CC BY
17DOI: https://doi.org/10.21323/2414-438X-2023-8-2-112-123
Received 26.12.2022 Accepted in revised 20.05.2023 Accepted for publication 23.05.2023
Available online at https://www.meatjournal.ru/jour Original scientific article Open Access
SALMONELLA ENTERICA SPECIES ISOLATED FROM LOCAL FOODSTUFF AND PATIENTS SUFFERING FROM FOODBORNE ILLNESS: SURVEILLANCE, ANTIMICROBIAL RESISTANCE AND MOLECULAR DETECTION
Zahraa A. AlShaheeb1, Zaid A. Thabit2*, Asma G. Oraibi3, Ahmed A. Baioumy4, Tarek Gamal Abedelmaksoud4
1 Iraqi Ministry of Health, Baghdad, Iraq 2 Environmental Biotech Department, Biotechnology Research Center, Al-Nahrain University, Baghdad, Iraq 3 Plant Biotechnology Department, College of Biotechnology, Al-Nahrain University, Baghdad, Iraq 4 Food Science Department, Faculty of Agriculture, Cairo University, Giza, Egypt
Keywords: foodborne pathogen, frozen chicken meat, azithromycin resistance gene mphA.
Abstract
The aim of this study was to determine the prevalence of Salmonella enterica in raw chicken meat, eggs, and ready-to-eat foods containing poultry products and among patients suffering from diarrhea as a result of ingestion of this foodborne pathogen in Baghdad, Iraq. It assesses the antibiotics susceptibility, virulence and pathogenicity of S. enterica isolates. Thirteen Salmonella spp. isolates from foodstuff and seven from clinical patients were recovered from 80 and 20 samples, respectively. Isolates from foodstuff samples displayed the highest resistance to nalidixic acid (69.23%), followed by chloramphenicol (53.84%). Salmonella spp. isolated from clinical samples showed resistance to both azithromycin and cefotaxime at the same percentage level (71.42%). The results of antibiotic resistance gene amplification (gyrA, mphA) were analyzed and showed that these genes were present in 100% and 50% of phenotypically resistant isolates, respectively. Virulence genes invA, avrA, and sipB were found on average in 86% of food isolates, accounting for 69.2%, 92.3%, and 95%, respectively. In addition, the detection of these virulence genes among clinical isolates showed their presence at the same level (85.7%). Our study revealed that unhygienic chicken slaughterhouses and lack of food safety management are strong indicators of a high probability of the Salmonella presence in our food products in the Iraqi markets.
For citation: AlShaheeb, Z., A., Thabit, Z.A., Oraibi, A.G., Baioumy, A.A., Abedelmaksoud, T.G. (2023). Salmonella enterica species isolated from local foodstuff and patients suffering from foodborne illness: Surveillance, antimicrobial resistance and molecular detection. Theory and Practice of Meat Processing, 8(2), 112-123. https://doi.org/10.21323/2414-438X-2023-8-2-112-123
Introduction
The World Health Organization (WHO) has stated that foodborne diseases remain a significant problem and can
show severity among children, the elderly, and people with
immunosuppression [1]. More than 250 different food-borne illnesses are caused by various microbial pathogens and toxins [2], poisonous chemicals, or bio-toxins. Salmonella infections are a critical epidemiological and economic problem worldwide [4,5]. For example, the European
Food Safety Authority (EFSA) reports that Salmonella spp.
is recognized to be the second most common cause of human diseases and food poisoning associated with contaminated food [6]. Salmonella is a genus of gram-negative bacteria that belongs to the Enterobacteriaceae family and can infect various animal hosts [7]. Moreover, Salmonella can survive under harsh conditions for about a year in frozen meat [8]. Salmonella exists in different environments such as soil, water systems, sewage, and the gut flora of several animals [9]. The members of the genus Salmonella are categorized on the basis epidemiology, host range, biochemical reactions, and structures of the O, H, and Vi antigens [10]. Salmonella, according to their DNA relativeness, can be classified into two species; S. bongori, which populates
cold-blooded animals, and S. enterica, which is able to inhabit both cold and warm-blooded hosts [11]. Strains belonging to S. enterica subsp. enterica are responsible for almost 99% of Salmonella infections in people and warmblooded animals [12].
Antimicrobial drugs are utilized to prevent microbial infectious diseases in both humans and animals [7] as well as in animal feed for prophylaxis, therapeutics, and growth promotion [13]. The antimicrobial resistance of Salmonella, particularly multidrug resistance (MDR), has become a significant worldwide problem [14]. For example, more recently, S. enterica in food-producing animals has shown high MDR resulting in a global problem due to the widespread use of antibiotic drugs [13]. The excessive use of the same antibiotic drugs as a treatment in clinical and veterinary medicine may lead to emergence of resistant strains that can easily be transmitted to the human population from animal products, which is a serious public health problem/concern [15-17]. In Iraq, there is currently a widespread lack of food safety aspects including domestic production of poultry and its products, as well as restaurants and this is leading to the increased risk of exposure to Salmonella infection. In Baghdad and central
Copyright © 2023, AlShaheeb et al. This is an open access article distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons. org/licenses/by/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material for any purpose, even commercially, provided the original work is properly cited and states its license.
Iraq, non-typhoidal Salmonella was indicated as the second cause of gastroenteritis in children after enteric viruses [18]. Non-typhoidal Salmonella was recovered from 10.3% of diarrheal stool samples from children under the age of 5 years in a recent study in southern Iraq [18]. To our knowledge, there have been no published studies on the molecular epidemiology of non-typhoidal Salmonella isolated from local hens in Iraq. Given the importance of this pathogen to worldwide health, the current study presents an evaluation of the molecular detection of virulence and antibiotic resistance genes of Salmonella enterica from Iraqi foodstuff. We focused on three virulence genes of the SPI-1 region involved in Salmonella pathogenicity (avrA, invA, and sipB), which play a critical role in the initial invasion of the host organism and cause salmonellosis infection as previously mentioned in [19-21]. Therefore, the aim of this study was to determine the prevalence of Salmonella enterica in raw chicken meat, eggs, and ready-to-eat foods containing poultry products and in patients suffering from diarrhea as a result of ingestion of this foodborne pathogen in Baghdad (Iraq). It assesses the antibiotic susceptibility as well as virulence and pathogenicity.
Materials and methods
Sample collection
From October 2020 to May 2021, one hundred samples were collected in Baghdad, including 80 samples of Iraqi raw and ready-to-eat food from eight processing points (frozen whole 9-piece chicken = 10; frozen chicken breasts = 10; frozen chicken thighs = 10; eggshell = 10; cooked chicken shawarma = 10; cooked chicken tika = 10; ready-to-eat cake cream = 10; food appetizers containing chicken derivatives = 10) from local supermarkets, and 20 samples from clinically suspected patients with foodborne diseases from private medical laboratories.
Salmonella isolation
Bacteria were isolated according to the ISO 6579-1:2017(E) procedure [22]. An analytical unit of 25 grams from each food sample chopped finely and fecal samples from patients taken with sterilized cotton swabs were inoculated into sterile flasks with 225mL of Buffered Peptone Water (BPW) broth (Himedia, India). The flasks were incubated at 37 °C for 18 hours. An amount of 0.1mL from pre-enriched culture was transferred to 10ml of Rappaport Table 1. PCR conditions of this study
Vassiliadis (RV) broth medium (Himedia, India), thoroughly mixed and incubated at 41 ± 0.5 °C for 24 hours. A loopful from the incubated selective enrichment broth culture was streaked on Xylose Lysine Deoxycholate (XLD) agar plate and Salmonella-Shigella (SS) agar (Himedia, India). Both agar plates were incubated at 37 °C for 24 hours.
Salmonella identification
Suspected colonies with Salmonella morphology from each plate were identified biochemically using the VITEK-2 system (bioMerieux, France). In addition, isolates were investigated by the conventional method in the Iraqi National Centre for Salmonella at the Central Public Health Laboratories in Baghdad using the serological test (Anti-Salmonella H test) (Sifin/ Germany) kits that were designed for the use in examining the H-antigens of Salmonella strains via slide agglutination in Baghdad's Central Public Health Laboratory (CPHL). Bacteria from 16-20-hour-old subculture (nutrient) agar were applied to a clean microscope slide and mixed well with a drop of 25^l of anti-Salmonella H reagent (test serum), then slowly stirred with a sanitized stick. The slide was put on a dark surface and visible agglutination was observed in the case of the positive reaction, while a negative result was seen as a homogeneous milky turbid suspension. On the same slide, the positive and negative controls were tested in the same way. Typical Salmonella phenotypes were further confirmed by single-step PCR for the 16S rRNA gene of S. enterica [23].
Genomic DNA extraction
Extraction of DNA was carried out as recommended by the manufacturer of the HiPer® Bacterial Genomic DNA Extraction Teaching Kit (Solution Based), India.
16S rRNA gene direct sequencing
Conventional PCR was carried out to analyze all the genes of this study, the confirmatory 16S rRNA gene (621bp) was amplified by using GoTaq® G2 Green Master Mix (Promega, USA). PCR conditions in this study and primer design were used as shown in Tables 1 and 2. Purified PCR products (45^L) from the identified 16S rRNA gene target were forwarded to Macrogen comp. (Korea) for DNA sequencing. Then, using the BioEdit and Mega7 software, consensus sequences were created by aligning the forward and reverse DNA sequences for each sample. In addition, the final sequence from each sample was
Gene name Step conditions 16S rRNA invA avrA sipB mphA gyrA
1 CYCLE Initial denaturation 95 °C, 5 min 94 °C, 5 min
Denaturation 94 °C, 40 sec 94 °C, 30 sec
30 CYCLE Annealing 60 °C 56 °C 58 °C 60 °C 58 °C 58 °C, 30 sec
40 secs
Extension 72 °C, 40 sec 72 °C, 30 sec
1 CYCLE Final extension 72 °C, 5 min 72 °C, 10 min
— Holding 4 °C, 10 min 4 °C, 10 min
further analyzed by searching for similar matches in the NCBI gene bank database. This was achieved by employing the BLAST website tool, the BLAST search to assess the similarity.
Table 2. Primers used in PCR amplification
'Si
.O
Gene name
16S rRNA invA avrA sipB mphA gyrA
Primer sequences (5'^3')
F primer: GGAACTGAGACACGGTCCAG R primer: CCAGGTAAGGTTCTTCGCGT F primer: TTGTTACGGCTATTTTGACCA R primer: CTGACTGCTACCT TGCTGATG F primer: CCTGTATTGTTGAGCGTCTGG R primer: AGAAGAGCTTCGTTGAATGTCC F primer: GGACGCCGCCCGGGAAAAACTCTC R primer: ACACTCCCGTCGCCGCCTTCACAA F primer: GTGAGGAGGAGCTTCGCGAG R primer: TGCCGCAGGACTCGGAGGTC F primer: TGGGCAATGACTGGAACA R primer: GGTTGTGCGGCGGGATA
e eR
671 [23]
521 [24]
425 [25]
875 [26]
403 [27]
396 [28]
Antimicrobial susceptibility test
The disk diffusion method described by the Clinical and Laboratory Standards Institute (CLSI) [29] was chosen to test antibiotic resistance of Salmonella isolates. Ten antimicrobial agents (Bioanalysis, Turkey) were selected from several family groups according to [29], and tested against Salmonella isolates: phenicols (chloramphenicol, 30^,g), aminoglycosides (gentamicin, 10^g), quinolones (nalidixic acid, 30^,g), carbapenems (meropenem and imipenem, 10^,g), fo-late pathway antagonists (trimethoprim-sulfamethoxazole, 30^,g), macrolides (azithromycin, 15^,g), cephalosporins (ceftazidime and cefotaxime, 30^,g), and fosfomycins (fos-fomycin, 200^g). Escherichia coli ATCC25922 was used as a quality control strain. The isolates were described as susceptible, intermediate, or resistant according to the CLSI [29] guidelines. An isolate was defined as multi-drug resistant (MDR) when showing resistance to three or more different classes of antimicrobials [30].
Detection of virulence and antimicrobial
resistance genes
The virulence genes invA (521bp), avrA (425bp), sipB (875bp), and the quinolone resistance gene gyrA (396bp), macrolide azithromycin resistance gene mphA (403bp) were analyzed in isolates that showed resistance to these two antimicrobials only. Bioneer's master mix (Bioneer's AccuPower PCR PreMix, Korea) was used for amplification. PCR conditions performed in this study and primer design were used as shown in Table 1 and Table 2.
Gel electrophoresis
The agarose powder (1 percent% w/v) was dissolved in 1X TBE buffer. The mixture was microwaved and allowed
to cool at 50 °C before adding 8|l of RedSafe™ (iNtRON/ Korea) (0.5 g/ml) to the agarose solution and pouring it onto the tray. After the gel hardened, the comb was removed.
Results
Occurrence of Salmonella spp.
Among 100 collected samples, 20 isolates (20%) were culture positive for Salmonella spp. Within the food sample groups, Salmonella spp. was isolated from 16.25% of samples (13 out of 80 food samples), all of which were collected from raw poultry meat and egg groups, whilst the other food groups were Salmonella free. Raw frozen chicken breasts had the highest level of contamination with Salmonella spp. (60%) followed by raw frozen chicken thighs (40%), raw frozen 9-piece chicken (20%), and eggshell (10%). As regards clinical diarrheal patients, Salmonella spp. was isolated from 7 (35%) out of 20 samples. The S. enterica isolates from food products identified in this study were S. enterica serovar Typhimurium (11 isolates, 84.6%) isolated from raw frozen 9-piece chicken (2 isolates, 15.3%), raw frozen chicken breasts (5 isolates, 38.4%), and raw frozen chicken thighs (4 isolates, 30.7%), S. enterica subsp. enterica (one isolate from eggs, 7.6%), and S. enterica subsp. diarizonae (one isolate from raw frozen chicken breasts, 7.6%). S. enterica serovar Typhi (4 isolates, 57.1%), and S. enterica serovar Typhimurium (3 isolates, 42.8%) were isolated from human diarrheal patients as shown in Table 3. The percentage of each serovar identified in this study is presented in diagrams (Figure 1A and Figure 1B).
Table 3. Identified isolates and their sources
o N
la
lo
s
1
2
3
4
5
6
7
8
9
10 11 12
13
14
15
16
17
18
19
20
Source of isolates
Whole raw frozen 9- piece chicken
Raw frozen chicken breasts
Raw frozen chicken thighs
Egg shell
Diarrheal human patients
Type of species
S. enterica serovar Typhimurium S. enterica serovar Typhimurium
S. enterica subsp. diarizonae S. enterica serovar Typhimurium S. enterica serovar Typhimurium S. enterica serovar Typhimurium S. enterica serovar Typhimurium S. enterica serovar Typhimurium S. enterica serovar Typhimurium S. enterica serovar Typhimurium S. enterica serovar Typhimurium S. enterica serovar Typhimurium S. enterica subsp. enterica S. enterica serovar Typhi S. enterica serovar Typhi S. enterica serovar Typhi S. enterica serovar Typhi S. enterica serovar Typhimurium S. enterica serovar Typhimurium S. enterica serovar Typhimurium
■ S. enterica serovar Typhimurium I S. enterica subsp. diarizonae
■ S. enterica subsp. enterica
Figure 1A. Percentage of S. enterica serovars identified in raw food samples
As shown in Figures 1A and 1B, the most frequently identified serovars were S. enterica serovar Typhimurium (85%) and S. enterica serovar Typhi (57%) in raw food and clinical samples, respectively. The confirmatory molecular analysis indicated that all isolates (100%) had the 16S rRNA gene of Salmonella.
Sequencing analysis results
Several changes in nucleotide sequences were observed in isolates A4, A7, A13, A16, A17, and A19. There was approximately a maximum of 14 differences in base pairs as shown in Figure 2. With the presence of such polymorphisms, differences between isolates belonging to different subspecies and serovars were found.
During the further analysis for bacterial classification and detection of similarity in Figure 2, four clusters of bacterial strains were identified with reference strains. Two of them included AB680591.1 and MZ773245.1, and the other two included isolates A1 and A10. Each of them contained bacterial isolates with the highest similarity and the lowest genetic distance.
Differentiation of the reference strains from those of other serovars and subspecies was carried out as illustrated in Figure 3. It shows that isolates A11, AA2, A1, A8, A20, A12, A5, MZ773245.1, A4, A7, A17, A16, A13, A19, A6, A9, A10, A15, and A18 are more related to strain AB680591.1
43%
1
57% ▼
I S. enterica serovar Typhimurium | S. enterica serovar Typhi
Figure 1B. Percentage of S. enterica serovars identified in clinical human diarrheal samples
Table 4. Alignment of partial 16S rRNA gene sequences of Salmonella spp. bacteria under consideration with the sequence of the NCBI database
Isolate no. Result of strain sequencing Similarity
A1 100%
A2 100%
A3 A4 S. enterica serovar Typhimurium 100% 99.53%
A5 100%
A6 100%
A7 S. enterica subsp. enterica 100%
A8 S. enterica serovar Typhimurium 99.50%
A9 S. enterica serovar Typhi 100%
A10 S. enterica serovar Typhimurium 99.84%
A11 100%
A12 S. enterica serovar Typhi 100%
A13 99.05%
A14 100%
A15 100%
A16 A17 S. enterica serovar Typhimurium 98.73% 98.69%
A18 100%
A19 100%
0.0
Figure 2. 16S rRNA gene sequence alignment of S. enterica isolates with the related reference sequence of the 16S rRNA gene by BioEdit software. Ref= Reference sequences of the 16S rRNA gene of S. enterica strains AB680591.1 S, X80681.1 S. t, and MZ773245.1 S (wild type). The black sign "A" denotes the names of isolates given in Table 4
Figure 3. Phylogenetic tree of 16S rRNA gene sequences alignment of S. enterica spp. isolates with the related reference sequence of the 16S rRNA gene
and belong to different S. enterica serovars while isolates A14 and A13 belonging to S. enterica serovar Typhimurium have high similarity to X80681.1 as a common ancestor.
Additionally, the obtained data presented in Table 4 demonstrate the similarity (98-100%) of the isolated bacteria by the 16S rRNA gene, and show that the expected value (e-value) for all Salmonella spp. isolates was zero.
Antimicrobial susceptibility test
Antimicrobial susceptibility testing of Salmonella enterica in this study showed that all isolates tested except one were resistant to one antibiotic at least as shown in Table 5.
In general, the most effective antimicrobials against Salmonella isolated from food samples were imipenem (100%), cefotaxime, meropenem and ceftazidime (69.2% each). The highest resistance of all 13 isolates was recorded for nalidixic acid (69.23%), followed by chlorampheni-col (53.84%), gentamicin (46.15%), trimethoprim-sulfa-methoxazole (46.1%), fosfomycin (46.1%), and azithro-
mycin (38.46%), whilst resistance to both cefotaxime and meropenem was 30.7% as shown in Table 6.
Different Salmonella serovars/subspecies tested in this study showed different levels of resistance. It was revealed that 63.63% (7/11) of isolates of S. enterica serovar Typhimurium recovered from food were resistant to na-lidixic acid and chloramphenicol. Lower resistance was recorded for trimethoprim-sulfamethoxazole and genta-micin, which had the same percentage of 45.45% (6/11), followed by meropenem, cefotaxime, and azithromycin with the same proportion of 36.36% (4/11). Imipenem and ceftazidime were found to be effective antimicrobials against food isolates of S. enterica serovar Typhimurium (100% and 76.93%, respectively).
All food isolates (100%) of S. enterica subsp. enterica (n = 1) and S. enterica subsp. diarizonae (n = 1) were susceptible to meropenem, ceftazidime, cefotaxime, and chlor-amphenicol. Only S. enterica subsp. diarizonae showed high resistance (100%) to azithromycin, trimethoprim-sulfamethoxazole, gentamicin, nalidixic acid, and fosfo-
Table 5. Antibiotic resistance of each isolate to ten antibiotics chosen according to CLSI [29]
sample Name of serovar/subspecies NA SXT C CTX AZM MEM IPM CN CAZ FOS
1 S. enterica serovar Typhimurium SSSRSRSRRS MDR
2 S. enterica serovar Typhimurium SSSRSSSSSS —
3 S. enterica serovar Typhimurium SSSSSSSSSS —
4 S. enterica serovar Typhimurium SSRSSSSSSR —
5 S. enterica serovar Typhimurium RRRRRRSRRR MDR
6 S. enterica serovar Typhimurium RRSSSRSSSS MDR
7 S. enterica subsp. diarizonae RRRSRS SRSR MDR
8 S. enterica serovar Typhimurium RSSSSSSSSS —
9 S. enterica serovar Typhimurium RRRSSSSSSR MDR
10 S. enterica serovar Typhimurium RRRRRRSRRS MDR
11 S. enterica serovar Typhimurium RSRSRSSRSS MDR
12 S. enterica serovar Typhimurium RRRSRS SRSR MDR
13 S. enterica subsp. enterica RSSSSSSSSS —
14 S. enterica serovar Typhi SRSRS S SRRR MDR
15 S. enterica serovar Typhi RSIRRSSSSS MDR
16 S. enterica serovar Typhi RSRRSSSSSS MDR
17 S. enterica serovar Typhi IRI SRSRRSS MDR
18 S. enterica serovar Typhimurium RSSRRSSI SR MDR
19 S. enterica serovar Typhimurium SRRSRRS SRS MDR
20 S. enterica serovar Typhimurium RSSRRSSIRS MDR NA: nalidixic acid; SXT: trimethoprim/sulfamethoxazole; C: chloramphenicol, CTX: cefotaxime; AZM: azithromycin; MEM: meropenem; IPM: imipenem; CN: gentamicin; CAZ: ceftazidime; FOS: fosfomycin; S: susceptible; I: intermediate; R: resistant; MDR: multidrug-resistant
mycin. S. enterica subsp. enterica showed high levels of resistance (100%) to nalidixic acid and high levels of susceptibility (100%) to gentamicin.
Regarding human isolates, the results obtained indicate that in general isolates (S. enterica serovar Typhi (n = 4) and S. enterica serovar Typhimurium (n = 3)) recovered from the diarrheal patient samples were resistant to azithromycin and cefotaxime showing the same percentage (71.42%; 5/7), while imipenem and meropenem were the ultimate effective antibiotics with the same proportion of susceptible isolates (85.7%; 6/7) as shown in Table7.
As for Salmonella serovars, S. enterica serovar Typhimurium (n= 3) isolates were completely susceptible (100%) to imipenem, followed by meropenem, fosfomycin, cefo-taxime and chloramphenicol with the same proportion (66.67%, 2/3). However, they showed resistance to trimethoprim-sulfamethoxazole, nalidixic acid, and ceftazidime
Table 6. Percentage of food isolates of Salmonella spp. resistant, intermediate and susceptible to antibiotics
with the same proportion (66.67%, 2/3). The resistance to gentamicin was intermediate (66.67%, 2/3).
S. enterica serovar Typhi (n = 4) isolates exhibited intermediate resistance to chloramphenicol (50%; 2/4). Moreover, they showed resistance to trimethoprim-sulfon-amide, nalidixic acid, azithromycin, and gentamicin, all of which had the same ratio (50%; n = 2/4). The highest susceptibility (100%) was observed for meropenem followed by ceftazidime, fosfomycin, and imipenem with the same proportion of 75% (3/4). S. enterica serovar Typhi was resistant (75%; 3/4) to cefotaxime.
All isolates except for five isolates from food samples (one from eggshell and four from frozen raw chicken breasts) exhibited multidrug resistance to > 3 antibiotics as shown in Table 5.
This study illustrates a high proportion (77.7%) of food isolates of S. enterica serovar Typhimurium (n = 7) consid-
Table 7. Percentage of clinical Salmonella spp. isolates resistant, intermediate and susceptible to antibiotics
Antibiotics Food Isolates No. Resistant (%) Intermediate (%) Susceptible (%)
Nalidixic acid (NA) 13 69.2% 0% 30.7%
Trimethoprim/ Sulfamethoxazole (SXT) 13 1 i 46.1% tZ~Z QOL 0% AO/. 53.8% Ais. 1 0/.
Chloramphenicol (C) Cefotaxime (CTX) 13 13 1 i 53.8% 30.7% ^Q /10/. 0% 0% AO/. 46.1% 69.2% /£1 CO/.
Azithromycin (AZM) Meropenem (MEM) 13 13 1 2 38.4% 30.7% nn/ 0% 0% nn/ 61.5% 69.2% i nno/
Imipenem (IPM) Gentamicin (CN) Ceftazidime (CAZ) 13 13 13 0% 46.1% 30.7% 0% 0% 0% 100% 53.8% 69.2%
Fosfomycin (FOS) 13 46.1% 0% 53.8%
Antibiotics Clinical Isolates No. Resistant (%) Intermediate (%) Susceptible (%)
Nalidixic acid (NA) 7 57.1% 14.2% 28.5%
Trimethoprim/ Sulfamethoxazole (SXT) 7 42.8% 0% 57.1%
Chloramphenicol (CAM) 7 28.5% 28.5% 42.8%
Cefotaxime (CTX) 7 n 71.4% *71 A OA. 0% AO/ 28.5% OQ CO/.
Azithromycin (AZM) Meropenem (MEM) 7 7 n /1.4% 14.2% 1 4 10/ 0% 0% t\ 0/ 28.5% 85.7% or »70/
Imipenem (IPM) Gentamicin (GEN) 7 7 n 14.2% 28.5% AI QO/ 0% 28.5% no/ 85.7% 42.8% C7 1 OA.
Ceftazidime (CAZ) Fosfomycin (FOS) 7 7 42.8% 28.5% 0% 0% 57.1% 71.4%
ered multidrug resistant (MDR). Two isolates were resistant to three antibiotic groups, two isolates were resistant to four antibiotic groups, one isolate was resistant to six antibiotic groups and two isolates were resistant to eight antibiotic groups as shown in Table 8. All (100%) clinical isolates of S. enterica serovar Typhimurium (n = 3) were MDR: one isolate was resistant to three antibiotic groups, one isolate was resistant to four antibiotic groups and one isolate was resistant to five antibiotic groups as shown in Table 8.
Table 8. MDR of food and clinical isolates of S. enterica serovar Typhimurium
s p u о Food isolates Clinical diarrheal isolates
ад ib (n= 7) (n= 3)
bor ic
imi § f o .o Ï5 Antimicrobial resistance patterns No. of isolates (%) Antimicrobial resistance patterns No. of isolates (%)
e r
Quinolones (NA), Sulfa drug)SXT(, Carbapenem (MEM). Cephems (CTX, CAZ), Carbapenem (MEM), Gentamycin (CN).
Quinolones (NA), Sulfa drug)SXT(. Chloramphenicol (C), Fosfomycin (FOS). Quinolones (NA), Chloramphinical (C), Macrolides (AZM), Gentamycin (CN).
vi
№
2 Quinolones (NA), ^ Cephems (CTX, CAZ), (14.,Ä%) (28.56%) Macrolides (AZM). (1428%)
Quinolones (NA), 2 Chloramphenicol (C), 1 (28.56%) Macrolides (AZM), (14.28%) Fosfomycin (FOS).
Cephems (CAZ), Carbapenem (MEM), i Chloramphenicol (C), ( % Macrolides (AZM), (14.280) Sulfa drug (SXT(.
Quinolones (NA),
Chloramphenicol (C),
% Fosfomycin (FOS) 1
Й Carbapenem (iPM), (14.28%)
Macrolides (AZM),
Sulfa drug)SXT(.
h
gi iE
Cephems (CAZ, CTX), Carbapenem (MEM), Chloramphenicol (C), Macrolides (AZM), Sulfa drug (SXT(, Gentamycin (CN), Quinolones (NA), Fosfomycin (FOS). Cephems (CAZ, CTX), Carbapenem (MEM), Chloramphenicol (C), Macrolides (AZM), Sulfa drug (SXT), Gentamycin (CN), Quinolones (NA), Fosfomycin (FOS).
2
(28.56%)
Antibiotic resistance gene detection
in S. enterica isolates
The fluoroquinolone resistance gene (gyrA) was associated with all fluoroquinolone (nalidixic acid) resistant isolates (16/16). All nine resistant isolates recovered from food (S. enterica serovar Typhimurium, n = 7; S. enterica subsp. enterica, n = 1; S. enterica subsp. diarizonae, n = 1) and all seven resistant clinical isolates (S. enterica serovar Typhi, n = 4; S. enterica serovar Typhimurium, n = 3) showed the presence of the gyrA gene. The azithromycin resistance gene (mphA) was associated with about half of the macrolide (azithromycin) resistant isolates (n = 6/10). The mphA gene was detected in four resistant isolates recovered from food (S. enterica serovar Typhimurium, 3/4; and S. enterica subsp. diarizonae; 1/1) with the proportion equaled 75% and 100%, respectively. Among resistant clinical isolates, 2 out of 5 isolates showed the presence of the mphA gene (S. enterica serovar Typhi,1/2; S. enterica serovar Typhimurium; 1/3), which accounted for 50% and 33.33%, respectively.
Virulence gene detection in S. enterica isolates
The invA gene was revealed in 75% (15/20) of all Salmonella isolates. Among food isolates, invA was found in 9 out of 13 (69.2%) S. enterica isolates. Detection of this gene gave negative results in four isolates, including three isolates from raw frozen chicken breasts and one isolate from raw whole 9-piece chicken. All these four negative isolates belonged to S. enterica serovar Typhimurium. So, the proportion of invA gene detection was 63.6% (7/11) for S. enterica serovar Typhimurium isolates, whilst it was 100% for both S. enterica subsp. enterica (1/1) and S. enterica subsp. diarizonae (1/1). The avrA virulence gene was detected in 90% (18/20) of all Salmonella isolates. Among food isolates, avrA was detected in 12 out of 13 isolates (92.3%). Only one isolate of S. enterica subsp. enterica from eggshell showed a negative result of avrA gene detection. S. enterica serovar Typhimurium and S. enterica subsp. dia-rizonae showed a positive result of avrA gene detection in all isolates (100%) from local raw poultry meat. The sipB virulence gene was found in 95% (19/20) of all Salmonella isolates. Regarding local raw poultry meat and eggshell, the sipB gene was detected in all (100%) isolates of S. enterica serovar Typhimurium, S. enterica subsp. diarizonae, and S. enterica subsp. enterica.
All these virulence genes were detected in 85.7% (6/7) of clinical isolates. The proportion of clinical isolates of S. enterica serovar Typhi positive for these genes was 25% (1/4).
Discussion
To the best of our knowledge, this work is one of the first studies interested in the Salmonella prevalence in food and clinical samples in Iraq. The results of Salmonella isolates are approximate, with various studies done in many areas in Iraq between 2008 and 2017, with percentage of Salmonella isolation ranging from 1.07% to 16%. The great-
est proportion was recorded in Al-Hawijah, while the lowest percentage was recorded in Mosul [31-37].
Different studies on Salmonella prevalence were carried out in several countries. In [38] performed in China, Salmonella spp. were isolated from 249 out of 664 (37.5%) samples, including 190 (36.7%) chicken, 48 (40.7%) duck and 11 (39.2%) pigeon samples. Salmonella prevalence of 13.4% was documented by Rabby [39] in poultry meat retailed in wet- and super-markets in Dhaka city, Bangladesh. Salih et al. [40] examined the distribution of Salmonella spp. in 121 specimens from diarrheal patients in Duhok, Iraq, and showed that 72 isolates (59.5%) belonged to Salmonella spp. Sadeq et al. [41] analyzed 40 chicken samples, and found that 14 isolates (35%) belonged to S. enterica serovar Typhimurium with the presence of the invA gene in 11 (78.5%) out of 14 isolates of S. enterica serovar Typhimurium. These results are almost identical to the results of our study since we recorded the presence of seven food isolates of S. enterica serovar Typhimurium positive for the invA gene with a proportion of 53%. A recent study in Babil, Iraq, was carried out by Obayes et al. [42] who collected samples from 120 children with diarrhea and revealed that 58 samples were positive for different Salmonella spp. The most common serovar of Salmonella enterica in their study was Salmonella enterica serovar Typhi (29.3%) and this result agrees with the result of our study, which indicates the presence in the clinical human diarrheal samples of four isolates (57.1%) of S. enterica serovar Typhi as the most common serovar.
The most common serovars transferred from animals to humans are Salmonella Enteritidis and Salmonella Ty-phimurium. Typhoid fever, paratyphoid fever, food poisoning and gastroenteritis are all disorders caused by Salmonella [43]. The 16S rRNA gene sequence is considered an important approach toward identification of bacterial genus, species, and sub-species, and was used in this study as a confirmatory detection test. It is unique for each bacterial organism and can be considered a unique identification gene for bacterial species.
In general, the reasons for Salmonella spp. contamination detected in this study are the lack of HACCP control and due diligence. The Iraqi Central Organization for Standardization and Quality Control (COSQC, document No. 2270) indicates that the percentage of Salmonella growth should be zero in chicken cuts (thighs, breasts, wings), and for this reason the problem of the absence of quality control, HACCP and food handling instructions have to be dissolved and they should be applied in Iraqi slaughterhouses along the poultry processing chain until reaching consumers to prevent an increase in foodborne diseases as much as possible.
Concerning nalidixic acid, other studies also documented Salmonella resistance to this antimicrobial agent, and the resistance increased significantly (94.1%) in 2021 compared with the 2018 report (77.3%) indicating more applications of nalidixic acid in both veterinary medicine
and human medicine fields [44, 45]. As for other antibiotics, a study conducted in Bangladesh reported that 95% of the isolates were resistant to azithromycin [46], another study reported low resistance (8%) to chloramphenicol [47]. In [48] 12% of Salmonella isolates were resistant to azithromycin and 1% to chloramphenicol, whereas the present study recorded much higher resistance to azithro-mycin and chloramphenicol compared to previous studies.
In comparison with [49], the partial similarity was noticed, particularly, the susceptibility of the isolates to imipenem. Resistance to SXT was higher in the present study than in [49], which recorded 31.3%, while the study by Velez [50] displayed that Salmonella isolates showed higher resistance (100%) to gentamicin than in our study. Moreover, in the current study, nine isolates were resistant to cefotaxime (approximately 30.7%), which is higher than the result reported in China by [14] where 2.44% of Salmonella isolates were found to be resistant to cefotaxime.
On other hand, resistance to ceftazidime, meropenem, and fostomycin was in the same line with an Iraqi study [51]. Antibiotic-resistant bacteria can cause life-threatening infections in people and constitute a serious danger to public health and wellbeing. Furthermore, the use of antimicrobials in veterinary medicine may increase the emergence of resistant bacteria harmful to humans and posing a possible threat to public health from zoonotic pathogens, such as Salmonella. As a result, the high resistance/MDR in human isolates of Salmonella spp. to antibiotics may be caused not by the misuse of drugs and their wrong consumption, but rather this resistance transfers through consumption of foods (e. g., poultry meat) from food-producing animals that received antibiotics on farm to enhance and promote their quality and prevent the growth and transmission of microbes.
Bacteria may acquire resistance genes via mobile genetic elements such as plasmids, which provide the flexibility to a host bacterium and aid in the dissemination and dispersion of these genes among various bacterial populations [52]. In our study, the gyrA and mphA genes conferring resistance to nalidixic acid and azithromycin, respectively, were detected among isolates that showed the phenotypic resistance. Similarly, there were high percentages of the gyrA genes found in nalidixic acid resistant Salmonella Albany (92%), Salmonella Corvallis (75%), and Salmonella Kentucky (85%) isolated in chicken food chains in Cambodia [53].
Quinolones with a broad spectrum of activity have a greater ability to inhibit gyrase in gram-negative bacteria. According to the researchers, antibiotic resistance in Salmonella spp. is mostly caused by mutations within the quinolone resistance-determining regions (QRDRs) of the target enzymes DNA gyrase (gyrA and gyrB) and topoi-somerase IV (parC and parE) [54].
Wang et al. [28] identified the mphA gene in 15 out of 31 azithromycin-resistant Salmonella isolates. This is partially similar to the results of our study. Azithromycin is an
azalide antibacterial drug, which was shown to be equal to chloramphenicol, fluoroquinolones, and extended-spectrum cephalosporins for the treatment of uncomplicated typhoid fever [55]. The mphA gene is the key gene involved in Salmonella resistance to the macrolide azithromycin. It is typically found on plasmids and spreads rapidly, posing a significant threat to current Salmonella infection therapy [56].
Salmonella employs several virulence factors expressed at various phases of the disease process to develop a successful infection. A number of these parameters are linked to Salmonella Pathogenicity Islands (SPIs) on the Salmonella chromosomes [57]. The virulence invA gene is involved in Salmonella pathogenicity. The invA gene acts as a unique biomarker for Salmonella identification [58]. Previous studies [59-62] show that the invA gene has been found in 100% of Salmonella strains, whilst, our study recorded a lower percentage (75%). Likewise, other authors, such as Mthembu et al. [21], revealed lower rates (54.4%; 106/195) and Somda et al. [63] showed the presence of the invA gene in 91% (52/57) of non-typhoidal Salmonella isolates from human diarrhea, environment, and lettuce samples in Burkina Faso. Furthermore, Nikiema et al. [64] found that the invA gene was present in 67% (61/91) of clinical isolates and 60% (9/15) of sandwich samples. In our study, 25% of Salmonella isolates did not harbor the invA gene and hence would be unable to invade host cells. Salih and Yousif [65] conducted a study in Iraq to detect five virulence factors among four isolates of S. enterica serovar Typhimurium isolated previously from three puppies and one adult dog and reported that the invA gene was detected in two isolates only. In the same line, another Iraqi study showed that the invA gene was detected among eight Salmonella strains with a proportion of 50% [66]. Therefore, Salmonella might be virulent (invA) or avirulent [67]. Furthermore, asymptomatic animals carrying either virulent or avirulent strains might be possible sources of transmission to humans through the food chain, as well as due to their close proximity to people and poor animal effluent management [21, 67]. All strains containing this invA gene, which encodes a protein found in bacterial inner membrane and is crucial for invasion of host epithelium, are pathogenic [68,69]. Moreover, a key component of the pathogen's virulence phenotype is the virulence-associated effector protein AvrA of Salmonella enterica, which blocks
the first line of defense of the host organism. AvrA expression increases the ability of the bacterium to invade the host [70,71]. Our study indicated that the avrA gene was revealed in 90% (18/20) of all Salmonella isolates. The other Iraqi researchers Jbar et al. [72] detected the avrA gene in 100% (30/30) of Salmonella enterica isolates. Similarly, an Egyptian study showed that all 6 (100%) Salmonella isolates carried the avrA gene [69]. This presence of the avrA gene in all isolates suggests a higher rate of gastroenteric illnesses in humans that may be transmitted from contaminated food. In addition, Hersh et al. [73] established the role of sipB in Salmonella-induced macrophage death, as well as the possible involvement of caspase-1 in this process. In our study, the sipB gene was found in 95% (19/20), while another Iraqi study [42] found that the sipB gene occurrence in Salmonella isolates was 18.9% (11/120).
Moreover, having regard to the serious roles of these three genes as illustrated briefly above and the outcome of our study, which shows the high occurrence of the invA, avrA, and sipB genes (75%, 90% and 95%, respectively), it is safe to assume that the severity of infections that may occur in the Baghdad population will be increasing.
Differences in the presence of virulence genes in bacterial isolates from this investigation and prior studies might be attributed to geographic circumstances, dietary variables, and the migration of virulence genes through integrons and transposons. In addition to plasmids, [74] indicated that conjugation is a crucial method for the transmission of virulence genes in bacterial groups. These virulence genes, despite their high pathogenicity, are still in circulation, but the variables, as well as the mechanisms of the asymptomatic carriage, are poorly understood. Nonetheless, certain variables, such as a decrease in virulence gene expression or even the expression of bacterial components unique to a carrier, might be blamed. These pathogenicity island-encoded genes are critical in various phases of Salmonella pathogenesis [75,76].
Conclusions
This study shows that Salmonella enterica exists in local chicken meat and eggshell with high resistance to antibiotics, including multidrug resistance (75%). In addition, it demonstrates high proportions of Salmonella enterica isolates positive for virulence genes (invA, sipB, avrA) responsible for initial invasion of the host cells.
REFERENCES
1. Cwiek, K., Korzekwa, K., Tabis, A., Bania, J., Bugla-Ploskoriska, G., Wieliczko, A. (2020). Antimicrobial resistance and biofilm formation capacity of Salmonella enterica serovar enteritidis strains isolated from poultry and humans in Poland. Pathogens, 9(8), Article 643. https://doi.org/10.3390/pathogens9080643
2. Pal, M., Ayele, Y. (2020). Emerging role of foodborne viruses in public health. Biomedical Research International, 5, 01-04.
3. Kawamoto, S., Bari, M. L. (2015). Emerging and re-emerging foodborne diseases: Threats to human health and global stability. Chapter in a book: Foodborne Pathogens and Food Safety. CRC Press, 2015.
4. EFSA (2020). The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2017/2018. EFSA, 18(3), Article 6007. https://doi.org/10.2903/j.efsa.2020.6007
5. Khalaf, Z. Z. (2018). Comparative study of antibiofilm activity of lime juice and lithium dioxide nanoparticles against Salmonella isolated from local cheese. Journal of Biotechnology Research Center, 12(2), 82-94. https://doi.org/10.24126/jo-brc.2018.12.2.542
6. ECDC. (2020). Salmonella the Most Common Cause of Foodborne Outbreaks in the European Union. Retrieved from
https://www.ecdc.europa.eu/en/news-events/Salmonella-most-common-cause-foodborne-outbreaks-european-union Accessed December 15, 2022
7. Jajere, S. M. (2019). A review of Salmonella enterica with particular focus on the pathogenicity and virulence factors, host specificity and antimicrobial resistance including multidrug resistance. Veterinary World, 12(4), 504-521. https://doi. org/10.14202/vetworld.2019.504-521
8. Muller, K., Aabo, S., Birk, T., Mordhorst, H., Bjarnadottir, B., Agerso, Y. (2012). Survival and growth of epidemically successful and nonsuccessful Salmonella enterica clones after freezing and dehydration. Journal of Food Protection, 75(3), 456-464. https://doi.org/10.4315/0362-028X.JFP-11-167
9. Rosenkrantz, J. T., Aarts, H., Abee, T., Rolfe, M. D., Knud-sen, G. M., Nielsen, M. -B. et al. (2013). Non-essential genes form the hubs of genome scale protein function and environmental gene expression networks in Salmonella enterica serovar Ty-phimurium. BMC Microbiology, 13(1), Article 294. https://doi. org/10.1186/1471-2180-13-294
10. Brooks, G. F., Butel, J. S., Morse, S. A. (2004). Cultivation of Microorganisms. Chapter in a book: Medical Microbiology. New York, Cenveo Publisher Services, 2004.
11. Tindall, B. J., Grimont, P. A. D., Garrity, G. M., Euzeby, J. P. (2005). Nomenclature and taxonomy of the genus Salmonella. International Journal of Systematic and Evolutionary Microbiology, 55(1), 521-524. https://doi.org/10.1099/ijs.0.63580-0
12. Brenner, F. W., Villar, R. G., Angulo, F. J., Tauxe, R., and Swam-inathan, B. (2000). Salmonella Nomenclature. Journal of Clinical Microbiology, 38(7), 2465-2467. https://doi.org/10.1128/ JCM.38.7.2465-2467.2000
13. Harb, A., Habib, I., Mezal, E. H., Kareem, H. S., Laird, T., O'Dea, M. et al. (2018). Occurrence, antimicrobial resistance and whole-genome sequencing analysis of Salmonella isolates from chicken carcasses imported into Iraq from four different countries. International Journal of Food Microbiology, 284, 84-90. https://doi. org/10.1016/j.ijfoodmicro.2018.07.007
14. Ma, Y., Xu, X., Gao, Y., Zhan, Z., Xu, C., Qu, X. et al. (2020). Antimicrobial resistance and molecular characterization of Salmonella enterica serovar Corvallis isolated from human patients and animal source foods in China. International Journal of Food Microbiology, 335, Article 108859. https://doi.org/10.1016/j.ij-foodmicro.2020.108859
15. Lai, J., Wu, C., Wu, C., Qi, J., Wang, Y., Wang, H. et al. (2014). Serotype distribution and antibiotic resistance of Salmonella in food-producing animals in Shandong province of China, 2009 and 2012. International Journal of Food Microbiology, 180, 30-38. https://doi.org/10.1016/j.ijfoodmicro.2014.03.030
16. Yang, B., Qiao, L., Zhang, X., Cui, Y., Xia, X., Cui, S. et al. (2013). Serotyping, antimicrobial susceptibility, pulse field gel electrophoresis analysis of Salmonella isolates from retail foods in Henan Province, China. Food Control, 32(1), 228-235. https://doi.org/10.1016/j.foodcont.2012.11.022
17. Zhu, Y., Lai, H., Zou, L., Yin, S., Wang, C., Han, X. et al. (2017). Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China. International Journal of Food Microbiology, 259, 43-51. https://doi.org/10.1016/j.ijfoodmicro.2017.07.023
18. Harb, A., O'Dea, M., Hanan, Z. K., Abraham, S., Habib, I. (2017). Prevalence, risk factors and antimicrobial resistance of Salmonella diarrhoeal infection among children in Thi-Qar Gover-norate, Iraq. Epidemiology and Infection, 145(16), 3486-3496. https://doi.org/10.1017/S0950268817002400
19. Fabrega, A., Vila, J. (2013). Salmonella enterica serovar ty-phimurium skills to succeed in the host: Virulence and regulation. Clinical Microbiology Reviews, 26(2), 308-341. https://doi. org/10.1128/cmr.00066-12
20. Lou, L., Zhang, P., Piao, R., Wang, Y. (2019). Salmonella Pathogenicity Island 1 (SPI-1) and its complex regulatory network. Frontiers in Cellular and Infection Microbiology, 9, Article 270. https://doi.org/10.3389/fcimb.2019.00270
21. Mthembu, T. P., Zishiri, O. T., El Zowalaty, M. E. (2019). Detection and molecular identification of Salmonella virulence genes in livestock production systems in South Africa. Pathogens, 8(3), Article 124. https://doi.org/10.3390/pathogens8030124
22. Mostafa, L., Aioub, K., Mousa, M., Ahmed, A. (2019). Effect of some essential oils on Salmonella Kentucky isolated from quail meat retailed in Alexandria markets. Alexandria Journal of Veterinary Sciences, 61(1), Article 179. https://doi.org/10.5455/ ajvs.29683
23. Kaabi, H. K. J. A., AL-Yassari, A. K. S. (2019). 16SrRNA sequencing as tool for identification of Salmonella spp. isolated
from human diarrhea cases. Journal of Physics: Conference Series, 1294(6), Article 062041. https://doi.org/10.1088/1742-6596/1294/6/062041
24. Van der Velden, A. W., Lindgren, S. W., Worley, M. J., Heffron, F. (2000). Salmonella pathogenicity island 1-independent induction of apoptosis in infected macrophages by Salmonella enterica serotype Typhimurium. Infection and Immunity, 68(10), 57025709. https://doi.org/10.1128/iai.68.10.5702-5709.2000
25. Huehn, S., La Ragione, R. M., Anjum, M., Saunders, M., Woodward, M. J., Bunge, C. et al. (2010). Virulotyping and antimicrobial resistance typing of Salmonella enterica serovars relevant to human health in Europe. Foodborne Pathogens and Disease, 7(5), 523-535. https://doi.org/10.1089/fpd.2009.0447
26. Skyberg, J. A., Logue, C. M., Nolan, L. K. (2009).Virulence ge-notyping of Salmonella spp. with multiplex PCR. Avian Diseases, 50(1), 77-81. https://doi.org/10.1637/7417.1
27. Gomes, C., Ruiz-Roldan, L., Mateu, J., Ochoa, T. J., Ruiz, J.
(2019). Azithromycin resistance levels and mechanisms in Escherichia coli. Scientific Reports, 9(1), Article 6089. https://doi. org/10.1038/s41598-019-42423-3
28. Wang, J., Li, Y., Xu, X., Liang, B., Wu, F., Yang, X. et al. (2017). Antimicrobial resistance of Salmonella enterica serovar Ty-phimurium in Shanghai, China. Frontiers in Microbiology, 8, Article 510. https://doi.org/10.3389/fmicb.2017.00510
29. Clinical and Laboratory Standards Institute (CLSI). 2021. Performance standards for antimicrobial susceptibility testing. 31th (ed.). CLSI document M100. Wayne, USA.
30. Abraham, S., Groves, M. D., Trott, D. J., Chapman, T. A., Turner, B., Hornitzky, M. et al. (2014). Salmonella enterica isolated from infections in Australian livestock remain susceptible to critical antimicrobials. International Journal of Antimicrobial Agents, 43(2), 126-130. https://doi.org/10.1016/j.ijantimicag.2013.10.014
31. Alrifai, S. B., Alsaadi, A., Mahmood, Y. A., Ali, A. A. (2009). Prevalence and etiology of nosocomial diarrhoea in children < 5 years in Tikrit teaching hospital. EMHJ — Eastern Mediterranean Health Journal, 15(5), 1111-1118. https://doi. org/10.26719/2009.15.5.111
32. Rabatti, A.A., Rasheed, N.E. (2009). Etiology of bloody diarrhea among children admitted to maternity and children's Hospi-tal-Erbil. Al-Kindy College Medical Journal, 4(2), 19-24.
33. Al-Mosawi, G.J., Al-Haris, F.M. (2008). The aetiology of bloody diarrhea in children of najaf governorate. Kufa Medical Journal, 11(1), 224-233.
34. Al-Taie, H. H. I. (2009). Prevalence rate of Salmonella in Babylon province. The Iraqi Journal of Veterinary Medicine, 33(2), 152-157. https://doi.org/10.30539/iraqijvm.v33i2.705
35. Al-Juboory, Y.H, Zenad, M.M, Hassen, R. H. (2014). Prevalence of Salmonella Serotypes in Diarrheic and Non-Diarrheic Patients in Mosul-Iraq. Kerbala Journal of Medicine, 7(2), 1937-1944.
36. Saleh, M.B., Hanan, Z.K., Mezal, E.H. (2016). Antimicrobial resistance, Virulence profiles of Salmonella enterica serovar Typhimurium isolated from diarrheal children in Thi-Qar province during 2015. University of Thi-Qar Journal of Science, 6(1), 3-8.
37. Abbas, K., Al-Wattar, W., Hasan, S., Kasim, H., Jasim, A. (2017). The incidence of Shigella and Salmonella in the stool of pediatric patients. Iraqi Journal of Public Health, 1(3), 25217267. https://doi.org/10.22317/ijph.12201705
38. Yang, X., Huang, J., Zhang, Y., Liu, S., Chen, L., Xiao, C. et al.
(2020). Prevalence, abundance, serovars and antimicrobial resistance of Salmonella isolated from retail raw poultry meat in China. Science of The Total Environment, 713, Article 136385. https://doi.org/10.1016/j.scitotenv.2019.136385
39. Rabby, M. R. I., Shah, S. T., Miah, M. I., Islam, M. S., Khan, M. A. S., Rahman, M. S. et al. (2021). Comparative analysis of bacteriological hazards and prevalence of Salmonella in poultry-meat retailed in wet- and super-markets in Dhaka city, Bangladesh. Journal of Agriculture and Food Research, 6, Article 100224. https://doi.org/10.1016/j.jafr.2021.100224
40. Salih, D., Abdo, J., Saadi, A. (2019). Molecular identification of Salmonella enterica from patients with diarrhea in Duhok governorate Kurdistan region/Iraq. Journal of Duhok University, 22(1), 148-154. https://doi.org/10.26682/sjuod.2019.22.1.16
41. Sadeq, J. N., Esmaeel, J. R., Neama, A. A. (2017). Molecular detection of invA, ssaP in Salmonella typhimurium isolated from chicken in Al-Qadisiyah Province. AL-Qadisiyah Journal of Veterinary Medicine Sciences, 16(2), 8-13. https://doi.org/10.29079/ vol16iss2art436
42. Obayes, M. S., Al-Bermani, O. K., Rahim, S. A. (2020). Genetic detection of invA, sipB, SopB and sseC genes in Salmonella spp. isolated from diarrheic children patients. Eurasian Journal of Biosciences, 14(2), 3085-3091.
43. Preethi, B., Shanthi, V., Ramanathan, K. (2015). Investigation of nalidixic acid resistance mechanism in Salmonella enterica using molecular simulation techniques. Applied Biochemistry and Biotechnology, 177, 528-540. https://doi.org/10.1007/ s12010-015-1760-6
44. Fardsanei, F., Soltan Dallal, M. M., Douraghi, M., Memari-ani, H., Bakhshi, B., Zahraei Salehi, T. Z. et al. (2018). Antimicrobial resistance, virulence genes and genetic relatedness of Salmonella enterica serotype Enteritidis isolates recovered from human gastroenteritis in Tehran, Iran. Journal of Global Antimicrobial Resistance, 12, 220-226. https://doi.org/10.1016/j. jgar.2017.10.005
45. Wei, B., Shang, K., Cha, S.-Y., Zhang, J.-F., Jang, H.-K., Kang, M. (2021). Clonal dissemination of Salmonella enterica serovar albany with concurrent resistance to ampicillin, chloramphenicol, streptomycin, sulfisoxazole, tetracycline, and nalidixic acid in broiler chicken in Korea. Poultry Science, 100(7), Article 101141. https://doi.org/10.1016/j.psj.2021.101141
46. Ahsan, S., Rahman, S. (2019). Azithromycin resistance in clinical isolates of Salmonella enterica serovars typhi and paratyphi in Bangladesh. Microbial Drug Resistance, 25(1), 8-13. https://doi.org/10.1089/mdr.2018.0109
47. Mthembu, T. P., Zishiri, O. T., El Zowalaty, M. E. (2019). Molecular detection of multidrug-resistant Salmonella isolated from livestock production systems in South Africa. Infection and Drug Resistance, 12, 3537-3548. https://doi.org/10.2147/idr.s211618
48. Girish, R., Kumar, A., Khan, S., Dinesh, K. R., Karim, S. (2013). Revised ciprofloxacin breakpoints for Salmonella: Is it time to write an obituary? Journal of Clinical and Diagnostic Research, 7(11), 2467-2469. https://doi.org/10.7860/JCDR/2013/7312.3581
49. Yu, X., Zhu, H., Bo, Y., Li, Y., Zhang, Y., Liu, Y. (2021). Prevalence and antimicrobial resistance of Salmonella enterica subspecies enterica serovar Enteritidis isolated from broiler chickens in Shandong Province, China, 2013-2018. Poultry Science, 100(2), 1016-1023. https://doi.org/10.1016Zj.psj.2020.09.079
50. Velez, D. C., Rodriguez, V., & Garcia, N. V. (2017). Phenotyp-ic and genotypic antibiotic resistance of Salmonella from chicken carcasses marketed at Ibague, Colombia. Brazilian Journal of Poultry Science, 19, 347-354. http://doi.org/10.1590/1806-9061-2016-0405
51. Hasan, T. O. (2021). Genomic diversity analysis of Salmonella spp. from broiler and layer flocks and their feed and water in Karbala, Iraq. Ph.D. thesis, University of Baghdad, 2021. https://doi.org/10.13140/RG.2.2.23584.71682
52. Blair, J. M. A., Webber, M. A., Baylay, A. J., Ogbolu, D. O., Piddock, L. J. V. (2014). Molecular mechanisms of antibiotic resistance. Nature Reviews Microbiology, 13(1), 42-51. https://doi. org/10.1038/nrmicro3380
53. Vuthy, Y., Lay, K. S., Seiha, H., Kerleguer, A., Aidara-Kane, A. (2017). Antibiotic susceptibility and molecular characterization of resistance genes among Escherichia coli and among Salmonella subsp. in chicken food chains. Asian Pacific Journal of Tropical Biomedicine, 7(7), 670-674. https://doi.org/10.1016/j. apjtb.2017.07.002
54. Preethi, B., Shanthi, V., Ramanathan, K. (2015). Investigation of nalidixic acid resistance mechanism in Salmonella enterica using molecular simulation techniques. Applied Biochemistry and Biotechnology, 177(2), 528-540. https://doi.org/10.1007/ s12010-015-1760-6
55. Sharma, P., Kumari, B., Dahiya, S., Kulsum, U., Kumar, S., Manral, N. et al. (2019). Azithromycin resistance mechanisms in typhoidal Salmonellae in India: A 25 years analysis. Indian Journal of Medical Research, 149(3), 404-411. https://doi. org/10.4103/ijmr.IJMR_1302_17
56. Wang, H., Cheng, H., Huang, B., Hu, X., Chen, Y., Zheng, L., et al. (2023). Characterization of resistance genes and plas-mids from sick children caused by Salmonella enterica resistance to azithromycin in Shenzhen, China. Frontiers in Cellular and Infection Microbiology, 13, 343. https://doi.org/10.3389/ fcimb.2023.11161722
57. Golubeva, Y. (2010). Regulation of virulence in Salmonella enterica. Ph.D. thesis, University of Illinois at Urbana-Champaign 2010.
58. Li, Q., Cheng, W., Zhang, D., Yu, T., Yin, Y., Ju, H. et al. (2012). Rapid and sensitive strategy for Salmonella detection using an InvA gene-based electrochemical DNA sensor. International Journal of Electrochemical Science, 7(1), 844-856.
59. Chaudhary, J.H., Nayak, J.B., Brahmbhatt, M.N., Makwana, P.P. (2015).Virulence genes detection of Salmonella serovars
isolated from pork and slaughterhouse environment in Ahmed-abad, Gujarat. Veterinary World, 8(1), 121-124. https://doi. org/10.14202/vetworld.2015.121-124
60. Gassama-Sow, A., Wane, A.A., Canu, N.A., Uzzau, S., Aid-ara-Kane, A., Rubino, S. (2006). Characterization of virulence factors in the newly described Salmonella enterica serotype Keurmassar emerging in Senegal (sub-Saharan Africa). Epidemiology and Infection, 134(4), 741-743. https://doi.org/10.1017/ S0950268805005807
61. Borges, K.A., Furian, T.Q., Borsoi, A., Moraes, H.L., Salle, C.T., Nascimento, V.P. (2013). Detection of virulence-associated genes in Salmonella Enteritidis isolates from chicken in South of Brazil. Pesquisa Veterinaria Brasileira, 33, 1416-1422.
62. Deguenon, E., Dougnon, V., Lozes, E., Maman, N., Agbank-pe, J., Abdel-Massih, R.M. et al. (2019). Resistance and virulence determinants of faecal Salmonella spp. isolated from slaughter animals in Benin. BMC Research Notes, 12(1), Article 317. https://doi.org/10.1186/s13104-019-4341-x
63. Somda, N.S., Bonkoungou, I.J.O., Sambe-Ba, B., Drabo, M.S., Wane, A.A., Sawadogo-Lingani, H. et al. (2021). Diversity and antimicrobial drug resistance of non-typhoid Salmonella serotypes isolated in lettuce, irrigation water and clinical samples in Burkina Faso. Journal of Agriculture and Food Research, 5, Article 100167. https://doi.org/10.1016/j.jafr.2021.100167
64. Nikiema, M.E.M., Kakou-Ngazoa, S., Ky/Ba, A., Sylla, A., Ba-ko, E., Addablah, A.Y.A. et al. (2021). Characterization of virulence factors of Salmonella isolated from human stools and street food in urban areas of Burkina Faso. BMC Microbiology. 21(1), Article 338. https://doi.org/10.1186/s12866-021-02398-6
65. Salih, W., Yousif, A.A. (2018). Molecular detection of Salmonella typhimurium isolated from canine feces by PCR. Advances in Animal and Veterinary Sciences, 6(12), 542-547. https://doi. org/10.17582/journal.aavs/2018/6.12.542.547
66. Kadry, M., Nader, S.M., Dorgham, S.M., Kandil, M.M. (2019). Molecular diversity of the invA gene obtained from human and egg samples. Veterinary World, 12(7), Article 1033. https://doi. org/10.14202/vetworld.2019.1033-1038
67. Ahmer, B. M. M., Gunn, J. S. (2011). Interaction of Salmonella spp. with the intestinal microbiota. Frontiers in Microbiology, 2, Article 101. https://doi.org/10.3389/fmicb.2011.00101
68. Hassan, K. I., Saleh, S. H. (2016). A rapid method for PCR based on detection of Salmonella spp. and Staphylococcus aure-us in spiked and naturally contaminated food. Iraqi Journal of Agricultural Sciences, 47(7 — special issue), 66-73.
69. Oludairo, O.O., Kwaga, J.K.P., Dzikwi, A. A., Junaid, K. (2013). Detection of invA virulence gene by polymerase chain reaction (PCR) in Salmonella spp. isolated from captive wildlife. Bio-Genetics Journal, 1(1), 12-14.
70. Lu, R., Wu, S., Liu, X., Xia, Y., Zhang, Y. -G., Sun, J. (2010). Chronic effects of a Salmonella type III secretion effector protein AvrA in vivo. PLoS ONE, 5(5), Article e10505. https://doi. org/10.1371/journal.pone.0010505
71. Saber, A. S., Abeer, H.A., (2019). Molecular characterization of Salmonella species isolated from chicken table egg content. Assiut Veterinary Medical Journal, 65(162), 83-92. https://doi. org/10.21608/avmj.2019.168950
72. Jbar, H.S., Al-Janabi, H. S. Kadhim, M.J. (2021). Molecular detection of some outer membrane proteins related to immune resistance in Salmonella Enterica. Turkish Journal of Physiotherapy and Rehabilitation, 32(3), 18739-18743.
73. Hersh, D., Monack, D. M., Smith, M. R., Ghori, N., Falkow, S., Zychlinsky, A. (1999). The Salmonella invasin SipB induces macrophage apoptosis by binding to caspase-1. Proceedings of the National Academy of Sciences, 96(5), 2396-2401.
74. Cabezon, E., Ripoll-Rozada, J., Pena, A., de la Cruz, F., Arecha-ga, I. (2015). Towards an integrated model of bacterial conjugation. Microbiol. Rev. FEMS Microbiology Reviews, 39(1), 81-95. https://doi.org/10.1111/1574-6976.12085
75. Ahmet, N. A., Bissoume, S. B., Abdoulaye, S., Amadou, D., Khota, F. N., Aziz, W. A. et al. (2020). Phenotypic and genotyp-ic characterization of Salmonella isolated from Asymptomatic Carriers in the Suburb of Dakar. Journal of Tropical Diseases and Public Health, 8, Article 350. https://doi.org/10.35248/2329-891X.20.8.346
76. Allaith, S. A., Abdel-aziz, M. E., Thabit, Z. A., Altemimi, A. B., Abd El-Ghany, K., Giuffre, A. M. et al. (2022). Screening and molecular identification of lactic acid bacteria producing ß-glucan in Boza and Cider. Fermentation, 8(8), Article 350. https://doi. org/10.3390/fermentation8080350
AUTHOR INFORMATION
Zahraa A. AlShaheeb, MSc, Assistant lecturer, Laboratory Scientist, Iraqi Ministry of Health. Baghdad 64074, Iraq. Tel.:+9647830602282, E-mail:
ORCID: https://orcid.org/0000-0002-0193-9218
Zaid A. Thabit, PhD, Assistant professor, Academic Stuff, Environmental Biotech Department, Biotechnology Research Center, Al-Nahrain University. Baghdad 64074, Iraq.
Tel.:+9647700326685, E-mail: [email protected] ORCID: https://orcid.org/0000-0002-3431-7562 * corresponding author
Asma G. Oraibi, PhD, Professor, Academic Stuff, Plant Biotechnology Department, College of Biotechnology, Al-Nahrain University, Baghdad 64074, Iraq.
Tel.: +9647819905976, E-mail: [email protected] ORCID: https://orcid.org/0000-0002-0533-1349
Ahmed A. Baioumy, PhD, Assistant Professor, Food Science Department, Faculty of Agriculture, Cairo University. 12613, 1 Gamaa Street, Giza, Egypt. Tel.: +2-0122-838-44-78, E-mail: [email protected] ORCID: https://orcid.org/0000-0002-2909-603X
Tarek G. Abedelmaksoud, PhD, Assistant Professor, Food Science Department, Faculty of Agriculture, Cairo University. 12613, 1 Gamaa Street, Giza, Egypt. Tel.: +2-0110-144-12-80, E-mail: [email protected] ORCID: https://orcid.org/0000-0002-7012-6667
All authors bear responsibility for the work and presented data.
All authors made an equal contribution to the work.
The authors were equally involved in writing the manuscript and bear the equal responsibility for plagiarism. The authors declare no conflict of interest.
