CC BY
22018, Scienceline Publication
Worlds Veterinary Journal
World Vet J, 8(1): 09-18, March 25, 2018
Molecular Characterization of Staphylococci Isolated from Cattle with Mastitis
Mohamed M. Ali1, Salwa M.Helmy2, Ibrahim E. El Desouky2* and Hanaa A. Asfour3
1Microbiology Department, Animal Health Research Center, Kafr Elsheikh, Egypt
2Bacteriology, Mycology and Immunology Department, Faculty of Veterinary Medicine, Kafrelsheikh University 33516, 3Department of Mastitis and Neonatal Diseases, Animal Reproduction Research Institute (ARRI), Giza, Egypt *Corresponding author's Email: [email protected]
ABSTRACT
This study was carried out in order to investigate the occurrence of some virulence genes of Staphylococci isolated from cattle with mastitis. A total number of 133 milk samples (45 from clinical mastitis and 88 from subclinical mastitis) were collected from dairy cattle in Kafr El-Sheikh and EL Gharbia Governorates, Egypt. The samples were examined for the presence of Staphylococci by classical bacteriological methods and were further characterized geno-typically. A total of 41 Staphylococcus isolates were recovered from cattle with mastitis with an incidence of 30.8%. Among the isolates, 21(15.8%) of S. aureus [6 from clinical mastitis (13.3%) and 15 from subclinical mastitis (17%)] and 20 (15%) isolates of CNS [8 from clinical mastitis (17.7%) and 12 from subclinical mastitis (13.6%)] were identified phenotypically. All isolates were screened for the detection of binding protein A (spa-X), haemolysine type A (hla), Haemolysine type B (hlb), and toxic shock syndrome (tsst-1) by PCR. The obtained results revealed that the spa Xgene was detected in all Staphylococcus isolates recovered from subclinical mastitis while in clinical mastitis was detected with an incidence of 42.9%. Haemolysine type A was detected in clinical and subclinical mastitis with an incidence of 71.4% and 70% respectively, while haemolysine type B was detected in clinical and subclinical mastitis with an incidence of 28.5% and 40% respectively. Toxic shock syndrome was not detected in any of the isolates. The data in the study provided an overview on the distribution of some virulence genes related to Staphylococci isolated from cattle with mastitis in Egypt. Key words: Cattle, Mastitis, Staphylococci, Virulence gene, PCR
INTRODUCTION
A wide variety of organisms have been identified as potential mastitis pathogens including E. coli, S. aureus (Radostitis, 2008; Erskine et al., 2002 and Gitau et al., 2003). Staphylococcal mastitis is a major concern in dairy farming and a serious source of subclinical and clinical Intra-Mammary Infections (IMI) in dairy cows leading to severe economic losses to the dairy industry worldwide (Momtaz et al., 2010; Atasever, 2012; Memon et al., 2013). Several epidemiological studies have suggested that S. aureus is the most prevalent in intramammary infections being related to more than 80% of the cases (Song et al., 2016). Recently published work has shown that 3 % of all animals are infected with S. aureus (Schukken et al., 2009), however, S. aureus represents 10 to 12 % of all clinical mastitis infections (Tenhagen et al., 2009).
Staphylococci have a capacity to produce a large number of putative virulence factors including surface-associated adhesins, a capsular polysaccharide, exo-enzymes, and exo-toxins. Some of these factors may be of more importance than others in different diseases or at different stages of the pathogenesis of particular infections, as not all factors are
ISSN 2322-4568
p R
C R 2 c e 2 &
t g. 2 N
^ < 2
SS 2 A
5 ~
G\
2 9
F
b 22
8
F S"1 1-1 —-b S 0 T i
C ■ L
8
S 8 - L
uberis and S.
9
produced by each strain (Fitzgerald et al., 2000; Kalorey et al., 2007). One of the important virulence factors is staphylococcal exo-protein A (spa) which is a bacterial cell wall product that binds to the FC region of immunoglobulin G and impairs opsonisation by serum complement and phagocytosis by polymorphnuclear leukocytes (Alonso and Daggett, 2000; Eman et al., 2015). Therefore, low expression of protein A on the cell on surface of S. aureus resulted in greater number of free receptor sites for complement C3b and in increase in phagocytosis(Gao and Stewart, 2004).Staphylococcal hemolysins are identified as important virulence factors that contribute to bacterial invasion and escape from the host immune response (Rodrigues and da Silva, 2005). Alpha-hemolysin is the most studied and characterized S. aureus cytotoxin and is considered as a main pathogenic factor because of its hemolytic, dermonecrotic, and neurotoxic effects (Dinges et al., 2000). Additionally, beta hemolysin is a sphingomyelinase that is highly active against bovine erythrocytes (Larsen et al., 2002). The staphylococcal enterotoxins (SEs) are recognized agents of the staphylococcal food poisoning syndrome and may be involved in other types of infections with sequelae of shock in humans and animals (Bergdoll, 1981; Marrack and Kappler, 1990). A distantly related protein, toxic shock syndrome toxin-1 (tsst-1), also produced by S. aureus, was the first toxin shown to be involved in toxic shock syndrome, in both menstrual and non-menstrual cases (Bergdoll et al., 1981 and Schlievert et al., 1981). However, no immunological identity and little amino acid homology between tsst-1 and the staphylococcal enterotoxins exist (Blomster-Hautamaa et al., 1986).
The importance to evaluate Staphylococcus pathogenic activity assessing the combination of virulence genes has been emphasized both in human and in veterinary medicine (Zecconi et al., 2006; Piccinini et al., 2009). The genotype of Staphylococcus affects its prevalence and the number of infected quarters within a herd (Fournier et al., 2008). As information about the genetic variability of different Staphylococcus populations would help in the design of efficient therapeutic approaches and improvement of control measure. Few reports exist on the prevalence of Staphylococci among cattle with mastitis in Egypt. Consequently, the purpose of the present study was to investigate the prevalence and molecular characterization of Staphylococci isolated from dairy cattle with clinical and subclinical mastitis in Kafr El-Sheikh and EL Gharbia governorates, Egypt.
MATERIALS AND METHODS
Ethics committee approval
Ethical approval handlings of animals were according to the guidelines of animal ethics committee, faculty of veterinary medicine, Kafrelsheikh University, Egypt.
Sampling and bacterial isolation
A Total of 133 milk samples were collected aseptically from lactating cow (45 from cows with clinical mastitis and 88 from cows with sub clinical mastitis) in Kafr El-Sheikh and EL Gharbia Governorates, Egypt (Table 1). The samples were collected into sterile plastic tubes and submitted to the laboratory on ice packs as soon as possible for further bacteriological examinations. Samples were processed within 24-48 hours after reception. For subclinical mastitis, apparently normal milk samples were tested by using the California Mastitis Test (CMT), and were graded as negative, trace, weak, distinct, or strongly positive (Persson et al., 2011). Isolation of Staphylococcus was attempted from the CMT positive milk samples.
Milk samples were centrifuged; sediment was diluted with equal amount of sterile distilled water and streaked on Mannitol Salt Agar (Oxoid) at 37°C for 48 h. Suspected colonies were selected and picked onto nutrient agar slants, all slants were incubated aerobically at 37°C / 24 h for further identification. The isolates were identified as S. aureus based on their cultural, morphological and biochemical characteristics (tube coagulase, urease, sugar fermentation, catalase tests). Haemolytic activity was evaluated by plating suspected staphylococcal strains on plates of nutrient agar supplemented with 10% sterile sheep blood according to Quinn et al. (1994). Types of haemolysins were identified according to the lysis zone of each Staphylococcus isolates on the blood agar plate after 24 h incubation at 37°C aerobically.
Table 1. Number and type of samples collected from cattle with mastitis
Farms
Clinical Samples
Subclinical samples
Total samples
Kafr El-Sheikh farms farms
30 15 45
61 27 88
91 42 133
El Gharbia farms
Total
10
Molecular detection of Staphylococci virulence genes using PCR
DNA extraction. DNA extraction from samples was performed by using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) with modifications from the manufacturer's recommendations. Briefly, 200 ^l of the sample suspension was incubated with 10 ^l of proteinase K and 200 ^l of lysis buffer at 56 °C for 10 min. After incubation, 200 ^l of 100% ethanol was added to the lysate. The sample was then washed and centrifuged following the manufacturer's recommendations. Nucleic acid was eluted with 100 ^l of elution buffer provided in the kit.
Molecular identification was conducted for the detection of the S. aureus16S rRNA gene by using species-specific primers described by Wada et al. (2010) and Pradhan et al. (2011). All Staphylococcus isolates were analyzed for four virulent genes including, spaX (X-region of protein A), hla gene (encoding a haemolysin), hlb gene (gene encoding p haemolysin) and tsst-1 gene (encoding toxic shock syndrome toxin). Several PCR protocols were used to detect the target genes of Staphylococcus isolates. PCR amplification was performed with PTC-100 programmable thermal cycler (Peltier Effect cycling, MJ, Research, INC, UK). DNA amplification was performed in a final reaction volume of 25 ^l consisting of: 12.5^l of Emerald Amp GT PCR master mix (2X premix), 1 ^l of 20 pmol of each primer, 6 ^l of the DNA template and water, nuclease-free up to 25^l. In the present study, the primer pairs used in PCR protocols were selected from published papers based on specificity, compatibility and ability to target the genes of interest. The nucleotide sequences and anticipated molecular sizes of PCR amplified fragments for these gene-specific oligonucleotide primer sets are outlined in table 2. The cycling condition of each gene has been listed in table 3. After PCR reactions, the amplified products were separated by agarose gel electrophoresis (1.5% agarose gel containing 0.5 mg/ml ethidium bromide in 0.5 X Tris EDTA electrophoresis buffer) at 5V/ cm for 1.5 hand visualized under UV trans-luminator. A 100-bp DNA ladder (Fermentas, USA) was used as molecular weight marker.
Table 2. Target genes, primers sequences, and amplicon sizes of Staphylococci virulence determinants
Target genes
Primers sequences
Amplified segment (bp)
References
16S rRNA
TTCGTACCAGCCAGAGGTGGA
____AGCGCAT£ACCAATCCC"
229
Wada et al. (2010)
______
spa (X region)
CAA GCA CCA AAA GAG GAA
......CACCAGGTTTAACGACAT.......
226
Booth et al. (2001)
hla
GGTTTA GCC TGG CCT TC
CAT CAC GAA CTC GTT CG
550
Akineden et al. (2001)
.......pradhan"etaïr(20T1).......
hlb
GCC AAA GCC GAA TCT AAG
____TATAC ATCCCATGG"_
850
Wada et al. (2010)
.Booth"et'"äi."(2ööT)"
tsst-1
ATGGCAGCATCAGCTTGATA
.....TTTCCAATAACCACCCGTTT......
350
Booth et al. (2001)
S. aureus nuc GCGATTGATGGT GATACGGTT gene ...................agccAaGCCTTGAcGAACTAA aGc"
267
Brakstad et al. (1992)
Table 3. Cycling conditions of Staphylococci virulence determinants
Primary Amplification (35 cycles)
Target gene - Final extension
denaturation Secondary denaturation Annealing Extension
16S rRNA 95°C, 4 min. 95°C, 45 sec. 50°C, 60 sec. 72°C, 30 sec. 72°C, 10 min.
spa (X region) 94°C, 4 min. 94°C, 30 sec. 55°C, 30 sec. 72°C, 30 sec. 72°C, 10 min.
hla 94°C, 4 min. 94°C, 45 sec. 50°C, 45 sec. 72°C, 60 sec. 72°C, 10 min.
hlb 94°C, 4 min. 94°C, 45 sec. 57°C, 60 sec. 72°C, 80 sec. 72°C, 10 min.
tsst-1 94°C, 4 min. 94°C, 2 min. 55 °C, 2 min 72°C, 60 sec. 72°C, 10 min.
11
RESULTS
Bacteriological identification of Staphylococcus isolates
A total of 41 Staphylococcus isolates were recovered from the milk of 133 mastitic cattle in a prevalence rate of 30.8 %. Among the isolates, 21 were identified as Staphylococcus aureus based on cultural, morphological and biochemical characteristics in a prevalence rate of 15.8%, while the rest of the isolates (20 isolates) identified as Coagulase Negative Staphylococci (CNS) (15%). All the S. aureus isolates were positive for tube coagulase test; these strains were confirmed by PCR (Figure 1). Among the examined cattle, 6 S. aureus isolates were recovered from 45 cattles with clinical mastitis (13.3%) and 15 isolates were recovered from 88 cattles with subclinical mastitis (17 %). On the other hand, 8 and 12 isolates of CNS were isolated from cattle with clinical and subclinical mastitis in a prevalence rate of 17.7% and 13.6% respectively (Table 4).
Molecular detection of Staphylococcus virulence genes
Staphylococcus genus specific primers targeting 16S rRNA were employed for the specific confirmation of the Staphylococcus DNA. All the examined isolates yielded a specific single DNA band of 229 bp amplicon. Furthermore, a second confirmatory PCR for confirmation of atypical S. aureus was used (Figure 1). All Staphylococcus isolates were subjected to PCR for the detection of four virulent genes (spaX, hla, hlband tsst-1). All of the isolates were found to be positive for one or more virulence-associated genes (Table 5). Among the examined 21 isolates of S. aureus, spaX gene was the predominant one, detected in 17 isolates with an incidence of 81 % (Figure 2).
SpaX gene was detected in all isolates of S. aureus recovered from subclinical mastitis (100%) while detected in 2 out of 6 isolates from clinical mastitis (33.3%). With regard to hla, it was detected from S. aureus isolated from clinical and subclinical mastitis with an incidence of 33.3% and 60% respectively (Figure 3). On the other hand, hlb gene was detected in S. aureus recovered from clinical mastitis and subclinical mastitis with an incidence of 16.6% and 46.6% respectively (Figure 4).
Regarding to incidence of virulent genes in CNS isolates, spa X gene was detected in all the isolates of Staphylococcus recovered from subclinical mastitis (100%) while in clinical mastitis, 4 out of 8isolates were positive (50%). Haemolysine type A was detected in all isolates of CNS from clinical mastitis (100%) while in subclinical mastitis, 5 isolates gave positive amplicons out of 12 (41.6%). With regard to hlb gene, it was detected in CNS isolates of clinical and subclinical mastitis with an incidence of 37.5% and 8.3%, respectively. All the isolates tested, failed to amplify tsst-1(Table 5).
Table 4. Incidence of Staphylococci in cattle with mastitis
Types of samples No. of samples S. aureus CNS Total isolates
No % No % No %
Clinical mastitis 45 6 13.3 8 17.7 14 31.1
Subclinical mastitis 88 15 17 12 13.6 27 30.7
Total 133 21 15.8 20 15 41 30.8
Table 5. Distribution of virulence determinant genes in Staphylococcus isolates
Items Clinical Mastitis Subclinical mastitis
S. aureus (6*) CNS (8) Total (14) S. aureus (15) CNS (12) Total (27)
No % No % No % No % No % No %
spa (X region) 2 33.3 4 50 6 42.9 15 100 12 100 27 100
hla 2 33.3 8 100 10 71.4 9 60 5 41.66 14 70
hlb 1 16.6 3 37.5 4 28.5 7 46.66 1 8.3 8 40
tsst-1 0 0 0 0 0 0 0 0 0 0 0 0
*Among the isolates, 21of S. aureus (15.8%) [6 from clinical mastitis (13.3%) and 15 from subclinical mastitis (17%)] and 20 isolates of CNS (15%) [8 from clinical mastitis (17.7%) and 12 from subclinical mastitis (13.6%)] were identified phenotypically.
12
Ml 234 5 6 789 10 11 12
bp
Figure 1. Agarose gel electrophoresis of duplex PCR amplification of 16S rRNA gene of Staphylococci (228 bp) and S. aureus specific nuc gene (267 bp). Lane M: 100 bp DNA ladder, Lanel, 2and 11: positive isolates for S. aureus. Lanes: 1-11 are positive isolates for genus Staphylococci (228 bp).
Ml 2345 6 7 89 lO
bp
200 TOO
Figure 2. Agarose (1.5%) gel electrophoresis of spa X gene of Staphylococcus PCR products (226 bp). Lane M: 100 bp DNA markers, Lane 1, 3-8: positive samples, lanes 2 and 10: negative samples.
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
-" -—, ——* — -***
bp
500 400 300 200 100
550 bp
Figure 3. Agarose (1.5%) gel electrophoresis of hla gene of Staphylococcus PCR products (550 bp). Lane M: 100 bp DNA marker, Lanes: 1, 3, 9-14 and 18-19: negative isolates, lanes: 2, 4-8 and 15-17: positive isolates.
13
M 1 2 3 4 5 6 7 8 9 10 11 12 13
bp
850 bp
800
500 400 300
200 lOO
Figure 4. Agarose (1.5%) gel electrophoresis of hlb gene of Staphylococcus PCR products (850 bp). Lane M: 100 bp DNA marker, lanes 1-4 and 7-13: Positive isolates, lanes 5 and 6: negative isolates.
DISCUSSION
Cattle mastitis remains a serious and common disease in animals with significant economic losses in dairy industry worldwide (Momtaz et al., 2010; Atasever, 2012); therefore, knowing that mastitis causing bacteria and their virulent determinants using molecular methods is crucial to control the IMI (Ayman et al., 2015). A wide variety of organisms including Staphylocooci, Streptococci, E.coli, Enterobacter spp., Klebsiella spp., Mycoplasma spp. and Corynebacterium spp. are responsible for mastitis in animals. Among several bacterial pathogens that can cause mastitis, Staphylococcus species being the most lethal agent because it causes chronic and deep infection in the mammary glands that is extremely difficult to be cured (Momtaz et al., 2010).
The isolation of Staphylococci from milk alone is unequivocal in determining its role in the pathogenesis, therefore, Staphylococci virulent gene surveillance could be helpful in detecting genetic diversity among these major mastitis causing pathogens to develop effective control strategies against mastitis caused the pathogen (Khan et al., 2013).
In Egypt it was confirmed that S.aureus is considered as the predominant factor among mastitis causing pathogens followed by S. agalactiae (Elhaig and Selim, 2015) and E.coli (Hamed and Ziatoun, 2014). In the present study, out of 133 milk samples collected from cattle with mastitis, 41 Staphylococcus isolates were identified in a prevalence rate of 30.8%. This result was similar to the finding obtained by Barkema et al. (2009), however, a higher incidence rate was also recorded by Zecconi and Hahn (2000). Among the isolates, 21(51.2%) identified as S. aureus and 20 (48.78%) isolates as CNS based on biochemical tests and molecular identification.
In the current study, it was noticed that 15.7% (21/133) of S. aureus isolates were isolated and identified from cattle with mastitis. Similar results were reported by Botrel (2010), Nibret et al. (2011), Persson et al. (2011) and Hamid et al. (2017) who isolated S. aureus with an incidence of 15.8%, 16.5%, 19% and 22.5% respectively. However, higher detection rate was reported by other authors (Ahmed and Mohamed, 2009; Ashraf et al., 2016) who isolated S. aureus with an incidence of 77.1% and 52.5% respectively. Different PCR-based systems for the identification of S. aureus isolates from various origins have been used by numerous authors (Akineden et al., 2001; Nashev et al., 2004; Momtaz et al., 2010). As was found by Brakstad et al. (1992), the amplification of the gene encoding an S. aureus-specific part of the 16S rRNA revealed an amplicon with a size of 1,250 bp for all S. aureus isolates investigated.
The subclinical mastitis has special importance as it goes unnoticed and affects in a great extent the production's animal (Bhati et al., 2016). In subclinical mastitis, 15 isolates of S. aureus out of 88 samples were identified in a prevalence rate of 17%. Similar finding was reported by (Ak, 2000; Busato et al., 2000) who isolated S.aureus with a percentage of 13.3% and 16% respectively. In contrast to our data, several studies have demonstrated higher incidence of S. aureus in subclinical mastitis (Mokhbatly et al., 2001; Karimuribo et al., 2005; Khan and Muhammad, 2005; Ahmed and Mohamed, 2009; Alemu et al., 2014). In clinical mastitis, the incidence of S. aureus was 13.3% (6/45). This record agreed with the finding reported by Nevala et al. (2004), however, other studies have reported higher detection rates of S. aureus in clinical mastitis (Workineh et al., 2002; Elsayed et al., 2015). These variations are likely due to geographical area differences and time of sampling. In the last few years, the prevalence of CNS in mastitis was higher than those caused by S. aureus. In the present study, the prevalence of S. aureus and CNS in clinical mastitis was 13.3% and 17.7%
14
respectively. Similar finding was also reported by Persson et al. (2011). In other studies, incidence of S. aureus was higher than that of CNS in clinical mastitis (Botrel et al., 2010; Rajeev et al., 2011; Eman et al., 2015).
Epidemiologic studies indicates that S. aureus strains agents of mastitis produce a group of virulence factors and it is believed that there is a relationship between the severity of mastitis and the virulence factors produced by S. aureus (Akineden et al., 2001). In the present study, molecular surveillance carried out in all isolates of Staphylococci to screen the presence of four putative virulence determinants encoding spa (the X-region of protein A) hla gene (encoding a haemolysin), hlb gene (gene encoding p haemolysin) and tsst-1 gene (encoding toxic shock syndrome toxin) by PCR. The distribution of virulent genes differed among the examined strains, some genes were present in all of the strains, but some genes were not found in any strain. The spaX gene typing in current study amplified (150-315bp) (Bhati et al., 2016). The genes spaX-region was detected in all isolates recovered from the samples of subclinical mastitis, it was consistent with the finding described by several authors (Coelho et al., 2011; Memon etal., 2013; Ashrafet al., 2016) that established the presence of spaX gene in nearly all of the isolates. Other reports in several countries including Italy (Dalla Pozza et al., 1999) India (Kumar et al., 2010) and Poland (Kahl et al., 2016), have previously identified this gene by 93-100% of S. aureu s isolated from subclinical form. The high incidence of spaX gene in S. aureus isolated from subclinical mastitis points to the potential role of this gene in this bacterium in a subclinical form, which unlike clinical mastitis, is milder and more difficult to detect.
Unlike the subclinical form, spaX was detected in S. aureus and CNS isolates in clinical mastitis with an incidence of 33.33% and 50% respectively. This is in contrast to the results described by (Stephan et al., 2001; Kalorey et al., 2007; Klein et al., 2012) who identified spaX in Staphylococcus isolates with an incidence of 76.5%, 70.3% and 85.9% respectively. In previous studies conducted by Salasia et al. (2011); Yang et al. (2012) and Wang et al. (2016), high frequency of hla was observed in S. aureus isolated from clinical mastitis (100%, 85%, and 94.3%, respectively). In our study, hla was observed in a percentage of 33.3%. However, hla was detected in all CNS isolates (100%). This finding might indicate the significant role of CNS isolates in the pathogenesis of bovine mastitis compared to S. aureus isolates. In subclinical mastitis, hla was detected in S. aureus and CNS with an incidence of (60%) and (41.66%) respectively, this result disagreed with Haveri et al. (2007); Salasia et al. (2011); Memon et al. (2013) they had recorded hlaas 76%, 84% and 58% respectively. However; a higher frequency was recorded by Elsayed et al. (2015) and Ahmed et al. (2016). These different frequencies may be due to the different animal populations studied or the implemented methodologies, among other factors.
With regard to hlb in clinical mastitis, it was detected in S. aureus and CNS with an incidence of (16.66%) and (37.5%) respectively, these results correspond significantly with similar results obtained by Coelho et al. (2011). However, other investigators (Elsayed et al., 2015; Wang et al., 2016) have reported a relatively high incidence of this gene, while in subclinical mastitis, hlb was detected in S. aureus and CNS isolates with an incidence of (46.66%) and (8.3%) respectively, this percentage is higher than the one recorded by Coelho et al. (2011); Ahmed et al. (2016), however, in other studies, higher percentages of hlb in S. aureus isolates (Larsen et al., 2002, Salasia et al., 2011; Memon et al., 2013; Wang et al., 2016) were observed (97%, 84%, 71% and 79.1%, respectively). Toxic shock syndrome toxin (tsst-1) is one of the enterotoxogenic toxins responsible for food poisoning and is very important in the virulence of Staphylococci. In agreement with other studies (Nashev et al., 2004; Hassan et al., 2010; Gunaydin et al., 2011), we observed that the tsst-1 gene was not found in any isolate (0 %). However, these results are in disagreement with an earlier finding reported by Stephan et al. (2001) and Wang et al. (2016) that described higher tsst-1 gene positivity among S. aureus isolates (67.7% and 40% respectively).
CONCLUSION
Thus, in conclusion, the study provides a valuable insight into the virulence-associated genes of Staphylococci. The findings of this study indicated that all of the Staphylococcus isolates harbored one or more virulence-associated genes in dairy herds of cows suffering from clinical mastitis. The results also indicated that there is a direct relationship between the presence of spaX gene, it was the most frequent gene detected in examined isolates, and bovine mastitis especially subclinical type. Therefore, spa X gene could be considered as a good diagnostic method for typing of Staphylococcus isolates, which provided important results for the effective control of staphylococcal mastitis.
DECLARATIONS
Acknowledgments
The authors are grateful to all staff members of Bacteriology, Mycology and immunology department, Faculty of Veterinary Medicine, Kaferelshikh University, for their support.
15
Author's contribution
Salwa M.Helmy and Ibrahim E. El Desouky planned and supervised the experiments and wrote the paper.
Mohamed M. Ali and Hanaa A.Asfour performed the experiments and/or analyzed the data.
Competing of interest
The author declares that he has no conflict of interest with respect to the research, authorship, and/or publication of
this article, the author declares that he has no competing interests.
REFERENCES
Ahmed A and Mohamed S (2009). Epidemiological Studies on Subclinical Mastitis in Dairy cows in Assiut Governorate. Veterinary World, 2: 373-380.
Ahmed HFK, Gafer J, Ibrahim S and Abu El-Magd M (2016). Genotypes and Virulence Factors of Staphylococcus aureus Isolated from Bovine Subclinical Mastitis. Global Veterinaria, 17: 476-481.
Ak S (2000). Bacterial agents cause contagious and environmental bovine mastitis in Trakya district and their susceptibility to antibiotics. Journal of Faculty of Veterinary Medicine I stanbul University, 26: 353-365.
Akineden O, Annemuller C, Hassan AA, Lammler C, Wolter W and Zschock M (2001). Toxin genes and other characteristics of Staphylococcus aureus isolates from milk of cows with mastitis. Clinical and Diagnostic Laboratory Immunology, 8: 959-964.
Alemu G, Almaw G and Abera M (2014). Incidence rate of Staphylococcus aureus and Streptococcus agalactiae in subclinical mastitis at smallholder dairy cattle farms in Hawassa, Ethiopia,academic journal,8(3):252-256.
Alonso DO and Daggett V (2000). Staphylococcal protein A: unfolding pathways, unfolded states, and differences between the B and E domains. Proceedings of the National Academy of Sciences USA, 97, 133-138. http://dx.doi.org/10.1073/pnas.97.L133.
Ashraf AA, Maarouf A, El-Hofy F and Abbas S (2016). Molecular detection of some virulence genes of S. aureus isolated from mastitic Cows by PCR. Benha Veterinary Medical Journal, 30: 238-245.
Atasever S (2012). Estimation of Correlation Between Somatic Cell Count and Coagulation Score of Bovine Milk. International Journal of Agriculture &Biology,14: 315-317.
Ayman E, Mohamed E, Eman and Yaser B (2015). Detection of Virulence Genes in Staphylococcus aureus and Streptococcus agalactiae Isolated fromMastitis in the Middle East. British Microbiology Research Journal, 10(3): 1-9.
Barkema HW, Green MJ, Bradley AJ and Zadoks RN (2009). Invited review: The role of contagious disease in udder health. Journal of Dairy Science, 92: 4717-4729.
Bergdoll MS, Crass BA, Reiser RF, Robbins RN and Davis JP (1981). A new staphylococcal enterotoxin, enterotoxin F, associated with toxic-shock-syndrome Staphylococcus aureus isolates. Lancet, 1: 1017-1021.
Bhati T, Nathawat P, Sharma SK, Yadav R, Bishnoi J and Kataria AK (2016). Polymorphism in spa gene of Staphylococcus aureus from bovine subclinical mastitis. Veterinary World, 9: 421-424.
Blomster-Hautamaa DA, Kreiswirth BN, Kornblum JS, Novick RP and Schlievert PM (1986). The nucleotide and partial amino acid sequence of toxic shock syndrome toxin-1. Journal of Biological Chemistry,261: 15783-6.
Booth MC, Pence LM, Mahasreshti P, Callegan MC and Gilmore MS (2001). Clonal associations among Staphylococcus aureus isolates from various sites of infection. Infection and Immunity, 69: 345-352.
Botrel MA, Haenni M, Morignat E, Sulpice P, Madec JY and Calavas D (2010). Distribution and antimicrobial resistance of clinical and subclinical mastitis pathogens in dairy cows in Rhone-Alpes, France. Foodborne Pathogens Disease, 7: 479-487.
Brakstad OG, Aasbakk K and Maeland JA (1992). Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. Journal of Clinical Microbiology, 30: 1654-1660.
Busato A, Trachsel P, Schallibaum M and Blum JW (2000). Udder health and risk factors for subclinical mastitis in organic dairy farms in Switzerland. Preventive Veterinary Medicine, 44: 205-220.
Coelho SM, Pereira IA, Soares LC, Pribul BR and Souza MM (2011). Short communication: profile of virulence factors of Staphylococcus aureus isolated from subclinical bovine mastitis in the state of Rio de Janeiro, Brazil. Journal of Dairy Science, 94: 3305-3310.
Dalla Pozza MC, Ricci A and Vicenzoni G (1999). Protein A gene polymorphism analysis in Staphylococcus aureus strains isolated from bovine subclinical mastitis.Journal of Dairy Research,66: 449-453.
Dinges MM, Orwin PM and Schlievert PM (2000). Exotoxins of Staphylococcus aureus. Clinical Microbiology Reviews, 13: 16-34.
Elhaig MM and Selim A (2015). Molecular and bacteriological investigation of subclinical mastitis caused by Staphylococcus aureus and Streptococcus agalactiae in domestic bovids from Ismailia, Egypt. Tropical Animal Health Production, 47: 271-276.
Elsayed MS, Mahmoud, EAE and Dawoud MA (2015). Phenotypic and genotypic detection of virulence factors of Staphylococcus aureus isolated from clinical and subclinical mastitis in cattle and water buffaloes from different farms of Sadat City in Egypt. Veterinary World, 8: 1051-1058.
Eman AE, Mousa W, Heba H and Saher R (2015). PCR for identification of virulence and antibiotic resistance genes of coagulase positive Staphylococcus aureus from clinical mastitis in Egypt. International Journal of Basic and Applied Science, 4: 315-319.
Erskine RJ, Walker RD, Bolin CA, Bartlett PC and White DG (2002). Trends in antibacterial susceptibility of mastitis pathogens during a seven-year period. Journal of Dairy Science, 85:1111-1118.
16
Fitzgerald JR, Hartigan PJ, Meaney WJ and Smyth CJ (2000). Molecular population and virulence factor analysis of Staphylococcus aureus from bovine intramammary infection. Journal of Applied Microbiology, 88:1028-1037. doi:http://dx.doi.org/10.1046/j.1365-2672.2000.01071.x
Fournier C, Kuhnert P, Frey J, Miserez R, Kirchhofer M, Kaufmann T, Steiner A and Graber HU (2008). Bovine Staphylococcus aureus: association of virulence genes, genotypes and clinical outcome. Research in Veterinary Science, 85: 439-448.
Gao J and Stewart GC (2004). Regulatory elements of the Staphylococcus aureus proteiA (Spa) promoter. Journal of Bacteriology, 186: 3738-3748.
Gitau GK, Waridi M, Makame HA, Saleh MM, Muhamed RA, Mkola AP and Haji MA (2003). Occurrence of high udder infection rates in dairy cows in Ungunja Island of Zanzibar, Tanzania. Journal of Applied Research in Veterinary Medicine, 1: 73-76.
Gunaydin B, Aslantas O and Demir C (2011). Detection of superantigenic toxin genes in Staphylococcus aureus strains from subclinical bovine mastitis. Tropical Animal Health and Production, 43: 1633-1637.
Hamed MI and Ziatoun AMA (2014). Prevalence of Staphylococcus aureus Subclinical Mastitis in Dairy Buffaloes Farms at different seasons at Assiut Governorate, Egypt. International Journal of Livestock Research, 4(3): 21-28.
Hamid S, Bhat MA, Mir IA, Taku A, Badroo GA, Nazki S, Malik A (2017) Phenotypic and genotypic characterization of methicillin-resistant Staphylococcus aureus from bovine mastitis, Veterinary World, 10(3): 363-367
Haveri M, Roslof A, Rantala L and Pyorala S (2007). Virulence genes of bovine Staphylococcus aureus from persistent and nonpersistent intramammary infections with different clinical characteristics. Journalof Applied Microbiology, 103:993-1000. doi: 10.1111/j.1365-2672.2007.03356.x
Kahl BC, Becker K and Loffler B (2016). Clinical Significance and Pathogenesis of Staphylococcal Small Colony Variants in Persistent Infections. Clinical Microbiology Review, 29: 401-427.
Kalorey DR, Shanmugam Y, Kurkure NV, Chousalkar KK and Barbuddhe SB (2007). PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases. Journal of Veterinary Science, 8: 151154. doi:http://dx.doi.org/10.4142/jvs.2007.8.2.151.
Karimuribo ED, Kusiluka LJ, Mdegela RH, Kapaga AM, Sindato C and Kambarage DM (2005). Studies on mastitis, milk quality and health risks associated with consumption of milk from pastoral herds in Dodoma and Morogoro regions, Tanzania. Journal of Veterinary Science, 6: 213-221.
Khan AZ and Muhammad G (2005). Quarter-Wise Comparative Prevalence of Mastitis in Buffaloes and Crossbred Cows. Pakistan Veterinary Journal, 25(1).
Khan A, Hussain R, Javed MT, Mahmood F. (2013). Molecular analysis of virulent genes(coa and spa) of Staphylococcus aureus involved in natural cases of bovine mastitis. Pakistan Journal of Agriculture Sciences,50(4): 739-743.
Klein RC, Fabres-Klein MH, Brito MA, Fietto LG and Ribon Ade O (2012). Staphylococcus aureus of bovine origin: genetic diversity, prevalence and the expression of adhesin-encoding genes. Veterinary Microbiology, 160:183-188.
Kumar R, Surendran PK and Thampuran N (2010). Evaluation of culture media for selective enrichment and isolation of Salmonella in seafood. J AOAC International, 93: 1468-1471.
Larsen HD, Aarestrup FM and Jensen NE (2002). Geographical variation in the presence of genes encoding superantigenic exotoxins and beta-hemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA. Veterinary Microbiology, 85: 61-67.
Marrack P and Kappler J (1990). The staphylococcal enterotoxins and their relatives. Science, 11(248): 705-711.
Memon J, Yang Y, Kashif J, Yaqoob M, Buriro R, Soomro J, Liping W and Hongjie F (2013). Genotypes, Virulence Factors and Antimicrobial Resistance Genes of Staphylococcus aureus Isolated in Bovine Subclinical Mastitis from Eastern China. Pakistan Veterinary Journal, 33:486-491.
Mokhbatly AA, Desouky ML, El-Sawak ML and Abou El-Azb MF (2001). Clinicopathological studies on subclinical mastitis in cattle and buffaloes in Kafr El-Sheikh Governorate. Suez Canal Veterinary Medical Journal, 4: 123-135.
Momtaz H, Rahimi E, Tajbakhsh E. (2010). Detection of some virulence factors in Staphylococcus aureus isolated from clinical and subclinical bovinemastitis in Iran. African Journal of Biotechnology,9:3753-3758.
Nashev D, Toshkova K, Salasia SI, Hassan AA, Lammler C and Zschock M (2004). Distribution of virulence genes of Staphylococcus aureus isolated from stable nasal carriers. FEMS Microbiology Letters, 233: 45-52.
Nevala M, Taponen S and Pyorala S (2004). Bacterial etiology of clinical mastitis - data from Saari Ambulatory Clinic in 2003-2004. Finnish Veterinary Journal, 363-369.
Nibret M, Yilikal A and Kelav B (2011). A Cross Sectional Study on the Prevalence of Sub Clinical Mastitis and Associated Risk Factors in and Aronund Gondar, Northern Ethiopia. International Journal of Animal and Veterinary Advances, 3: 455-459.
Persson Y, Nyman AK and Gronlund-Andersson U (2011). Etiology and antimicrobial susceptibility of udder pathogens from cases of subclinical mastitis in dairy cows in Sweden. Acta Veterinaria Scandinavica, 53: 36.
Piccinini R, Cesaris L, Dapra V, Borromeo V, Picozzi C, Secchi C and Zecconi A (2009). The role of teat skin contamination in the epidemiology of Staphylococcus aureus intramammary infections. Journal of Dairy Research, 76, 36-41.
Pradhan PGSM, Reddy GR, Dechamma HJ and Suryanarayana VVS (2011). Detection of major pathogens in bovine sub-clinical mastitis by multiplex PCR directly from milk samples in presence of an internal control. Indian Journal of Fundamental and Applied Life Sciences, 1: 209-218.
Quinn PJC, Markey BK and Carter GR (1994). Clinical Veterinary Microbiology. 1st Edn., London, Mosby, 22-91.
Radostits OM, Blood DC and Gay GC (2008). Veterinary Medicine. A Textbook of the Diseases of cattle, sheep, pigs, goats and horses. 10th Ed., Bailliare Tindall, London.
Rajeev R, Gupta MK and Singh KK (2011). Study of bovine mastitis in different climatic conditions in Jharkhand, India. Veterinary World, 4: 205-208.
17
Rodrigues da Silva E and da Silva N (2005). Coagulase gene typing of Staphylococcus aureus isolated from cows with mastitis in southeastern Brazil. Canadian Journal of Veterinary Research, 69: 260-264.
Salasia SI, Tato S, Sugiyono N, Ariyanti D and Prabawati F (2011). Genotypic characterization of Staphylococcus aureus isolated from bovines, humans, and food in Indonesia. Journal of Veterinary Science, 12: 353-361.
Schlievert PM, Shands KN, Dan BB, Schmid GP and Nishimura RD (1981). Identification and characterization of an exotoxin from Staphylococcus aureus associated with toxic-shock syndrome. Journal of Infectious Diseases, 143: 509-516.
Schukken YH, Gonzalez RN, Tikofsky LL, Schulte HF, Santisteban CG, Welcome FL, Bennett GJ, Zurakowski MJ and Zadoks RN (2009). CNS mastitis: nothing to worry about? Veterinary Microbiology, 134:9-14.
Song M, He Y, Zhou H, Zhang Y, et al. (2016). Combined analysis of DNA methylome and transcriptome reveal novel candidate genes with susceptibility to bovine Staphylococcus aureus subclinical mastitis. Scientific Reports, 6: 29390
Stephan R, Annemuller C, Hassan AA and Lammler C (2001). Characterization of enterotoxigenic Staphylococcus aureus strains isolated from bovine mastitis in north-east Switzerland. Veterinary Microbiology, 78: 373-382.
Tenhagen BA, Fetsch A, Stuhrenberg B, Schleuter G, Guerra B, Hammerl JA, Hertwig S, Kowall J, Kampe U, Schroeter A, Braunig J, Kasbohrer A and Appel B (2009). Prevalence of MRSA types in slaughter pigs in different German abattoirs. Veterinary Record, 165: 589-593.
Wada M, Lkhagvadorj E, Bian L, Wang C, Chiba Y, Nagata S, Shimizu T, Yamashiro Y, Asahara T and Nomoto K (2010). Quantitative reverse transcription-PCR assay for the rapid detection of methicillin-resistant Staphylococcus aureus. Journal of Applied Microbiology, 108: 779-788. doi:http://dx.doi.org/10.1111/j.1365-2672.2009.04476.x.
Wang D, Zhang L, Zhou X, He Y, Yong C, Shen M, Szenci O and Han B (2016). Antimicrobial susceptibility, virulence genes, and randomly amplified polymorphic DNA analysis of Staphylococcus aureus recovered from bovine mastitis in Ningxia, China. Journal of Dairy Science, 99: 9560-9569. doi:http://dx.doi.org/10.1111/j.1365-2672.2009.04476.x.
Workineh S, Bayleyegn M, Mekonnen H and Potgieter LN (2002). Prevalence and aetiology of mastitis in cows from two major Ethiopian dairies. Tropical Animal Health and Production, 34: 19-25.
Yang FL, Li XS, Liang XW, Zhang XF, Qin GS and Yang BZ (2012). Detection of virulence-associated genes in Staphylococcus aureus isolated from bovine clinical mastitis milk samples in Guangxi. Tropical Animal Health and Production, 44: 1821-1826. doi:http://dx.doi.org/10.1007/s11250-012-0143-z
Zecconi A and Hahn G (2000).Staphylococcus aureus in Raw Milk and Human Health Risk. Bulletin of the International Dairy Federation, 345: 15-18.
Zecconi A, Cesaris L, Liandris E, Dapra V and Piccinini R (2006). Role of several Staphylococcus aureus virulence factors on the inflammatory response in bovine mammary gland. Microbial Pathogenesis, 40:177-183. doi:http://dx.doi.org/10.1016/j.micpath.2006.01.001
18
