Molecular Detection of Streptococcus Species Isolated from Cows with Mastitis Текст научной статьи по специальности «Биологические науки»

© 2016, Scienceline Publication

World's Veterinary Journal

World Vet J, 6(4): 193-202, December 25, 2016

Molecular Detection of Streptococcus Species Isolated from Cows with Mastitis

Ibrahim Elsayed Eldesouky1*, Mena Allah Abd Elnaby Refae2, Hisham Saad Nada1 and Gamal Ragab Hassb

Elnaby2

1Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Kafrelsheikh University 33516, Egypt 2Animal Health Research Institute, Tanta, Egypt

*Corresponding author's Email: Ibrahim543@yahoo.com

ABSTRACT

Streptococcal mastitis is considered as one of the most common infectious diseases in the dairy cattle, which threatens the dairy industry all over the world. The aim of this study was to determine the prevalence of Streptococcus species in mastitic cows with molecular investigation to detect the presence of some virulence genes of the recovered isolates by PCR. A total of 150 milk samples were collected from dairy cattle with clinical and subclinical mastitis from different areas in El- Gharbia governorate, Egypt. Streptococcus species were isolated with an incidence of 38%. S. agalactiae, S. dysgalactiae, S. uberis, S. pyogenes, S. pneumoniae and S. faecalis were isolated from the milk samples of the examined cows with the percentage of 14.7%, 6%, 9.3%, 4.7%, 1.3% and 2%, respectively. Molecular investigation of virulence associated genes revealed that sip, cfb and bca genes of S. agalactiae were found with the percentage of 77.7%, 88.8% and 33.3%, respectively. The mig gene of S. dysgalactiae was found with an incidence of 77.8%. Of the examined S. uberis isolates, 55.5%, 22.2% and 33.3% were carrying the cfu, oppF and has A genes, respectively. The present study revealed the prevalence of Streptococci and distribution of virulence associated genes among the isolates. The high frequency of virulence genes in the isolates suggests an important role of these virulence genes in the pathogenesis of Streptococci in cattle mastitis.

Key words: Mastitis, Cows, Streptococci, Virulence genes INTRODUCTION

Bovine mastitis is one of the most frequent diseases in dairy cattle which causes major economic losses due to the reduced milk quantity and increased costs of treatment (Koskinen et al., 2009). Mastitis is an inflammation of the mammary gland that occurs as a response to injury. This disease is mainly caused by microorganisms usually bacteria, including Gram-negative and Gram-positive bacteria, mycoplasma, yeasts and algae (Zadoks et al., 2011).

Streptococci are Gram-positive bacteria widespread in the environment and are also commensal organisms of the cow's udder, mucosa and skin. Some of the commensal Streptococcus are opportunistic bacteria causing infection if the balance between bacteria and host is broken. Others are considered primary pathogens of mastitis (Cleary and Cheng, 2006). Among Streptococcus species, S. agalactiae (contagious agent), S. uberis (environmental agent) and S. dysgalactiae are the predominant group of organisms isolated from mastitis (Kuang et al., 2009).

Streptococcus agalactiae, the lone member of the Lancefield group B, is an important cause of chronic and contagious bovine mastitis. Its presence is frequently associated with high somatic cell counts in milk and decreased milk yield (Jain et al., 2012). However, S. agalactiae possesses several virulence factors including structural components, toxins and enzymes that play an important role in the intra-mammary infections (Krishnaveni et al., 2014). Streptococcus dysgalactiae is considered as a contagious pathogen, which adapts to the udder environment and can be spread from cow to cow during milking (Yanliang et al., 2016). However, this bacterial pathogen may contain several putative virulence associated genes which are not fully understood (Calvinho et al., 1998). One of these genes, a surface- expressed M-like protein, named mig, has been found to bind to the Immunoglobulin G (IgG), K2-macroglobulin (K2-M) (Jonsson and

ISSN 2322-4568

A R

c rc c C e i

P v

e S d :

ee 0 e

c v o c

6 6

o

R

G

HH

N A L

A R

T

2 O

193

Muller, 1994) and Bovine Immunoglobulin A (B-IgA) and plays a role in anti-phagocytosis by bovine neutrophils in the presence of bovine serum (Song et al., 2001).

Streptococcus uberis is one of the prime causative agents among the environmental pathogens and is predominantly associated with the clinical and subclinical mastitis in both lactating and non lactating cows (Reinoso et al., 2011). Despite the great economical loss due to high prevalence of S. uberis, several virulence factors associated with the pathogenesis are not well understood. Among these factors, resistance to phagocytosis conferred by hyaluronic acid capsule (Ward et al., 2001), Christie, Atkins and Munch Peterson (CAMP) factor (Jiang et al., 1996) and Opp proteins (Smith et al., 2002) have been found. The identification and characterization of Streptococci virulence associated genes causing bovine mastitis will open the way for the development the new strategies to prevent and control this bacterial pathogen in dairy herds (El-Behiry et al., 2015). Few reports exist on the prevalence of Streptococci as well as the occurrence of virulence-associated genes among Streptococcus isolates recovered from cattle with mastitis in Egypt. Therefore, the aim of the present study was to determine the prevalence of Streptococci involved in mastitis in cattle with molecular investigation the pattern distribution of some virulence associated genes of the recovered isolates.

MATERIALS AND METHODS

Ethical approval

Handling of animals were according to the guidelines of animal ethics committee, faculty of veterinary medicine, Kafrelsheikh University, Egypt.

Sampling

A total of 150 milk samples (115 from clinical mastitic cows and 35 from apparently healthy cows) were collected from lactating cows (Friesian and Jersey breeds) at different stages of lactation during the period from January 2015 to November 2015 from different areas in El- Gharbia governorate, Egypt. The udder of each animal was examined before sampling for detection of clinical signs of mastitis such as inflammation, asymmetry, hotness, swelling or any physical changes. Each udder was washed and carefully dried with clean towel then the teats were swabbed with 70% alcohol. Before sampling, the first jets of milk were rejected, then each quarter milk sample (nearly 3ml) was collected into sterile screw capped MacCarteny bottle as recommended by Blood and Handerson (1986) and submitted to the laboratory in an ice container as soon as possible for further bacteriological and molecular examination.

Isolation and identification of Streptococcus species

Isolation of suspected Streptococci was done according to Quinn et al. (2002). Briefly, the collected milk samples were incubated aerobically at 37°C for 24 h, then centrifuged at 3000 rpm for 20 min. The cream and supernatant fluid were discarded. Methylene blue stain was used routinely to detect the suggestive bacterial causes. The sediment was streaked on the surface of 5% sheep blood agar and Edward's media (Oxoid). The inoculated plates were incubated at 37°C for 24-48 h, and examined for bacterial growth. Suspected streptococcal colonies were sub-cultured, purified and preserved in semisolid agar for further identification which was done according to Cowan (1979); Carter and Cole (1990). Also, CAMP test was carried out according to Koneman et al. (1988). The subclinical samples were subjected to total somatic cell count using California Mastitis Test (CMT) in order to confirm the subclinical status of the collected samples.

Molecular detection of Streptococcus virulence associated genes

Bacterial DNA extraction was done by using QIA amp DNA mini and Blood mini kit according to the manufacturer's instructions. A molecular identification of Streptococcus species was performed by using species-specific oligonucleotide primers for the genes encoding 16S rRNA for the identification of S. agalactiae, S. dysgalactiae and S. uberis. For detection of some virulence associated genes, S. agalactiae isolates were screened for Sip, cfb and bca. S. dysgalactiae isolates were screened for mig while S. uberis isolates were screened for cfu, oppE and hasA genes. The primer pairs used in PCR protocols were selected from published papers based on specificity, compatibility and ability to target the potential virulence genes of interest.

The nucleotide sequences and anticipated molecular sizes of PCR amplified fragments for these gene-specific oligonucleotide primer sets are outlined in table 1. PCR reaction mixtures and conditions are given in table 2. The amplification was performed on a Thermal Cycler (Master cycler, Eppendorf, Hamburg, Germany). The PCR products were analyzed by electrophoresis using a 1.5 % agarose gel in Tris-Borate EDTA (TBE) buffer. A 100 bp plus DNA Ladder (Qiagen, Germany, GmbH) was used to determine the fragment sizes.

194

Table 1. Nucleotide sequence and product length of S. agalactiae, S. dysgalactiae and S. uberis virulence gene specific primers_

Streptococcus spp. Primer Oligonucleotide sequence (5' ^ 3*) Product size (bp) References

16S rRNA(F) 5' ATTGATAACGACGGTGTTACTGT '3 487 Raemy et al. (2013)

16S rRNA(R) 5' CATAGTAGCGTTCTGTAATGATGTC '3 487 Raemy et al. (2013)

sip (F) 5' ACTATTGACATCGACAATGGCAGC '3 266 Nithinprabhu et al. (2010)

S. agalactiae sip (R) 5' GTTACTGTCAGTGTTGTCTCA'3 266 Nithinprabhu et al. (2010)

Cfb (F) 5 'CAAAGATAATGTTCAGGGAACAGATTATG'3 320 Krishnaveni et al. (2014)

Cfb (R) 5' CTTTTGTTCTAATGCCTTTACGTT '3 320 Krishnaveni et al. (2014)

bca(F) 5' TAACAGTTATGATACTTCACAGAC '3 535 Manning et al. (2006)

bca (R) 5' ACGACTTTCTTCCGTCCACTTAG '3 535 Manning et al. (2006)

16S rRNA(F) 5' GTGCAACTGCATCACTATGAG '3 279 Raemy et al. (2013)

S. dysgalactiae 16S rRNA(R) 5' CGTCACATGGTGGAT TTTC '3 279 Raemy et al. (2013)

mig (F) 5' CGTTTTTAGTTTCGGGAGCA '3 188 Nithinprabhu et al. (2010)

mig (R) 5' TGCCTTCAATTGAGTCTGCTG '3 188 Nithinprabhu et al. (2010)

16S rRNA(F) 5' TGATTCCGACTACTACGCTAGAT '3 723 Raemy et al. (2013)

16S rRNA(R) 5' ATACTTTGAGTTTCACCGAGTTC '3 723 Raemy et al. (2013)

cfu (F) 5' TATCCCGATTTGCAGCCTAC '3 205 Reinoso et al. (2011)

S. uberis cfu (R) 5' CCTGGTCAACTTGTGCAACTG '3 205 Reinoso et al. (2011)

°ppE (F) 5' GGCCTAACCAAAACGAAACA '3 419 Smith et al. (2002)

oppE (R) 5' GGCTCTGGAATTGCTGAAAG'3 419 Smith et al. (2002)

hasA (F) 5' GAAAGGTCTGATGCTGAT '3 600 Ward et al. (2001)

hasA (R) 5' TCATCCCCTATGCTTACAG '3 600 Ward et al. (2001)

Table 2. PCR assay conditions and reaction mixture for molecular identification of Streptococcus species and detection of the virulence associated genes_

Reaction

Assay (1) (Raemy et al.,2013)

H e

П

D U

n

y

Assay (2) (El-Behiry et al., 2015)

H e

П

D U

n

y

Assay (4) (Reinoso et al., 2011)

H e

n

D

u

n y

Denaturation

Annealing

Extension

Elongation Cooling

Reaction mixture

94 60 sec 1 58 60 sec 72 10 min 35

4 Infinite -(total volume = 25 ^1): 1x HotStarTaq Master Mix + 2.5 ц1 of diluted lysate, and 300 цМ of each primer (16S rRNA of S. agalactiae, S. dysgalactiae and S. uberis)

94 45 72

4

30 sec 60 sec 90 sec

25

Infinite -25 ц1 containing PCR master mix with 3 mm of MgC12 + 3 ц1 of template DNA and 0.5 цМ of each primer (sip, cfb, bca genes of S. agalactiae)

94 55 72 72 4

1

}

30

30 sec 30 sec 30 sec 10 min

Infinite -25 ц1 of 10X PCR Taq Buffer A+ 1ц1 (20 pmol) of mig primers of S. dysgalactiae + 1 ц1 (100 цМ) of each dNTPs and 3 ц1 (150 ng) of template

DNA

94 30 sec 48-58 30 sec 72 10 min

}

25

4 Infinite -50 ^l containing 1.50 U Taq polymerase with 1.5 mM MgCl2, 1 ^M of each primer(c/u, oppF, has A genes of S. uberis) , 0.4 ^M of each of the dNTPs and 20 ng template DNA

Assay 1 is designed for molecular identification of S. agalactiae, S. dysgalactiae and S. virulence associated genes of S. agalactiae, S. dysgalactiae and S. uberis, respectively

uberis. Assays 2, 3 and 4 are for molecular detection of

1

1

RESULTS

Incidence of Streptococcus species in mastitic cows

Among the 150 examined milk samples, 115 from clinical cases and 35 from apparently healthy cows were subjected to CMT for detection of subclinical mastitis, 25 were positive for CMT and 10 were negative. A total of 57 isolates of Streptococcus species were isolated and identified [41 from clinical mastitis (35.7%) and 16 from subclinical

195

cases (64%)]. In clinical mastitis samples, S. agalactiae was the predominant species (13.9%) followed by S. uberis (9.6%), S. dysgalactiae (6.1%), S. pyogenes (3.5%), S. pneumoniae (1.7%) and S. fecalis (0.9%). While in subclinical mastitis, S. agalactiae was also the most frequent isolated species (17.1%), followed by S. uberis, S. pyogenes (8.6% each) S. dysgalactiae and S. fecalis (5.7% each) (Table 3).

Molecular detection of Streptococcus species virulence associated genes by PCR

As a result of the molecular screening of 27 Streptococcus species using species specific PCR, nine isolates for each S. agalactiae, S. dysgalactiae and S. uberis were identified (Figure1). PCR based screening of virulence genes revealed the presence of cfb, sip and bca in S. agalactiae isolates with the percentage of 88.8%, 77.7% and 33.3%, respectively (Figure 2),whereas 77.8% of S. dysgalactiae were carrying mig gene (Figure 3). Similarly, cfu, oppF and hasA genes were detected in S. uberis isolates with the percentage of 55.5%, 22.2% and 33.3%, respectively (Figure 4) (Table 5).

Table 3. The incidence of Streptococcus species among the examined Cow's milk samples in El- Gharbia governorate, Egypt during the period from January 2015 to November 2015

Streptococcus Species Clinical mastitis (n=115) Subclinical mastitis (n=35) Total (n=150)

No. % No. % No. %

S. agalactiae 16 13.9 6 17.1 22 14.7

S. dysgalactiae 7 6.1 2 5.7 9 6

S. uberis 11 9.6 3 8.6 14 9.3

S. pyogenes 4 3.5 3 8.6 7 4.7

S. pneumonia 2 1.7 0 0 2 1.3

S. fecalis 1 0.9 2 5.7 3 2

Total 41 35.7 16 45.7 57 38

No = positive number; % was calculated according to the total number of examined animals

Table 4. The incidence of some virulence associated genes in Streptococcus species isolated from Friesian and Jersey breeds in El- Gharbia governorate, Egypt during the period from January 2015 to November 2015_

S. agalactiae (n=9) S. dysgalctiae (n=9) S. uberis (n=9)

Sip Cfb bca Mig cfu oppF hasA

No. % No. % No. % No. % No. % No. % No. %

7 77.8 8 88.8 3 33.3 7 77.8 5 55.5 2 22.2 3 33.3

No = positive number; % was calculated according to the positive examined samples for each species

M I 2 4 5 A 7 N V 1(1 II

I (MIO < «il Ml NIMI 7<MI AIM) Aim* < 4IM> .<011

Figure 1. Agarose gel electrophoresis of multiplex PCR of GSag (487 bp) for Streptococcus agalactiae, GSdys (279 bp) for Streptococcus dysgalactiae and GSub (723 bp) for Streptococcus uberis as species specific genes for their identification (M=100 bp ladder, Lane 1: Control positive Streptococcus species for GSag, GSdys and GSub genes, Lane 2: Control negative, Lanes 3-9: positive for GSag, GSdys and GSub for Streptococcus agalactiae, Streptococcus dysgalactiae and Streptococcus uberis, respectively)

196

I o II

I IHM! I •»«III HIM»

TOO «.mm

Figure 2. Agarose gel electrophoresis of multiplex PCR of sip (266 bp), cfb (320 bp) and bca (535 bp) as virulence genes for characterization of Streptococcus agalactiae strains (M= 100 bp ladder, Lane 1: Control positive Streptococcus agalactiae for sip, cfb and bca genes, Lane 2: Control negative, Lane 3, 5-6 and 11: Positive Streptococcus agalactiae for sip and cfb genes, Lanes 4 and 8: Positive Streptococcus agalactiae for sip, cfb and bca genes, Lane 7: Positive Streptococcus agalactiae for cfb gene, Lane 9: Positive Streptococcus agalactiae strain for sip gene and Lane 10: Positive Streptococcus agalactiae strain for cfb and bca genes)

Figure 3. Agarose gel electrophoresis of PCR of mig protein gene (188 bp) virulence gene for characterization of

Streptococcus dysgalactiae strains (M=100 bp ladder, Lane 1: Control positive Streptococcus dysgalactiae for mig gene, Lane 2: Control negative, Lane 3, 5-8, 10 and 11: Positive Streptococcus dysgalactiae strains for mig gene and Lanes 4 and 9: Negative Streptococcus dysgalactiae strains for mig gene)

M I 2 4 5 <• 7 N 9 Kill

Figure 4. Agarose gel electrophoresis of multiplex PCR of cfu (205 bp), oppF (419 bp) and hasA (600 bp) as virulence genes for characterization of Streptococcus uberis strains (M=100 bp ladder, Lane 1: Control positive Streptococcus uberis for cfu, oppF and hasA genes, Lane 2: Control negative, Lane 3-4, 6, 8 and 11: Positive Streptococcus uberis strains for cfu gene, Lanes 6 and 9: Positive Streptococcus uberis strains for oppF gene and Lanes 5, 7 and 10: Positive Streptococcus uberis strains for has A gene)

197

DISCUSSION

Streptococcus species belong to a large group of organisms which are associated with bovine udder infections (Wyder et al., 2011). In the current study, a total of 150 milk samples were collected from cattle with mastitis (115 from clinical cases and 35 from apparently healthy cows, 25 were California mastitis test positive and represent subclinical mastitis and 10 samples were CMT negative and were discarded) and examined for presence of Streptococci. Fifty-seven Streptococci were recovered with a prevalence rate of 38%. This finding is nearly consistent with the report described by Mohanty et al. (2013). However, the present study shows much lower isolation rate than El Jakee et al. (2013) who isolated Streptococci with an incidence of 55%. In the present investigation, 16 Streptococci isolates were recovered from subclinical cases of mastitis with an incidence of 64%. Present result was in agreement with those obtained by Wahba et al. (2005). While a higher incidence of Streptococci in subclinical mastitis was obtained by Kia et al. (2014) with an incidence of 75%. However, other studies have reported a lower incidence of Streptococci from subclinical mastitis (Esron et al., 2005; Ranjan et al., 2011; chen et al., 2012; Jeykumar et al., 2013) who recovered Streptococci with the percentage of 9.8%, 5.7%, 15.5% and 16.1%, respectively.

With regard to clinical cases of mastitis, 41 isolates of Streptococci were recovered with a percentage of 35.7%. Contrary to our results, a lower incidence was recently reported by Demme and Abegaz (2015) who isolated Streptococcus from clinical cases at a rate of 16.7%.In our study, six different species of Streptococci (S. agalactiae, S. uberis, S. dysgalactiae, S. pyogenes, S. pneumoniae and S. fecalis) were isolated and identified.

Our results showed a clear overall predominance of S. agalactiae among Streptococcus species (14.7%). This finding confirms the results reported by Klimiene et al. (2005) and Kivaria and Noordhuizen (2007) who isolated S. agalactiae with an incidence of 15.1% and 15.4%, respectively. The high prevalence of S. agalactiae may indicate the poor management for the investigated cows. While higher incidences of S. agalactiae isolated from mastitic cows were recovered by Kuzma and Malinowski (2001), Khan and Mohammad (2005), Borkowoska et al. (2006), Momtaz et al. (2012) and El-Jakee et al. (2013) with isolation rate of 41.2%, 30%, 84.8%, 16%, 19.3%, respectively.

In our report, S. uberis was the second predominant Streptococcus species isolated from mastitic cattle with a percentage of 9.3%. A similar prevalence rate was also recently reported by El-Bagory and Zayda (2015) (9.4%). Other studies have been reported a higher incidence rate of S. uberis by Zadoks et al. (2003) (26%), Hussain et al. (2006) (15%), Bradley et al. (2007) (23%), Ericsson Unnerstad et al. (2009) (11%) and El Jakee et al. (2013) (15%).

A comparatively lower prevalence rate of S. uberis isolated from cattle with mastitis was also reported by other studies (Tenhagen et al., 2006 and Momtaz et al., 2012) with a percentage of 0.1% and 7.3 %, respectively. S. dysgalactiae was isolated in our study with an incidence of 6%. Other previous studied reported higher incidences such as Ericsson Unnerstad et al. (2002); Moges et al. (2011) and El Jakee et al. (2013) that isolated S. dysgalactiae with a prevalence rate of 15.6%, 14% and 17% respectively. Other Streptococcus species were isolated from the examined milk samples as S. pyogenes, Enterococcus species and S. pneumoniae. Yet these differences may be attributed to other factors rather than geographical location, such as the differences in the samples taken or type of mastitis.

S. pyogenes, a beta-hemolytic bacterium that belongs to Lancefield serogroup A, causes a wide variety of diseases in humans (Khan, 2012). The main reservoir of S. pyogenes includes, man, rarely cattle. S. pyogenes is almost exclusively associated with man, and contact with infected individuals or asymptomatic carriers is the most common source of infection (McDougall, 2005). However, previous study carried out by Khalil et al. (2014) reported that, the S. agalactiae and S. pyogenes represent the most important bacterial isolates responsible for severe losses to milk industry, in addition to the zoonotic importance of S. pyogenes.

Streptococcus pneumoniae colonizes the nasopharynx in mainly human at any time, and causes serious infectious diseases, such as pneumonia, septicemia, meningitis, and otitis media (Musher et al., 2005). S. pyogenes and S. pneumoniae were isolated with an incidence of 4.7% and 1.3% respectively. This is in contrast to El Jakee et al. (2013) who isolated S. pyogen and S. pneumoniae from mastitic cows in a lower percentage (2.7% and 0.7%, respectively). Their presence in the examined milk samples may be due to the bad manipulation during milking from the hand milkers. In cattle, enterococci have been associated with diarrhea in calves and bovine mastitis in dairy cattle (Rogers et al., 1992). Enterococcus species were recovered in our study with an incidence of 2%.

In the present study, a total of nine isolates of S. agalactiae were screened for some associated virulence genes, cfb, bca and sip by using multiplex PCR. Out of nine isolates, seven (77.8%) contained sip gene. Similarly, high percentages of sip gene in S. agalactiae have been reported by Krishnaveni et al. 2014 and El-Behiry et al. 2015, who reported sip gene with an incidence of 100% and 90.69%, respectively.

The cfb gene was detected in eight isolates (88.8%) of the examined S. agalactiae. Our results confirm the finding reported by El-Behiry et al. (2015) (93 %). However; other previous studies (Shome et al., 2012; El-Gedawy et al., 2014; Krishnaveni et al., 2014) have been reported that cfb was detected in the all obtained isolates. On the other hand, lower incidence of cfb gene was reported by Ding et al. (2016) who found cfb gene in only 50% of isolates. The cfb gene is a

198

cell surface protein that produces a traditional CAMP phenomenon with the typical half-moon forming hemolytic zones on blood agar plates (El-Behiry et al., 2015).

The results in the present study revealed that three isolates of S. agalactiae (33.3%) carried the bca gene. The bca gene codes for Alpha-C protein, a surface protein that helps the bacteria to enter the host cells (Bolduc et al., 2002). Higher incidences of bca gene was reported by Duarte et al. (2004) (64.7%) and Duarte et al. (2005) (78.9%). On the other hand, lower incidences of bca gene was recorded by El-Behiry et al. (2015) (20.93%) and Ding et al. (2016) (3.7%). While Jain et al. (2012) found that none of S. agalactiae isolates was carrying the bca gene.

The hyaluronic acid capsule production of S. uberis is dependent on the has operon (hasA, hasB and hasC). In this study, hasA gene was detected in three isolates out of nine S. uberis (33.3%). This result was nearly agreeing with Matthews et al. (1994) who found that 44% of S. uberis strains were carried hasA. However, higher incidence of hasA among S. uberis isolates have been reported by other studies (Reinoso et al., 2011; Mirta-Lasagno et al., 2011; Almeida et al., 2013) with the percentage of 74.3, 59.4 and 100%, respectively.

Another potential virulence factor analyzed in the present study was the CAMP factor (cfu) which was observed in five isolates out of nine S. uberis strains (55.5 %). This finding is consistent with the finding described by Shome et al.

(2012) (46.15%). However, other previous studies have been reported high frequency of cfu gene in S. uberis isolates (Shalka and Smola 1981; Hassan et al., 2000; Reinoso et al., 2011). While lower incidence was reported by Lammler et al. (1991) and Mirta-Lasagno et al. (2011) who detected cfu in a percentage of 28% and 25%, respectively among S. uberis isolates.

With regard to oppF gene, the data presented here showed that only two isolates of S. uberis were carring oppF gene with an incidence of 22.2%. OppF gene plays an important role during growth in milk (Smith et al., 2002). Higher incidences of oppF have been described by previous study (Reinoso et al. 2011) (64.1%). Moreover, Almeida et al.

(2013) detected oppF in all S. uberis isolates.

The mig protein of S. dysgalactiae is involved in resisting phagocytosis by bovine neutrophils in the presence of bovine serum (Song et al., 2001). Thus, the mig protein, an M-like protein, is considered as a potential virulence factor of S. dysgalactiae (Krishnaveni et al., 2014). This protein could act as the sensory component of a multiple component system, whereby, binding of IgG and or IgA to mig could trigger a conformational change on this protein, resulting in the activation of secondary proteins with histidine-kinase activities that result in the modulation of gene expression of factors involved in virulence (Krishnaveni et al. 2014). The DNA sequence encoding the alpha 2-M receptor portion of the mig gene was different from other Streptococci and was highly specific to S. dysgalactiae (Jonsson et al., 1994). In the current study, Mig gene was detected in seven out of nine S. dysgalactiae isolates with an incidence of 77.8 %. Song et al. (2001) reported that out of 16 S. dysgalactiae isolates, only five strains (31%) were found to carry the mig a2-M-homologous sequences linked to the IgG-binding domains.

CONCLUSION

This study revealed that Streptococcus species contribute to the occurrence of bovine mastitis in El- Gharbia governorate, Egypt. So, preventive measures must be taken to reduce the spread of infection. The high frequency of virulence genes in the isolates obtained in this work revealed the important role of these virulence genes in the pathogenesis of bovine mastitis. So, from our previous results we conclude that this multiplex PCR assay could be used as an alternative method in routine diagnosis for rapid, sensitive and specific simultaneous identification for Streptococcus spp. which play a role in the transmission and pathogenesis of bovine mastitis which is important for diseases control and epidemiological studies.

Competing interests

The authors have no competing interests to declare. REFERENCES

Almeida A, Ribeiro JN, Taveras F and Helena Madeira L (2013). Characterization of virulence and antibiotic resistance genetic

markers in Streptococcus agalactiae and Streptococcus uberis causing bovine mastitis. Universidade Do Porto. Blood DC and Handerson JA (1986). Veterinary Medicine 3rd Edition.Baillier Tin dall and Gassel, London.

Bolduc GR, Baron MJ, Gravekamp C, Lachenauer CS and Madoff LC (2002). The alpha C protein mediates internalization of group B

Streptococcus within human cervical epithelial cells. Cell Microbiolology, 4:751-758. Borkowska D, Polski and Janus E (2006). Microorganisms isolated from cow quarter milk and their susceptibility to antibiotics.

AnnalesUniversitatisMariae Curie SkodowskaSectio EE Zootechnica, 24:27-32. Bradley AJ, Leach KA, Breen JE, Green LE and Green MJ (2007). Survey of the incidence and etiology of mastitis in dairy' farms in England and Wales. Veterinary Record, 160 (8):253-257.

199

Carter GR and Cole JR (1990). Diagnostic procedures in veterinary bacteriology and mycology. 5th Edition. Academic press Inc: 469478.

Calvinho LF, Almeida RA and Oliver SP (1998). Potential virulence factors of Streptococcus dysgalactiae associated with bovine mastitis. Veterinary Microbiology, 61(1-2):93-110.

Chen YY, Yang ZT, Liu WB, Chang QC, Wang LG and Zhang NS (2012).Prevalence and Major Pathogen Causes of Dairy Cows Subclinical Mastitis in Northeast China. Journal of Animal and Veterinary Advances, 11 (8): 1278-1280.

Cleary P and Cheng Q (2006).Medically Important Beta-Hemolytic Streptococci. Prokaryotes, 4: 108-148.

Cowan ST (1979). Manual for identification of Medical bacteria.Cambridge University press.

Demme B and Abegaz S (2015).Isolation and Identification of Major Bacterial Pathogen from Clinical Mastitis Cow Raw Milk in Addis Ababa, Ethiopia. Academic Journal of Animal Diseases, 4(1): 44-51.

Ding Y, Zhao J, He X, Li M, Ghan H, Zhang Z and Li P (2016). Antimicrobial resistance and virulence-related genes of Streptococcus obtained from dairy cows with mastitis in Inner Mongolia, China. Pharmaceutical Biology, 54(1):162-167.

Duarte RS, Bellei BC, Miranda OP, Maria-Brito AVP and Lucia -Teixeira M (2005). Distribution of Antimicrobial Resistance and Virulence-Related Genes among Brazilian Group B Streptococci Recovered from Bovine and Human Sources. Antimicrobial agent and Chemotherapy, 49(1): 97-103.

Duarte RS, Miranda OP, Bellei BC, Brito MAVP and Teixeira LM (2004). Phenotypic and molecular characteristics of Streptococcus agalactiae isolates recovered from milk of dairy cows in Brazil. Journal of Clinical Microbiology, 42 (9): 4214-4222.

El-Bagory AM and Zayda MG (2015). Impact of Subclinical Mastitis on Cow's and Buffalo's Milk Quality. 2nd Conference of Food Safety, Suez Canal University, Faculty of Veterinary Medicine, 1: 67-75.

El-Behiry A, Elsayed M, Marzouk E and BathichY (2015). Detection of Virulence Genes in Staphylococcus aureus and Streptococcus agalactiae isolated from mastitis in the Middle East. British Microbiology Research Journal, 10(3): 1-9.

El-Gedawy AA, Ahmed HA and Awadallah MAI (2014). Occurrence and molecular characterization of some zoonotic bacteria in bovine milk, milking equipments and humans in dairy farms, Sharkia, Egypt. International Food Research Journal, 21(5): 18131823.

El-Jakee J, Hableel HS, Kandil M, Hassan OFA, Khairy E and Marouf SA (2013). Antibiotic Resistance Patterns of Streptococcus agalactiae Isolated from Mastitic Cows and Ewes in Egypt. Global Veterinaria, 10 (3): 264-270.

Ericsson Unnerstad H, Lindberg A, Persson Waller K, Ekman T, Artursson K, Nilsson-Ost M and Bengtsson B (2009). Microbial aetiology of acute clinical mastitis and agent-specific risk factors. Veterinary Microbiology, 137: 90-97.

Esron DK, Lughano JK, Robinson HM, Angolwisye MK, CaIvin S and Dominic MK (2005). Studies on mastitis, milk quality and health risks associated with consumption of milk from pastoral herds in Dodoma and Morogoro regions, Tanzania Journal of Veterinary Science, 6(3):213-221.

Hassan AA, Abdulmawjood A, Yildirim AO, Fink K, Lammler C and Schlenstedt R (2000). Identification of streptococci isolated from various sources by determination of cfb gene and other CAMP-factor genes. Canadian Journal of Microbiology, 46(10): 946-51.

Hussain SA, Willayat MM, Peer FU and Rashid R (2006). Antibiogram and microbiological studies of clinical mastitis. Indian Journal of Veterinary Medicine, 26(2): 104-105.

Jain B, Tewari A, Bhandari BB and Jhala MK (2012). Antibiotic resistance and virulence genes in Streptococcus agalactiae isolated from cases of bovine subclinical mastitis. Veterinarski Archive, 82 (5):423-432.

Jeykumar M, Vinodkumar G, Bashir BP and Krovvidi S (2013). Antibiogram of mastitis pathogens in the milk of crossbred cows in Namakkal district, Tamil Nadu. Veterinary World Journal, 6(6): 354-356.

Jiang ML, Babiuk A and Potter AA (1996). Cloning, sequencing and expression of the CAMP factor gene of Streptococcus uberis. Microbial Pathogenesis, 20: 297-307.

Jonsson H and Muller HP (1994). The type-III Fc receptor from Streptococcus dysgalactiae is also a K2-macroglobulin receptor. European Journal of Biochemistry, 220: 819-826.

Jonsson H, Frykberg L, Rantamaki l and Guss B (1994). MAG, Anovel plasma protein receptor from Streptococcus dysgalactiae. Gene, 143:85-89.

Khalil SA, El-Lakany HF and Shaaban HM (2014). Laboratory Differentiation between Streptococcus Species Isolated from Different Sources. Alexandria Journal of Veterinary Sciences, 43: 37-44.

Khan AZ and Muhammad G (2005). Quarter-wise comparative prevalence of mastitis in buffaloes and Crossbred cows. Pakistan Veterinary Journal, 25(1) 9-12.

Khan ZZ (2012). Group A Streptococcal Infections. Meadscape Drug, Diseases and Procedures.

Kia Gh, Mehdi Gh and Keyvan R (2014). Prevalence and antibiotic susceptibility of Streptococcus spp. in cows with mastitis in Germi, Iran. Animal and Veterinary Sciences, 2(2): 31-35.

Kivaria FM and Noordhuizen JP (2007). A retrospective study of the aetiology and temporal distribution of bovine clinical mastitis in smallholder dairy herds in the Dar es Salaam region of Tanzania. Veterinary Journal, 173(3): 617-22.

Klimiene I,Mockeliunas R, ButrimaiteAmbrozeviciene C and Sakalauskiene R (2005).The distribution of dairy cow mastitis in Lithuania. Veterinarija ir Zootechnika, (31): 67-76.

Koneman EW, Allen SD, Dowell VR and summer HW (1988). Color atlas and text book of diagnostic microbiology. Lippinicott, J.B. Company Philadelphia.

Koskinen MT, Holopainen J, Pyörälä S, Bredbacka P, Pitkälä A, Barkema HW, Bexiga R, Roberson J, Solverod L, Piccinini R, Kelton D, Lehmusto H, Niskala S and Salmikivi L (2009). Analytical specificity and sensitivity of a real-time polymerase chain reaction assay for identification of bovine mastitis pathogens. Journal of Dairy Science, 92:952-959.

200

Krishnaveni N, Isloor S, Hegde R, Suryanarayanan V, Rathnma D, Veeregowda B, Nagaraja C and Sundareshan S (2014). Rapid detection of virulence associated genes in Streptococcal isolates from bovine mastitis. African Journal of Microbiology Research, 8 (22): 2245-2254.

Kuang Y, Tani K, Synnott AJ, Ohshima K, Higuchi H, Nagahata H and Tanji Y (2009). Characterization of bacterial population of raw milk from bovine mastitis by culture-independent PCR-DGGE method. Biochemical Engineering Journal, 45(1): 76-81.

Kuzma K and Malinowski E (2001). Some factors affecting mastitis occurrence rate in cows. Bulletin of the Veterinary Institute in Puawy, 45(2): 297-305.

Lämmler C (1991). Biochemical and serological properties of Streptococcus uberis. Zentralblatt fur Veterinarmedizin Reihe B, 38: 737-42.

Manning S, Ki M, Marrs C, Kugeler K, Borchardt S, Baker C and Foxman B (2006). The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates. Bio Med Central Infectious Disease, 6: 116.

Matthews K, Jayarao B, Guidry A, Erbe E, Wergin W and Oliver S (1994). Encapsulation of Streptococcus uberis influence of storage and cultural conditions. Veterinary Microbiology, 39: 227-33.

McDougall S, Hussein H and Petrovski K (2014). Antimicrobial resistance in Staphylococcus aureus, Streptococcus uberis and Streptococcus dysgalactiae from dairy cows with mastitis. The New Zealand Veterinary Journal, 62 (2): 68-76.

Mirta-Lasagno MC, Reinoso EB, Dieser SA, Galvinho LF, Buzzola F, Vissio C, Bogni CI and Odierno LM (2011). Phenotypic and genotypic characterization of Streptococcus uberis isolated from bovine subclinical mastitis in Argentinean dairy farms. Revista Argentina de Microbiología, 43: 212-217.

Moges N, Asfaw Y and Belihu k (2011). A Cross Sectional Study on the Prevalence of Subclinical Mastitis and Associated Risk Factors in and Around Gondar, Northern Ethiopia. International Journal of Animal and Veterinary Advances, 3 (6): 455-459.

Mohanty NN, Das P, Pany SS, Sarangi LN, Ranabijuli S and Panda HK (2013). Isolation and antibiogram of Staphylococcus, Streptococcus and Escherichia coli isolates from clinical and subclinical cases of bovine mastitis. Veterinary World, 6(10): 739743.

Momtaz H, Froutan MS, Taktaz T and Sadeghi M (2012). Molecular detection of Streptococcus uberis and Streptococcus agalactiae in the mastitic cow's milks in Isfahan province. Biological Journal for Microorganism, 2: (1).

Musher DA, "Streptococcus pneumoniae," In: Mandell GL, Bennett JE and Dolin R (2005). Eds., Mandell, Douglas and Bennett's Principles and Practice of Infectious Diseases, 6th Edition, Churchill Livingstone, Philadelphia, 2392-2411.

Nithinprabhu K, Isloor S, Hegde R and Suryanarayana W (2010). Standardization of PCR and phylogenetic analysis of predominant streptococcal species isolated from subclinical mastitis. International Symposium on - Role of biotechnology in conserving biodiversity and livestock development for food security and poverty alleviation and XVII th Annual Convention of Indian Society of Veterinary Immunology and Biotechnology (ISVIB), Bikaner, Rajasthan, 50: 47.

Quinn PJ, Markey BK, Carter ME, Donelly WJC and Leonard FC (2002). Veterinary microbiology and microbial diseases. 1st Edn., Blackwell Science, 43-48.

Raemy A, Meylan M,Casati S, Gaia V,Berchtold B, Boss R,Wyder A and Graber H (2013). Phenotypic and genotypic identification of Streptococci and related bacteria isolated from bovine intra-mammary infections. Acta Veterinaria Scandinavica, 55: 53-61.

Ranjan R, Gupta MK and Singh KK (2011). Study of bovine mastitis in different climatic conditions in Jharkhand, Indian Veterinary World, 4(5.000): 205-208.

Reinoso E, Lasagno M, Dieser S and Odierno L (2011). Distribution of virulence-associated genes in Streptococcus uberis isolated from bovine mastitis. Federation of European Microbiological Societies Microbiology Letters, 318: 183-188.

Rogers DG, Zeman DH and Erickson ED (1992). Diarrhea associated with Enterococcus durans in calves. Journal of Veterinary Diagnostic Investigation, 4: 471-472.

Skalka B and Smola J (1981). Lethal effect of CAMP-factor and UBERIS-factor a new finding about diffusible exosubstance of Streptococcus agalactiae and Streptococcus uberis. Zentralbl Bakteriol A, 1981; 249: 190-4.

Shome BR, Bhuvana M, Mitra SD, Krithiga N, Shome R, Velu DC, Banerjee A, Barbuddhe SB, Prabhudas K and Rahman H (2012). Molecular characterization of Streptococcus agalactiae and Streptococcus uberis isolates from bovine milk. Tropical Animal Health Production, 44:1981-1992.

Smith A, Kitt A, Ward P and Leigh J (2002). Isolation and characterization of a mutant strain of Streptococcus uberis, which fails to utilize a plasmin derived beta-casein peptide for the acquisition of methionine. Journal of Applied Microbiology, 93:631-639.

Song XM, Casal JP, Bolton A and Potter AA (2001). Surface-Expressed mig protein protects Streptococcus dysgalactiae against phagocytosis by bovine neutrophils. Infection and Immunity, 69 (10): 6030-6037.

Tenhagen BA, Koster G, Wallmann J and Heuwieser W (2006). Prevalence of mastitis pathogens and their resistance against antimicrobial agents in dairy cows. Journal of Dairy Science, 89(7): 254-255.

Wahba Nahed M, All MM and Abdel-Hafeez MM (2005). Microbiological profile of subclinical mastitic cow milk and its correlation with field tests and somatic count. Assiut Veterinary medical journal, 51(104): 62-75.

Ward P, Field T, Ditcham W, Maguin E and Leigh J (2001). Identification and disruption of two discrete loci encoding hyaluronic acid capsule biosynthesis genes hasA, has B, and hasC in S. uberis. Infection and Immunity, 69: 392-399.

Wyder AB, Boss R, Naskova J, Kaufmann T, Steiner A and Graber HU (2011). Streptococcus spp. and related bacteria: their identification and their pathogenic potential for chronic mastitis - a molecular approach. Research in Veterinary Science, 91:349-357.

Yanliang Bi, Ya Jing Wang, Yun Qin, Roger GuixVallverdú, Jaime Maldonado García, Wei Sun, Shengli Li and Zhijun Cao (2016). Prevalence of Bovine Mastitis Pathogens in Bulk Tank Milk in China. Plos one, 11(5): e0155621. doi:10.1371/journal.pone.0155621

201

Zadoks RN, Gillespie BE, Barkema HW, Sampimon OC, Oliver SP and Schukken YH (2003). Clinical, epidemiological and

molecular characteristics of Streptococcus uberis infections in dairy herds. Epidemiology and Infection, 130(2): 335-349. Zadoks RN, Middleton JR, Mcdoujall S, Katholm J and Schukken YH (2011). Molecular epidemiology of mastitis pathogens of dairy cattle and comparative relevance to humans. Journal of Mammary Gland Biology and Neoplasia, 16 (4): 357-72.

202