Multidrug-Resistant Salmonella spp. Isolated from Apparently Healthy Pigeons in a Live Bird Market in Chattogram, Bangladesh Текст научной статьи по специальности «Биологические науки»

2020, Scienceline Publication

World's Veterinary Journal

World Vet J, 10(4): 508-513, December 25, 2020

DOI: https://dx.doi.org/10.54203/scil.2020.wvj61

Multidrug-Resistant Salmonella spp. Isolated from Apparently Healthy Pigeons in a Live Bird Market in Chattogram, Bangladesh

Zamila Bueaza Bupasha1, Ruhena Begum2, Sharna Karmakar3, Rahima Akter4, Md Bayzid5, Abdul Ahad1 and Md Samun Sarker1'2*

1 Department of Microbiology and Veterinary Public Health, Chattogram Veterinary and Animal Sciences University (CVASU), Chattogram-4225, Bangladesh

2 Antimicrobial Resistance Action Center (ARAC), Bangladesh Livestock Research Institute (BLRI), Savar, Dhaka-1341, Bangladesh

3 Department of Biochemistry and Molecular Biology, Jahangirnagar University, Savar, Dhaka-1342, Bangladesh

4 Department of Pharmacy, World University of Bangladesh (WUB), Bangladesh

5 Department of Pathology and Parasitology, Chattogram Veterinary and Animal Sciences University (CVASU), Chattogram-4225, Bangladesh "•"Corresponding author's E-mail: [email protected]. : 0000-0001-5445-1040

ABSTRACT

Multidrug-resistant Salmonella could pose a severe public health threat. The current study aimed to investigate the prevalence of antibiotic resistance and some antibiotic-resistant genes in Salmonella spp. isolated from pigeons in a live bird market, Chattogram, Bangladesh. A total of 100 cloacal swab samples were collected aseptically from apparently healthy pigeons in the live bird market, namely Riazuddin Bazar in Chattogram city, Bangladesh. Different bacteriological and biochemical tests were used for the isolation and identification of Salmonella spp. The susceptibility test of Salmonella isolates to different antibiotics was performed by the disk diffusion method. PCR assay using specific primers was used for antibiotic resistance genes detection. The results indicated that the prevalence of Salmonella spp. was 29% in sampled birds. The highest antibiotic resistance rate was found to be ampicillin (93.1%), followed by both sulfamethoxazole-trimethoprim and tetracycline (86.2%). In contrast, 65.5% of isolates were found sensitive to ciprofloxacin, followed by colistin (62.1%), kanamycin (55.2%), and gentamicin (48.3%). 96.6% of Salmonella isolates were classified as multidrug-resistant and harbored blaTEM, tetA, sul1, and sul2 genes. In conclusion, pigeons as carriers of antibiotic-resistant Salmonella spp. may pose a health risk to other birds and humans.

Keywords: Antibiogram, Antibiotic resistance genes, Pigeons, Prevalence, Salmonella INTRODUCTION

Food animals have been recognized as a reservoir of resistant bacteria and a source of foodborne infections for humans (Szmolka and Nagy, 2013). Food chain cycle act as a vehicle to transmit antibiotic-resistant infectious agents from farm animals to humans (Molbak et al., 2002).

Pigeons (Columbia livia) have an important role in dispersing the bacterial agents to free-range poultry and have been considered a fecal contaminator of drinking water sources and rural harvests (Lillehaug et al., 2005). These birds are in contact with humans at home, farms, and live bird markets (LBM), and are responsible for the transmission of several diseases through their droppings (Weber, 1979). Several pathogenic microbes such as E. coli, Salmonella spp., Cryptococcus spp., and Chlamydia spp. are carried by pigeons (Tanaka et al., 2005).

LBMs are the most significant terminal hub of the poultry business in Asian countries, where individuals purchase live or freshly butchered poultry (Sarker et al., 2019a). Pigeons in LBMs are originated from various sources and territories and stocked in confined spaces at high densities. Moreover, at LBMs, customers come in close and direct interaction with live or processed poultry. Therefore, unhygienic conditions in LBMs may provoke the dissemination of infectious agents from pigeon to pigeon and pigeon to human. In the farms and LBMs, the apparently healthy pigeons are one of the sources of human salmonellosis (Hosain et al., 2012). Therefore, LBMs have an important role in the transmission of Salmonella in human food chain. To date, very little work on prevalence of antibiotic-resistant Salmonella in pigeons has been conducted in Bangladesh. Therefore, the present study aimed to determine the prevalence of antibiotic resistance and some resistance genes in Salmonella isolated from pigeons in LBM in Chattogram, Bangladesh.

ISSN 2322-4568

A R

c n

c c

e i

p v

e ft

: :

2 C

N C

o t

2 C

0

1 —

G

HH

N A L

A R

T —

C L

E

_508

To cite this paper: Bupasha ZB, Begum R, Karmakar S, Akter R, Bayzid M, Ahad A and Sarker MS (2021). Multidrug-Resistant Salmonella spp. Isolated from Apparently Healthy Pigeons in a Live Bird Market in Chattogram, Bangladesh. World Vet. J., 10 (4): 508-513. DOI: https://dx.doi.org/10.54203/scil.2020.wvj61

MATERIALS AND METHODS

Ethical approval

The study protocol was approved by the Institutional Animal Ethics Committee, Chattogram Veterinary and Animal Sciences University, Bangladesh.

Samples collection

A total of 100 cloacal swab samples were aseptically collected from 100 apparently healthy pigeons in a LBM in Chattogram, Bangladesh during the period from February to April 2018. Using a simple random technique, 10 samples were collected from each shop. The swab samples were transferred to Falcon tubes containing 5 ml of buffered peptone water (BPW) (Oxoid, UK) and immediately transported to the laboratory in an icebox.

Isolation and identification of Salmonella

Samples were incubated overnight in BPW at 37 °C for enrichment. For selective enrichment, 100 ^l of the pre-enriched sample was transferred to Rappaport-Vassiliadis (RV) medium (Oxoid, UK), incubated at 41.5 °C for 24 hours. A loopful of positive enrichment in RV was streaked onto Salmonella-Shigella (SS) agar (Oxoid, UK) and xylose lysine deoxycholate (XLD) agar (Oxoid, UK), incubated at 37°C for 24 hours. At least two single typical Salmonella colonies were randomly picked up and subjected to biochemical tests (triple sugar iron [TSI], indole, urease, oxidase, and catalase tests) (Begum et al., 2018). Positive Salmonella isolates were preserved into brain heart infusion (BHI) broth (Oxoid, UK) with 15% glycerol at -80 °C.

Extraction of chromosomal DNA

For the PCR, total DNA was extracted from the isolated bacterial agents using the boiling method (Sánchez et al., 2010). In brief, 2-3 pure cultured colonies were mixed with 200 ^l of deionized water into 1.5 ml sterile Eppendorf tube, followed by boiling for 15 min. After boiling, it was kept on ice immediately for 10 min, centrifuged for 2 min at 15000 rpm. Finally, the collected supernatant was used as a DNA template for PCR.

Molecular detection of Salmonella

Genotypic confirmation of Salmonella was done by targeting the sdiA gene as previously described by Halatsi et al. (2006). The sequence of the specific primer pair for the sdiA gene is presented in Table 1. PCR amplification was accomplished with a 25 ^l reaction mixture containing deionized water (10.5 ^l), GoTaq master mix (Promega, USA) (12.5 ^l), forward and reverse primers (0.5 ^l each), and DNA template (1 ^l). The thermal profile consisted of an initial denaturation step at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 sec, annealing at 50 °C for 1 min, elongation at 72 °C for 1 min, and final extension at 72 °C for 10 min. PCR products were then electrophoresed by running in 1.5% agarose gel stained with ethidium bromide (Sigma-Aldrich, USA).

Table 1. Oligonucleotide primers used in the study

Target genes Primers sequence (5-3) Amplicon size (base pair) References

blaTEM F: TACGATACGGGAGGGCTTAC R: TTCCTGTTTTTGCTCACCCA 716 Belaaouaj et al. (1994)

tetA F: GCTACATCCTGCTTGCCTTC R: CATAGATCGCCGTGAAGAGG 210 Karczmarczyk et al. (2011)

sul1 F: CGGCGTGGGCTACCTGAACG R: GCCGATCGCGTGAAGTTCCG 433 Sunde (2005)

sul2 F: CGGCATCGTCAACATAACCT R: TGTGCGGATGAAGTCAGCTC 721 Lanz et al. (2003)

sdiA (Salmonella) F: AATATCGCTTCGTACCAC R: GTAGGTAAAC GAGGAGC AG 274 Halatsi et al. (2006)

F: forward, R: reverse

Antibiotic susceptibility test

To assess the antibiotic susceptibility of Salmonella isolates, the disk diffusion method was performed on Mueller-Hinton agar (Oxoid, UK) plates as described by CLSI (2012). The isolates were tested against 10 commonly used antibiotics using antibiotic disks including ampicillin (10 ^g), ceftriaxone (30 ^g), ciprofloxacin (5 ^g), gentamicin (10 ^g), kanamycin (30 ^g), tetracycline (30 ^g), sulfamethoxazole -trimethoprim (25 ^g), colistin sulfate (10 ^g), chloramphenicol (30 ^g) and nalidixic acid (30 ^g) (Oxoid, UK). The sensitivity results were interpreted according to CLSI (2012). Multidrug-resistant (MDR) was defined as isolate being resistant to at least three antimicrobial agents from different classes (Tenover, 2006).

—509

To cite this paper: Bupasha ZB, Begum R, Karmakar S, Akter R, Bayzid M, Ahad A and Sarker MS (2021). Multidrug-Resistant Salmonella spp. Isolated from Apparently Healthy Pigeons in a Live Bird Market in Chattogram, Bangladesh. World Vet J., 10 (4): 508-513. DOI: https://dx.doi.org/10.54203/scil.2020.wvj61

Detection of antibiotic resistance genes

All of the phenotypically resistant Salmonella isolates were subjected to PCR to detect the ampicillin resistance gene (blaTEM), tetracycline resistance gene (tetA), and sulfonamide resistance gene (sul1 and sul2) according to the previously published study (Sarker et al., 2019b). The sequence of primers used for target gene amplification is presented in Table 1.

Statistical analysis

Data were entered into an Excel spreadsheet (Microsoft Corporation, USA). Descriptive statistics were used to analyze the data by an online epidemiological calculator (Sergeant, ESG, 2019).

RESULTS

Prevalence and characteristic of Salmonella

The prevalence of Salmonella in the collected samples was 29% (29/100) (95% CI: 21.01-38.54). Distinctive Salmonella colonies on XLD agar were pink color with black centered, and on SS agar produced small, smooth, round, and black centered colonies. Salmonella isolates were positive to TSI and negative to indole, urease, oxidase, and catalase test.

Antibiotic resistance patterns

Antibiogram study of Salmonella showed that the isolates were highly resistant to ampicillin (93.1%, 27/29), tetracycline (86.2%, 25/29) and sulfamethoxazole-trimethoprim (86.2%, 25/29), followed by nalidixic acid (72.4%, 21/29), chloramphenicol (51.7%, 15/29) and ceftriaxone (48.28%, 14/29). To the contrary, the highest susceptibility rate was found against ciprofloxacin (65.5%, 19/29), followed by colistin (62.1%, 18/29) and kanamycin (55.2%, 16/29) (Figure 1). Of the 29 Salmonella isolates, 28 (96.6%) disclosed the MDR patterns (Table 2).

Table 2. Antibiotic resistance patterns and distribution of targeted resistant genes among 29 Salmonella isolates recovered from cloacal swab samples of pigeons in a live bird market in Chattogram, Bangladesh_

Phenotypic pattern of antibiotic resistance MDR isolate Genotypic pattern of antibiotic resistance

blaTEM tetA sul1 sul2

AMP-SXT - + - + +

AMP-TE-SXT + + + - -

AMP-TE-CT-C + - - - -

AMP-TE-SXT-NA + + + + +

AMP-SXT-C-K + + - - -

AMP-SXT-CIP-NA + + - - +

AMP-SXT-CN-C-NA + - - + -

AMP-CRO-TE-SXT-NA + + + - -

AMP-TE-SXT-CT-C + + + - +

CRO-TE-SXT-CN-NA + - + + -

AMP-TE-SXT-CN-NA + + - - +

AMP-TE-SXT-CN-CT-CIP + + + + -

AMP-TE-SXT-C-NA-K + - - - +

TE-SXT-CN-C-CIP-K + - + - -

AMP-CRO-TE-SXT-CT-NA + + - + +

AMP-TE-CN-CT-C-K + + + - -

AMP-CRO-TE-SXT-C-NA + + + - +

AMP-CRO-TE-SXT-CIP-NA + - - + +

AMP-TE-SXT-CN-C-NA + + + - -

AMP-CRO-TE-SXT-NA-K + + - - +

AMP-CRO-TE-SXT-CN-C-NA + - + + +

AMP-CRO-TE-SXT-CIP-NA-K + + - - -

AMP-CRO-TE-SXT-C-NA-K + + + + -

AMP-TE-SXT-CN-CT-CIP-NA + + + - +

AMP-CRO-TE-SXT-CT-CIP-NA + - + + -

AMP-CRO-TE-CN-CT-C-NA-K + + - - -

AMP-CRO-TE-CT-C-CIP-NA-K + + + - -

AMP-CRO-TE-SXT-C-CIP-NA-K + + - + +

AMP-CRO-TE-SXT-CN-C-CIP-NA-K + + + + +

Total 29 21 16 12 14

AMP: ampicillin, SXT: sulfamethoxazole-trimethoprim, TE: tetracycline, CT: colistin sulfate, C: chloramphenicol, NA: nalidixic acid, K: kanamycin, CIP: ciprofloxacin, CN: gentamicin, CRO: ceftriaxone, MDR: multidrug-resistant, blaTEM: ampicillin resistance gene, tetA: tetracycline resistance gene, sull and sul2: sulfa drug resistance genes.

—510

To cite this paper: Bupasha ZB, Begum R, Karmakar S, Akter R, Bayzid M, Ahad A and Sarker MS (2021). Multidrug-Resistant Salmonella spp. Isolated from Apparently Healthy Pigeons in a Live Bird Market in Chattogram, Bangladesh. World Vet. J., 10 (4): 508-513. DOI: https://dx.doi.org/10.54203/scil.2020.wvj61

Antibiotic resistance genes

Out of 27 ampicillin-resistant isolates, 77.8% (21/27) isolates carried ampicillin resistance gene blaTEM. The prevalence of tetA in Salmonella isolates that were phenotypically resistant to tetracycline was 64% (16/25). Among isolates that were phenotypically resistant to sulfamethoxazole-trimethoprim, the prevalence of sul1, and sul2 genes were 48% (12/25), and 56% (14/25), respectively. The distribution of resistance genes along with resistance patterns of Salmonella isolates are presented in Table 2.

■ Resistant

I Intermediate

I Sensitive

s

<

Nalidixic acid Ciprofloxacin Chloramphenicol Coli stin Kanamycin Gentamicin Sulfamethoxazole-trimethoprim Tetracycline Ceftriaxone Ampicillin

No of isolates (29)

Figure 1. Antibiogram profile of Salmonella isolates recovered from cloacal swab samples of pigeons in a live bird market in Chattogram, Bangladesh

DISCUSSION

In this study, the prevalence of Salmonella in pigeons was lower than the previous reports in Bangladesh (Hosain et al., 2012; Saifullah et al., 2016), which reported the prevalence rates of 40.28% and 37.5% in pigeons, respectively. In Copenhagen, pooled fecal samples of pigeons showed a prevalence rate of 22.8% for Salmonella (Pasmans et al., 2004), while in Iran, prevalence of Salmonella in cloacal samples isolated from pigeons was 15.6% (Akbarmehr, 2010).

In this study, Salmonella isolates were highly resistant to ampicillin, followed by tetracycline and sulfamethoxazole-trimethoprim (86.2%) and nalidixic acid (72.4%). A comparable result was obtained by Saifullah et al. (2016), who stated a high rate of resistance to ampicillin (88.2%), while a high sensitivity rate to nalidixic acid (76.5%) in Salmonella spp from apparently healthy pigeons. Hosain et al. (2012) reported that 80% of Salmonella isolated from pigeons were resistant to ampicillin, followed by tetracycline (60%) and sulfamethoxazole (20%) from Bangladesh. The highest resistance rate of these antibiotics may be due to the long-term use in veterinary practice. Ampicillin, tetracycline, and sulfonamide are regularly prescribed antibiotics in poultry treatment in Bangladesh (Saifullah et al., 2016). Moreover, cross resistance to similar classes of antibiotics is also responsible for the high resistance rates.

In food animals, ciprofloxacin is one of the broadly used antibiotics that is regularly prescribed for poultry practice in Bangladesh (Azad et al., 2019). The resistance to ciprofloxacin is a worldwide issue since it could complicate clinical therapy both in humans and livestock. Resistance to colistin (31%), one of the significant findings of our study which is worrisome. The last resort drug, colistin is being expansively prescribed in veterinary practice, however because of nephrotoxicity and neurotoxicity, its use is restricted in human practice (Hassan et al., 2015). The findings of the present study disclosed that 65.5%, 55.2%, and 48.3% of Salmonella isolates were sensitive to ciprofloxacin, kanamycin, and gentamicin, respectively while Hosain et al., (2012) reported 60% sensitivity rate to kanamycin and gentamicin. The present study indicated that 96.6% of Salmonella isolates were MDR. A number of previous researches reported MDR Salmonella in Bangladesh (Khan et al., 2005; Rahman et al., 2011). A high incidence of MDR strains may be occurred due to the aimless use of antibiotic agents.

In the present study, the antibiotic resistance genes among Salmonella isolates were detected. The presence of blaTEM, tetA, and sul2 genes in Salmonella isolates were reported by Adelowo et al. (2014) and Messaili et al. (2019)

511

To cite this papery Bupasha ZB, Begum R, Karmakar S, Akter R, Bayzid M, Ahad A and Sarker MS (2021). Multidrug-Resistant Salmonella spp. Isolated from Apparently Healthy Pigeons in a Live Bird Market in Chattogram, Bangladesh. World Vet J., 10 (4): 508-513. DOI: https://dx.doi.org/10.54203/scil.2020.wvj61

that had similar frequencies with our findings. The frequency of antibiotic resistance genes in Salmonella is quite variable in poultry, which may be due to differences in antibiotic use patterns in different regions.

CONCLUSION

The prevalence of MDR Salmonella in pigeons in live bird markets is a public health concern, therefore, it is recommended to maintain strict hygienic measures, proper cage, and litter management to diminish the load and spread of MDR Salmonella and ensure customers health and safety.

DECLARATIONS

Acknowledgments

The authors would like to thanks the pigeon shop owners for their help during sample collections.

Competing interests

The authors declare that they have no conflict of interest.

Authors' contribution

Zamila Bueaza Bupasha, Abdul Ahad and Md Samun Sarker designed the study plan. Zamila Bueaza Bupasha, Md Bayzid and Md Samun Sarker performed the laboratory experiments. Sharna Karmakar and Rahima Akter analyzed the data. Ruhena Begum and Zamila Bueaza Bupasha drafted the manuscript. Abdul Ahad and Md Samun Sarker revised the manuscript. All authors read and approved the final manuscript for publication.

REFERENCES

Adelowo O, Fagade O and Agerso Y (2014). Antibiotic resistance and resistance genes in Escherichia coli from poultry farms,

southwest Nigeria. The Journal of Infection in Developing Countries, 8: 1103-1112. DOI: https://doi.org/10.3855/iidc.4222 Akbarmehr J (2010). Isolation of Salmonella spp. from poultry (ostrich, pigeon, and chicken) and detection of their hilA gene by PCR method. African Journal of Microbiology Research, 4(24): 2678-2681. DOI: http://www. academiciournals.org/aimr

Azad MARA, Rahman MM, Amin R, Begum MIA, Fries R, Husna A, Khairalla AS, Badruzzaman ATM, Zowalaty MEE, Lampang KN et al. (2019). Susceptibility and Multidrug Resistance Patterns of Escherichia coli Isolated from Cloacal Swabs of Live Broiler Chickens in Bangladesh. Pathogens, 8(3): 118. DOI: https://dx.doi. org/10.3390%2Fpathogens8030118

Begum R, Sarker MS, Ngamsanga P, Pulsrikarn C, Pichpol D, Meeyam T and Chaisowwong W (2018). Prevalence and antimicrobial resistance of Salmonella isolated from meat and eggs in Muang district in Chiang Mai province, Thailand. The 5th Food Safety and Zoonoses Symposium for Asia Pacific, Chiang Mai, Thailand, 73-79.

Belaaouaj A, Lapoumeroulie C, Canifa MM, Vedel G, Nevot P, Krishnamoorthy R and Paul G (1994). Nucleotide sequences of the genes coding for the TEM-like P-lactamases IRT-1 and IRT-2 (formerly called TRI-1 and TRI-2). FEMS Microbiology Letters, 120(1-2): 75-80. DOI: https://doi.org/10.1111/i.1574-6968.1994.tb07010.x

CLSI (2012). Performance standards for antimicrobial disk susceptibility tests; approved standard, 11th Edn. CLSI document M02-A11. Wayne, PA: Clinical and Laboratory Standards Institute.

Halatsi K, Oikonomou I, Lambiri M, Mandilara G, Vatopoulos A and Kyriacou A (2006). PCR detection of Salmonella spp. using primers targeting the quorum sensing gene sdiA. FEMS Microbiology Letters, 259(2): 201-207. DOI: https://doi.org/10.1111/i.1574-6968.2006.00266.x Hassan M, Ahaduzzaman M, Alam M, Bari MS, Amin KB and Faruq AA (2015). Antimicrobial resistance pattern against E. coli and Salmonella spp. in environmental effluents. International Journal of Natural Sciences, 5: 52-58. DOI: https://doi.org/10.3329/iins.v5i2.28612 Hosain MS, Islam MA, Khatun MM and Dey RK (2012). Prevalence and antibiogram profiles of Salmonella isolated from pigeons in Mymensingh, Bangladesh. Microbes and Health, 1(2): 54-57. https://www.banglaiol.info/index.php/MH/article/view/14090

Karczmarczyk M, Martins M, Quinn T, Leonard N and Fanning S (2011). Mechanisms of fluoroquinolone resistance in Escherichia coli isolates from food-producing animals. Applied and Environmental Microbiology, 77(20): 7113-7120. DOI: https://doi.org/10.1128/aem.00600-11

Khan M, Rahman M, Khan M and Nazir Khmnh RM (2005). Antibiogram and plasmid profile analysis of isolated poultry Salmonella of Bangladesh.Pakistan Journal of Biological Sciences, 8(11): 1614-1619. DOI: http://dx.doi.org/10.3923/pibs.2005.1614.1619

Lanz R, Kuhnert P and Boerlin P (2003). Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Veterinary Microbiology, 91(1): 73-84. DOI: https://doi.org/10.1016/s0378-1135(02)00263-8

Lillehaug A, Jonassen CM, Bergsie B, Hofshagen M, Tharaldsen J, Nesse L and Handeland K (2005). Screening of feral pigeon (Colomba livia), mallard (Anas platyrhynchos) and graylag goose (Anser anser) populations for Campylobacter spp., Salmonella spp., avian influenza virus and avian paramyxovirus. Acta Veterinaria Scandinavica, 46(4): 193-202. DOI: https://doi.org/10.1186/1751-0147-46-193

512

To cite this papery Bupasha ZB, Begum R, Karmakar S, Akter R, Bayzid M, Ahad A and Sarker MS (2021). Multidrug-Resistant Salmonella spp. Isolated from Apparently Healthy Pigeons in a Live Bird Market in Chattogram, Bangladesh. World Vet J., 10 (4): 508-513. DOI: https://dx.doi.org/10.54203/scil.2020.wvj61

Messaili C, Messai Y and Bakour R (2019). Virulence gene profiles, antimicrobial resistance and phylogenic groups of fecal Escherichia coli strains isolated from broiler chickens in Algeria. Veterinaria Italiana, 55(1): 35-46. DOI: https://doi.org/10.12834/vetit.799.3865.2

Molbak K, Gerner-Smidt P and Wegener HC (2002). Increasing quinolone resistance in Salmonella enterica serotype Enteritidis. Emerging Infectious Diseases, 8(5): 514-515. DOI: https://dx.doi.org/10.3201%2Feid0805.010288

Pasmans F, Van Immerseel F, Hermans K, Heyndrickx M, Collard JM, Ducatelle R and Haesebrouck F (2004). Assessment of virulence of pigeon isolates of Salmonella enterica subsp. enterica serovar Typhimurium variant Copenhagen for humans. Journal of Clinical Microbiology, 42(5): 2000-2002. DOI: https://doi.org/10.1128/jcm.42.5.2000-2002.2004

Rahman M, Hossain M, Akhter M and Hasan S (2011). Characterization and antibiogram study of Salmonella serovars isolated from duck, quail and pigeon in Dinajpur district of Bangladesh. International Journal of Sustainable Agricultural Technology, 7(2): 2329.

Saifullah MK, Mamun MM, Rubayet RM, Nazir KNH, Zesmin K and Rahman MT (2016). Molecular detection of isolated from apparently healthy pigeon in Mymensingh, Bangladesh and their antibiotic Salmonella spp. resistance pattern. Journal of Advanced Veterinary and Animal Research, 3(1): 51-55. DOI: http://doi.org/10.5455/javar.2016.c131

Sánchez S, Martínez R, García A, Benítez J, Blanco J, Blanco JE, Blanco M, Dahbi G, López C and Mora A (2010). Variation in the prevalence of non-O157 Shiga toxin-producing Escherichia coli in four sheep flocks during a 12-month longitudinal study. Small Ruminant Research, 93(2-3): 144-148. DOI: https://doi.org/10.1016/j.smallrumres.2010.05.014

Sarker MS, Ahad A, Ghosh SK, Mannan MS, Sen A, Islam S, Bayzid M and Bupasha ZB (2019b). Antibiotic-resistant Escherichia coli in deer and nearby water sources at Safari parks in Bangladesh. Veterinary World, 12(10): 1578-1583. DOI: https://dx.doi.org/10.14202%2Fvetworld.2019.1578-1583

Sarker MS, Mannan MS, Ali MY, Bayzid M, Ahad A and Bupasha ZB (2019a). Antibiotic resistance of Escherichia coli isolated from broilers sold at live bird markets in Chattogram, Bangladesh. Journal of Advanced Veterinary and Animal Research, 6(3): 272277. DOI: https://doi.org/10.5455/javar.2019.f344

Sergeant, ESG (2019). Epitools Epidemiological Calculators. Ausvet. Available at: http://epitools.ausvet.com.au

Sunde M (2005). Prevalence and characterization of class 1 and class 2 integrons in Escherichia coli isolated from meat and meat products of Norwegian origin. Journal of Antimicrobial Chemotherapy, 56(6): 1019-1024. DOI: https://doi.org/10.1093/jac/dki377

Szmolka A and Nagy B (2013). Multidrug resistant commensal Escherichia coli in animals and its impact for public health. Frontiers in Microbiology, 4: 258. DOI: https://dx.doi.org/10.3389%2Ffmicb.2013.00258

Tanaka C, Miyazawa T, Watarai M and Ishiguro N (2005). Bacteriological survey of feces from feral pigeons in Japan. Journal of Veterinary Medical Science, 67(9): 951-953. DOI: https://doi.org/10.1292/jvms.67.951

Tenover FC (2006). Mechanisms of antimicrobial resistance in bacteria. The American Journal of Medicine, 119(6): S3-S10. DOI: https://doi.org/10.1016/j.amjmed.2006.03.011

Weber W (1979). Pigeon associated people diseases. Paper presented at the Bird Control Seminars Proceedings. Available at: https://digitalcommons.unl.edu/cgi/viewcontent.cgi?article=1020&context=icwdmbirdcontrol

_513

To cite this paper: Bupasha ZB, Begum R, Karmakar S, Akter R, Bayzid M, Ahad A and Sarker MS (2021). Multidrug-Resistant Salmonella spp. Isolated from Apparently Healthy Pigeons in a Live Bird Market in Chattogram, Bangladesh. World Vet. J., 10 (4): 508-513. DOI: https://dx.doi.org/10.54203/scil.2020.wvj61