among dwarf shrubs are found under rocks form two Ps. sogdianus of the first large shell (shell height 15 mm.) with a conical-cylindrical shape, speed 7 Painting, top 3 turns brown, the rest of turns on a white background are radial streaks. Mouth slightly skewed, the place of its attachment moderately close together, but not connected (Fig. 2 B). And at the second sink small (8-9 mm. height of the shell), thin-walled, with oblong-oval, 5 speed, color of light horn, the insertion of the mouth does not close together (Fig. 2).
As can be seen from the above data konhologicheskyh variability of the species studied are shown in color, shape and size of the shell.
Clams live on the southern slopes of the hills, on the stems of shrubs and dwarf shrubs characterized by the alternation on the sink white stripes of varying widths. Apparently, a striped coloration is associated with periodic changes in temperature and humidity during the shell growth. Regarding the development of stripes or streaks our views converge [5], during periods of low temperatures and moderate humidity sink is growing rapidly due to intensive work roll mantle, with the share of carbonates in secret in this case is relatively small and the sink in the end formed streaks.
It should be noted that the shellfish that live under rocks embryonic shell turns light brown, the other horn or light horn. This is due to the fact that shellfish inhabits shaded habitats, where climate con-
ditions there is no need in the reflection of the bright rays of the sun.
It should be noted that transitions linked differences in the color of the shell, the species studied, perhaps, above all, reflect the geochemical and climatic features of habitats. But at the same time, they are adaptive. The emergence of adaptation to the environment — the main result of evolution.
It should be noted that the nature of the variability of the Central Asian Buliminidae refer to the [4; 9].
P. V. Matekin (1959), setting an extremely wide range of variation konhologicheskih signs, brought all Buliminidae in 4 types (Jaminia potaniniana, J. labiella, J. fedtschenkoi, J. kasnakowi). The remaining 22 "kind of" united into one, an extremely volatile and widespread within the Central Asian appearance J. potaniniana.
A. A. Shileyko (1984) study of Central Asia Buliminidae found 29 species, of which the genus Psendonapaeus represented by 13 species, one of which Ps. albiplicatus composed with 8 forms
10 • I
(Ps (P.) albiplicatus f. albiplicata, Ps. (P.) albiplicatus f. sogdiana, Ps. (P.) albiplicatus f. secalina Ps. (P.) albiplicatus f. subobscura, Ps. (P.) albiplicatus f. asiatica, Ps. (P.) albiplicatus f. aptycha, Ps. (P.) albiplicatus f. retrodens, Ps. (P.) albiplicatus f. dissimilis) in-traspecific variation.
In the first, with the help of molecular genetic methods we investigated intraspecific variation Central Buliminidae the example of the widespread species Psendonapaeus.
Using polymerase chain reaction (PCR) using primers amplified 18S DNA region studied variability Ps (P.) albiplicatus f. albiplicata of two populations (1 populyatsiya neighborhood with Khumsan, Tashkent region; 2 population of a neighborhood with Hazratshah Namangan region). The size of the amplificate were analyzed by gel electrophoresis in 1.5 % agarose gel. The results showed that the nucleotide sequence of 18S rDNA partial areas of the two clam populations were identical (Fig. 3).
20 • I
30
• I
40 • I
50 • I
Ps.albiplicata_Nam 1 Ps.albiplicata_Tosh 1 Ps.sogdiana Jiz 1
CGAGT GGCGT T T AGCCACACGAGAT T GAGCAAT AACAGGT CT GT GAT GCC
Ps.albiplicata_Nam 51 Ps.albiplicata_Tosh 51 Ps.sogdiana Jiz 51
60 70 80 90 100
----I----I----I----I----I----I----I----I----I----I
CTTAGATGTCCGGGGCCGCACGCGCGCTACACTGAAGGAATCAGCGTGGA
Ps.albiplicata_Nam Ps.albiplicata_Tosh Ps.sogdi ana Ji z
110 120 130 140 150
----I----I----I----I----I----I----I----I----I----I
101 TGCCTCCCTGGCCCGAAAGGGCTGGGAAACCCGTTGAATCTCCTTCGTGC
101 ..................................................
101 ..................................................
Ps.albiplicata_Nam Ps.albiplicata_Tosh Ps.sogdi ana Ji z
160 170 180 190 200
----I----I----I----I----I----I----I----I----I----I
151 TAGGGATTGGGGCTTGTAATTCTTCCCCATGAACGAGGAATTCCCAGTAA
151 ..................................................
151 ..................................................
Ps.albiplicata_Nam Ps.albiplicata_Tosh Ps.sogdi ana Ji z
210 220 230 240 250
----I----I----I----I----I----I----I----I----I----I
201 GCGCGAGTCATAAGCTCGCGTTGATTACGTCCCTGCCCTTTGTACACACC
201 ..................................................
201 ..................................................
Ps.albiplicata_Nam Ps.albiplicata_Tosh Ps.sogdi ana Ji z
260 270 280 290 300
----I----I----I----I----I----I----I----I----I----I
251 GCCCGT CGCTACTAT CGAT TGAGCGGT T CAGTGAGGGCCT CGGAT TGGT С
251 ..................................................
251 ..................................................
Ps.albiplicata_Nam Ps.albiplicata_Tosh Ps.sogdi ana Ji z
310 320 330 340 350
----I----I----I----I----I----I----I----I----I----I
301 TCGGTCTGGTGCGCAAGTGCCGGCACCGCTGGCCGAGAAGAAGCTCGAAC
301 ..................................................
301 ..................................................
Ps.albiplicata_Nam Ps.albiplicata_Tosh Ps.sogdi ana Ji z
360 370 380 390 400
----I----I----I----I----I----I----I----I----I----I
351 T CGAT CGCT T GGAGAAAGTAAAAGT CGTAACAAGGT T T CCGTAGGTGAAC
351 ..................................................
351 ..............................T..................T
Ps.albiplicata_Nam Ps.albiplicata_Tosh Ps.sogdi ana Ji z
410
----I----I----I . .
401 CT GCGGAAGGAT CAT ТА
401 .................
401 .................
Fig. 3. Comparison of the nucleotide sequences Ps (P.) albiplicatus f. albiplicata and Ps. (P.) albiplicatus f. sogdiana (direction 5 'to 3' end, a point designated nucleobases)
And also with the help of molecular genetic methods we investigated intraspecific variation in two forms Ps (P.) albiplicatus f. albiplicata and Ps. (P.) albiplicatus f. sogdiana.
When comparing the nucleotide sequences of these regions (18S DNA region) of these forms have found differences in the two nucleotide positions. The percentage differences between the studied areas of shellfish accounted for 2.0 %. When comparing the differences between sequencers Ps (P.) albiplicatus f. albiplicata and Ps. (P.) albiplicatus f. 2 sogdiana mentioned nucleotide positions are represented by a transition between pyrimidines (C + T) (Fig. 3 at pos. 382 and 400).
It may be noted that the detection of signs of these types are clearly distinguished.
These data show that these types of both morphologically and genetically different levels with each other and are both these types Ps (P.) albiplicatus and Ps. (P.) sogdianus.
We phylogenetic analysis was also conducted using the method of nearest neighbors (Neighbor-joining, NJ) obtained on the basis of sequences 18S two species of mollusks and their intraspecific forms (Fig. 4). The phylogenetic tree indicated two well-isolated species Ps. albiplicatus and Ps. sogdianus.
Fig. 4. The phylogenetic tree depicting obtained on the basis of sequences 18S region Psendonapeus two types based on their own research and GenBank database (AY 145373)
Referring seen from the materials that within these types there are several konhologicheskih forms, in the simplest cases associated with smooth transitions. However, while collecting the material we found in one biotope two forms without transitions between them. These data allow us to consider one of the possible options for speciation in terrestrial mollusk species Psendonapaeus.
It should be noted that if in the Crimea, the Caucasus and in Central Europe for a long time the main ecological niches are filled, where each species is clearly separated from the next species, and we can say that the speciation process has been completed. In Central Asia, the speciation process is currently being intense.
As we know, any population of these species is characterized by the wide dimensional variability. In foothill areas on scree inhabits shallow molluscs from horn color, indicating that life mikroubezhis-chah under stones. In mountain areas in the open areas among dwarf shrubs mainly inhabit large mollusks developed with varying degrees of light radial pestrennoy.
If between the foothill and mountain populations there are enough strong bond, the foothills of the population, "merge" with the mountain and in this case, a relatively small area (the Alai Range, not far from the. Vodul) or biotope is possible to meet all possible transitions from small horn to large light shells.
However, if the shellfish semi-population for a long time were in isolation, then, going to the rocky slopes, they do not immediately "merge" with the mountain, and then on the same slope you can find a very small and very large clams, with virtually no
transitions between them, considering only this case, we can formally speak of two "real" types [5].
If the molluscs are long time in isolation, therefore, there is a weakening of contacts between individuals of the population, which stabilizes the direction of variation, together with the process variation adaptive shells, lead to the formation of a new species.
For example, near the village. Sherabad (Surhandarinskaya region) on the right bank of the river. Maidan in coarse scree, among thickets of bushes inhabits real Ps. sogdianus, however, is not far from this place (or rather 25 km.) to the north-eastern part, is the elevation of the place Independence, that all Stronach isolated deserts.
During the collection of material on the northern slopes of the hill in a melkooblomochnyh (debris) talus we found the view, which is very similar to Ps. sogdianus. In the study konhologicheskih characteristics and structure of the sexual apparatus, it was found that this particular kind of new to science.
As follows from the data obtained, the formation of new species occurs by targeting the source of the form of environmental conditions certain forms of adaptive variability of the environment, dwelling which requires a radical restructuring of the biology of reproduction and strong changes in the forms of protection against evaporation.
Thus, for long-term isolation of populations as a result of the constant elimination of medium-sized mollusks, can lead to the formation of new species, both on the basis of large forms in the interior of the original species, its population, standing at the threshold of habitats, which is now home to new species
References:
Komarova E. V., Stojko T. G., Titov S. V. Genetic and morphological structure of terrestrial mollusk populations Chondrula tridens in Middle Volga//Scientific Sheet Series Science. - 2015. - number 3(200), Issue 30. - P. 67-73.
Kramarenko S. S. Patterning of spatial and temporal variability of terrestrial molluscs: a multiscale approach//Abstract of dissertation for the degree of Doctor of Biological Sciences. - Kiev, 2014. - P. 44.
Kramarenko S. S. Analysis of the genetic structure of populations of terrestrial mollusk Cepaea vindobonensis (Gastropoda, Pulmonata, Helicidae) using RAPD markers//Vestnik zoologii. - 2009. - 43(5): 449-455.
Matekin P. V. Adaptive variation and speciation process in the Central Asian land snail family Enidae//Zool. Zh. - 1959. - T. 33, Vol. 10. - P. 1518-1536.
Muratov I. V. Terrestrial mollusks Kopetdag (fauna, ecology, zoogeography, systematics): Abstract. Dis ... kand. biol. nauk. - M., 1992. - 16 p.
Pazilov A. The nature of the variability Chondrulopsina fedtschenkoi (Mollusca, Pulmonata) from Ferghana and Alai ranges//Zool. zhurn. - 1991. - T. 70, Vol. 10. - P. 130-134.
7. Pazilov A., Daminova D. R. Character variability Chondrulopsina intumescens Turkestan ridges and Babatagskogo//Ruthenica. -2001. - T. XI, Vol. 2. - P. 183-186.
8. Snegin E. A. Analysis of genetic variability of populations of terrestrial mollusk Shondrula tridens Mull. (Gastropoda, Pulmonata) using ISSR and ^PD markers//Ecological Genetics. - 2013. - 11(3): 37-47.
9. Shileyko A. A. Terrestrial mollusks suborder Rupillina fauna of the USSR (Gastropoda, Pulmonota, Geophila) Fauna of the USSR. Shellfish. - L.: Nauka, Leningrad department, 1984. - TZ Vol. 3. - № 130. -P. 399.
Mirzayeva Yulduzkhon T., Master of biology, scientific researcher, Sadykov Institute of Bioorganic Chemistry, Uzbekistan Academy of Sciences E-mail: [email protected] Sultankhodzaev Mukhlis N., Doctor of science, Yunusov Institute of Chemistry of Plant Substances, Uzbekistan Academy of Sciences
Usmanov Pulat B., Doctor of science, professor, Sadykov Institute of Bioorganic Chemistry
The possible role of the Na+/Ca 2+ exchanger in the vasorelaxant effect of 1-O- benzoylkarakoline, a diterpenoid alkaloid, in rat aortic rings
This work was supported by a grant FA-F6-T083 from the Coordinating Committee for Development of Science and Technology under the Cabinet of Ministers of the Republic of Uzbekistan
Abstract: The aim of this study was to examine the role of the Na+/Ca 2+ exchanger in the vasorelaxation induced by 1-O-benzoylkarakoline (1-O-BK), a diterpenoid alkaloid, in rat aortic rings. We found that 1-O-BK potently and in a concentration-dependent manner inhibited the aortic rings contraction induced by low-Na+ solution and ouabaine. The comparison of our results showed that 1-O-BK inhibited the aortic rings contraction induced by these two procedures almost to the same extent and with nearly equal IC50 values. Since the contractions induced by low Na+ solution and ouabaine were mainly due to increased Ca 2+ influx mediated by the reverse mode of the Na+/Ca 2+ exchanger, these findings indicate that the inhibitory effect of 1-O-BK is a result of direct blockage of Ca 2+ influx via this exchanger. Taken together, the present results provide the clear evidence that 1-O-BK potently inhibited the Ca 2+ influx via Na+/Ca 2+-cexchanger, suggesting that this effect of alkaloid also may be involved in its vasorelaxant activity. The finding that 1-O-BK exhibits significant potency to block Ca 2+- influx via Na+/Ca 2+ exchanger may be important under some pathological conditions where the exchanger, operating in the reverse mode, induces Ca 2+ overload and, hence, may exacerbate overall vasoconstriction.
Keywords: rat aorta; vasorelaxation; diterpenoid alkaloid 1-O-benzoylkarakoline; Na+/Ca 2+ exchanger.
Introduction with a-adrenoreceptor stimulation [6,163-165; 7, 606-718]. These
Diterpenoid alkaloids produced by the plants of the genera data suggested that relaxant effect of 1-O-BK is probably due to
Aconitum and Delphinium comprise a large group of natural com- the inhibition of the Ca 2+ influx through both VDCCs and ROCCs,
pounds, still continue to deliver a great variety of structural templates resulting in decreased intracellular Ca 2+ concentration ([Ca 2+]in),
for drug discovery and development [1, 620-624; 2, 209-221]. and consequently, in reduced contractility. Furthermore, 1-O-BK
1-O-benzoylkarakoline (1-O-BK), a derivative of diterpenoid al- also effectively reduced the contraction induced by PE in a Ca 2+ —
kaloid karakoline, isolated from Aconitum karakolicum, has been free medium, suggesting that the inhibition Ca 2+ release from sar-
reported to possess diverse pharmacological properties, including coplasmic reticulum (SR), in addition to the blockage of VDCCs
spasmolytic, antiarrhythmic and anesthetic activities [3, 390-392; and ROCCs, also may be involved in the relaxant effect of 1-O-BK.
4, 254-269]. Recently, we found that 1-O-BK exhibited marked va- In smooth muscle cells the amount of Ca 2+ available for release, as
sorelaxant activity and significantly inhibited the contraction of rat well as the Ca 2+ content in SR is modulated by Na+/Ca 2+ exchanger,
aortic rings induced by KCl and phenylephrine (PE) [5, 8-11]. that operating in reverse mode provides a source of Ca 2+ for refill-
The relaxant effect of 1-O-BK was not significantly different in ei- ing this store [8, 657-660; 9, 763-854; 10, 519-529]. Considering
ther the presence or absence of functional endothelium and was this, we suggested that the reduction of PE-induced contraction in
not influenced by inhibition of nitric oxide synthase by L-NAME a Ca 2+-free medium by 1-O-BK may probably be due to the inhi-
or cyclooxygenase by indomethacin. At the same time, the relaxant bition of the Ca 2+ influx mediated by reverse mode of Na+/Ca 2+
effect of 1-0-BK on KCl- and PE-induced contractions was signifi- exchanger. Therefore, to address this possibility, we examined the
cantly attenuated in the presence ofverapamil, a voltage-dependent effects of 1-O-BK on the contractions of rat aortic rings induced by
Ca 2+ channels (VDCCs) blocker, and phentolamine which inhibits low-Na+ solution and ouabaine, which mainly are mediated by Ca 2+ receptor-operated Ca 2+ channels (ROCCs) activation associated entry via Na+/Ca 2+- exchanger.
