Variability and speciation in the Central Asian land mollusks kind Psendonapeus (Gastropoda, Pulmonata, Bulminidae)

Pazilov Abduvakhid; Gaibnazarova Feruza; Kuchbaev Abdurakhim; Karimova Khabiba

Pazilov Abduvakhid, Gaibnazarova Feruza, Kuchbaev Abdurakhim, Karimova Khabiba, Gulistan state University, 4 microdistrict, Gulistan, Uzbekistan E-mail: [email protected]

Variability and speciation in the Central Asian land mollusks kind Psendonapeus (Gastropoda, Pulmonata, Bulminidae)

Abstract: A study of intraspecific variation Central Buliminidae, types of Ps. albiplicatus, Ps. Sogdianus, the study of variability and clarify their taxonomy using molecular genetic techniques, as well as possible options for the speciation of these molluscs.

Keywords: Molecular genetic, marker, poltitpicheskie, genetic, landscape, Adyrna, konhological, matrix, amplification, primer elongation, denaturation, Sange, nucleotide.

Among the Central Asian Bulinidae race Psendonapeus provide an example of an amazing diversity of species, from the 64 species found in the region of 40 species or 62.5 % belong to this genus. Species diversity is undoubtedly a result of intense speciation, which in some cases can be observed currently. For example, over the past 20-25 years (Uvalieva, 1990, Kuznetsov, 1999, Pazilov, Asimov, 2003, Shileiko, Rymzhanov 2013) genus Pseudonapaeus refilled more than 10 new species for science.

The rapid completion of this kind of new species for science shows that the genus Pseudonapaeus in Central Asia is still poorly understood — taxonomy, biology, ecology, variability, and others.

It should be noted that the nature of the variability of the Central Asian Buliminidae analyzed a number of researchers [4; 9; 6; 7], but most of the researchers were limited to a statement of facts and a description of the variability of devices each form to the conditions of specific habitats, and why path and new forms practically unable attention.

In the last decade, along with traditional research methods to identify species used not only morphological and anatomical features, but also the data of biochemical and genetic studies. The increasing use of obtained molecular genetic techniques, with which, now established a DNA bank of valuable, rare and endangered species of animals and plants. Research on the intraspecific variability of stored objects, clarify contentious issues of taxonomy and classification, the development of techniques of genetic certification populations and study the genetic stability of stored ex situ taxa.

Intraspecific variation Central Buliminidae using molecular genetic markers is not yet known. Available works kind regards Chon-drula common within Europe [8; 1]and others.

Carrying out the molecular genetic studies poltitpicheskih species is very important, as it allows to evaluate how intraspecific polymorphism and create a typical "genetic passport" for the animal species in order to maintain and preserve biodiversity.

The aim of this work is an example of widespread species of Ps. albiplicatus, Ps. sogdianus study variability and clarify their taxonomy using molecular genetic techniques, as well as possible options for the speciation of these molluscs.

Material and methods

The material for this study were the charges authors conducted from 2007 to 2015 in Ugam, Chatkal, Fergana and Pskem, mountain ranges. Collection of material produced by the method ofA. Shileiko (1978, 1984). Material collected by hand in order to maximize tight and uniform research area, with a maximum coverage of the diversity of landscapes and habitats. To determine the number of types of

quantitative surveys conducted. This large species, larger than 10 mm. were counted with an area of 1 to 3 m., smaller species from the area were taken into account 0.25 sq. m. Live shellfish harvested in wet weather in adyr areas early in the morning until the dew has dried (at that time the majority of shellfish leads an active life, and they are easier to observe). In mountainous areas, most snails are active all day, so the material can be collected at any time of the day.

Determination of species belonging conducted by konho-logicheskim signs and reproductive system [9].

The isolated DNA was used as template for PCR amplification. Separately in each individual leg muscles clam isolated DNA using the DNA Tissue kit (Macherey-Nagel, Germany). DNA was dissolved in buffer were stored at — 20 °C. Fragments (18S) ribo-somal DNA were obtained in the polymerase chain reaction (PCR) using primers and 18Sd6 28Sr2. PCR was performed as follows: Step 1 — DNA denaturation at 95 °C for 3 minutes; Step 2 — DNA denaturation at 93 °C — 20 seconds; Step 3 — Annealing of primers at 55 °C — 30 seconds; Stage 4 — elongation at 72 °C — 2 min.; 5 stage — the chain elongation at 72 °C — 10 min. Steps 2 through 4 were repeated cyclically 35 times.

PCR — products were purified from impurities using gel electrophoresis and used to determine the nucleotide sequences of the Sanger method.

DNA sequencing was performed at the center of collective use "Genome" reagent kit using ABI PRISM® BigDye ™ Terminator v. 3.1 reaction products followed by analysis on an automatic sequencer ABI PRISM 3100-Avant (Applied Biosystems) (Moscow, Russia).

Analysis of the nucleotide sequences was performed using the software package MEGA5, alignment and comparison of sequences — using the method and Clustal W. Bioedit.

Research results and discussion

Both studied species are very widespread in Central Asia. It is found in the foothills and mountainous areas at an altitude of 1200-2500 m. above sea level. m. It lives among the thickets of grass, in coarse scree, among thickets of bushes, it prefers areas with loose soil.

Pseudonapaeus albiplicatus extremely variable species, variability konhologichesih signs of shell are as follows. For example, on the left bank of the river. Ugam, the neighborhood with. Khumsan, southern slopes of the hills of loose scree, basal parts of herbs in mollusks shell height of 13.5 mm., conical-cylindrical shape, a thick-walled (Fig. 1, A) p. Turns 7, well-convex. The last turnover of the mouth is raised very slightly. The height of the last whorl 2 times less than the height of the shell. Coating consists of horny background

and light radial Motley, developed to varying degrees. The sculp- oval usecheno-, places to attach it connected well developed corn, ture consists of massive blunt sharp edges. Mouth slightly oblique, equipped with a wide brim lip and moderate turn away.

A B CD

Fig. 1. Psendonapeus albiplicatus. A neighborhood of a. Humana (on the left bank of the river Ugam.); B- surroundings with. Hazratishah (Chartak district of Namangan region); B T- gorge. Piyazdy-sai (Chatkal range)

ABC Fig. 2. Variability shell Psendonapaeus sogdiana: A tract of Urta-Chuck (Nuratau hr.); B, near-c. Vodul (Alai Mts.)

Shellfish inhabiting the southern slopes of the hills of the lower parts of the plant suffrutescent, neighborhood s. Hazratishah (Chartak district of Namangan region) has the following differences from the first population: shell height of10 mm., oval-conical shape, shiny; coloration is brown background and developed in varying degrees of light radial Motley; the mouth of the attachment points are not connected; on the palatal wall are slightly prominent tubercle development of the tooth, which, when the shell is rotated to the left clearly visible (Fig. 1, B).

In Chatkal Ridge, Gorge. Piyazdy-say, the southern slope of the hills, among the bushes, live two forms, one large sink (height 17-18 mm.), thick-walled, oval-cylindrical shape; coloration is brown background and developed radial streaks; the mouth of the truncated-oval, his place of attachment is not connected (Fig. 1, B), another shell of medium size (height 10-12 mm.), fusiform shape, the color, light radial streaks developed so much that you can probably talk about the white shell (Fig. 1, D).

Psendonapaeus sogdianus upholstered in coarse scree, often in the steppe areas of the foothills, among herbaceous vegetation, sink very volatile as the Ps. albiplicatus. For example, living in coarse scree (Fig. 2, A) on the northern slope of the tract Urta-Chuck (Nurata Ridge), in mollusk shells oval-cylindrical shape, shiny, speed 6, convex, the last turnover of the mouth of the lift height of his 1.5 times the height of the half shells. Height 13 mm. shells. Painting horn (three embryonic turn light brown). Sculpture — embryonic turns smooth, and the rest with irregular radial wrinkles.

Mouth slightly skewed, the place of its attachment close together and connected to the thin corn, edge much to turn away.

On the Alai Range, not far from the. Vodul, southern slopes, on the lower parts of the stems subshrub among dwarf shrubs are found under rocks form two Ps. sogdianus of the first large shell (shell height 15 mm.) with a conical-cylindrical shape, speed 7 Painting, top 3 turns brown, the rest of turns on a white background are radial streaks. Mouth slightly skewed, the place of its attachment moderately close together, but not connected (Fig. 2 B). And at the second sink small (8-9 mm. height of the shell), thin-walled, with oblong-oval, 5 speed, color of light horn, the insertion of the mouth does not close together (Fig. 2).

As can be seen from the above data konhologicheskyh variability of the species studied are shown in color, shape and size of the shell.

Clams live on the southern slopes of the hills, on the stems of shrubs and dwarf shrubs characterized by the alternation on the sink white stripes of varying widths. Apparently, a striped coloration is associated with periodic changes in temperature and humidity during the shell growth. Regarding the development of stripes or streaks our views converge [5], during periods of low temperatures and moderate humidity sink is growing rapidly due to intensive work roll mantle, with the share of carbonates in secret in this case is relatively small and the sink in the end formed streaks.

It should be noted that the shellfish that live under rocks embryonic shell turns light brown, the other horn or light horn. This is due to the fact that shellfish inhabits shaded habitats, where climate con-

ditions there is no need in the reflection of the bright rays of the sun.

It should be noted that transitions linked differences in the color of the shell, the species studied, perhaps, above all, reflect the geochemical and climatic features of habitats. But at the same time, they are adaptive. The emergence of adaptation to the environment — the main result of evolution.

It should be noted that the nature of the variability of the Central Asian Buliminidae refer to the [4; 9].

P. V. Matekin (1959), setting an extremely wide range of variation konhologicheskih signs, brought all Buliminidae in 4 types (Jaminia potaniniana, J. labiella, J. fedtschenkoi, J. kasnakowi). The remaining 22 "kind of" united into one, an extremely volatile and widespread within the Central Asian appearance J. potaniniana.

A. A. Shileyko (1984) study of Central Asia Buliminidae found 29 species, of which the genus Psendonapaeus represented by 13 species, one of which Ps. albiplicatus composed with 8 forms

10 • I

(Ps (P.) albiplicatus f. albiplicata, Ps. (P.) albiplicatus f. sogdiana, Ps. (P.) albiplicatus f. secalina Ps. (P.) albiplicatus f. subobscura, Ps. (P.) albiplicatus f. asiatica, Ps. (P.) albiplicatus f. aptycha, Ps. (P.) albiplicatus f. retrodens, Ps. (P.) albiplicatus f. dissimilis) in-traspecific variation.

In the first, with the help of molecular genetic methods we investigated intraspecific variation Central Buliminidae the example of the widespread species Psendonapaeus.

Using polymerase chain reaction (PCR) using primers amplified 18S DNA region studied variability Ps (P.) albiplicatus f. albiplicata of two populations (1 populyatsiya neighborhood with Khumsan, Tashkent region; 2 population of a neighborhood with Hazratshah Namangan region). The size of the amplificate were analyzed by gel electrophoresis in 1.5 % agarose gel. The results showed that the nucleotide sequence of 18S rDNA partial areas of the two clam populations were identical (Fig. 3).

20 • I

30

• I

40 • I

50 • I

Ps.albiplicata_Nam 1 Ps.albiplicata_Tosh 1 Ps.sogdiana Jiz 1

CGAGT GGCGT T T AGCCACACGAGAT T GAGCAAT AACAGGT CT GT GAT GCC

Ps.albiplicata_Nam 51 Ps.albiplicata_Tosh 51 Ps.sogdiana Jiz 51

60 70 80 90 100

----I----I----I----I----I----I----I----I----I----I

CTTAGATGTCCGGGGCCGCACGCGCGCTACACTGAAGGAATCAGCGTGGA