Научная статья на тему 'Изучение молекулярных механизмов резистентности к аминогликозидным антибиотикам возбудителей сальмонеллеза'

Изучение молекулярных механизмов резистентности к аминогликозидным антибиотикам возбудителей сальмонеллеза Текст научной статьи по специальности «Биология»

CC BY
88
19
Поделиться
Область наук
Ключевые слова
РЕЗИСТЕНТНОСТЬ / АМИНОГЛИКОЗИДНЫЕ АНТИБИОТИКИ / СТРЕПТОМИЦИН / ГЕНТАМИЦИН

Аннотация научной статьи по биологии, автор научной работы — Зубрицкий А. В., Ильина Е. Н., Стрельченко С. А., Малахова М. В., Ленев С. В., Скляров О. Д., Панин А. Н., Говорун В. М.

Проведена характеристика фенотипических проявлений устойчивости к аминогликозидным антибиотикам и поиск соответствующих генов, обеспечивающих резистентность 243 штаммов Salmonella spp. из коллекции ФГУ «ВГНКИ», собранной в период с 1948 по 2010 год. Клиническая устойчивость к стрептомицину и гентамицину обнаружена у 3,7% (n=9) и 0,8% (n=2) штаммов соответственно. Промежуточная устойчивость к стрептомицину выявлена у 9,9% (n=24) штаммов. Для обнаружения генов, обусловливающих резистентность к аминогликозидным антибиотикам, были созданы тест-системы для амплификации и определения нуклеотидной последовательности генов aadAl, aadA2, aadB, aphAl, aphA3, sat, strA, strB, aphA, aacC, rmtB, armA и rpsL. Среди штаммов с промежуточной устойчивостью к стрептомицину выявлено присутствие в геноме генов aadAl, aadA2, strA, strB, кодирующих ферменты модификации аминогликозидных антибиотиков, а также мутации в гене rpsL (K42N, G91D). Генетические механизмы, объясняющие формирование резистентности к гентамицину, в ходе исследования не выявлены. Сопоставлением данных бактериологического и генетического тестирования обнаружена группа сальмонелл, несущих гены резистентности к стрептомицину, но не сформировавших выраженную клиническую устойчивость к нему. Обнаружение таких изолятов указывает на необходимость генетического тестирования для своевременного предотвращения распространения лекарственной устойчивости в микробной популяции за счёт горизонтального переноса генов.

Похожие темы научных работ по биологии , автор научной работы — Зубрицкий А.В., Ильина Е.Н., Стрельченко С.А., Малахова М.В., Ленев С.В., Скляров О.Д., Панин А.Н., Говорун В.М.,

Investigation of Molecular Mechanisms of Aminoglycoside Resistance in Salmonella

The spread of aminoglycoside resistance phenotype and respective genetic resistance determinants was evaluated in 243 Salmonella strains isolated within 1948-2010 and stored in the Culture Collection of the Russian State Research Institute for Control, Standardization and Certification of Veterinary Preparations (Moscow). The Salmonella strains showed resistance to streptomycin and gentamicin in 3.7% (n=9) and 0.8% (n=2) of the isolates respectively. Intermediate resistance to streptomycin was recorded in 9.9% (n=24) of the isolates. To detect the genes responsible for the aminoglycoside resistance, primers for aadAl, aadA2, aadB, aphAl, aphA3, sat, strA, strB, aphA, aacC, rmtB, armA and rpsL genes amplification and sequencing were designed. The strains with lower susceptibility to streptomycin harbored aadAl, aadA2, strA, strB resistance genes encoding enzymes for aminoglicoside modification and rpsL mutant allele (K42N, G91D). Genetic mechanisms able to explain the gentamicin resistance development were not detected. Some strains carried genetic markers of streptomycine resistance but had no clinically sufficient resistance to it. In this regard, genetic testing is essential for prevention of drug resistance spreading due to horizontal transfer of genes in microbial population.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Текст научной работы на тему «Изучение молекулярных механизмов резистентности к аминогликозидным антибиотикам возбудителей сальмонеллеза»

Изучение молекулярных механизмов резистентности к аминогликозидным антибиотикам возбудителей сальмонеллеза

А. В. ЗУБРИЦКИЙ, Е. Н. ИЛЬИНА, С. А. СТРЕЛЬЧЕНКО, М. В. МАЛАХОВА,

С. В. ЛЕНЕВ, О. Д. СКЛЯРОВ, А. Н. ПАНИН, В. М. ГОВОРУН

Научно-исследовательский институт физико-химической медицины, Москва

Investigation of Molecular Mechanisms of Aminoglycoside Resistance in Salmonella

A. V. ZUBRITSKIY, E. N. ILINA, S. A. STRELCHENKO, M. V. MALAKHOVA,

S. V. LENEV, O. D. SKLYAROV, A. N. PANIN, V. M. GOVORUN

Research Institute of Physicoсhemical Medicine, Moscow

Russian State Research Institute of Control, Standardization and Certification of Veterinary Preparations, Moscow

Проведена характеристика фенотипических проявлений устойчивости к аминогликозидным антибиотикам и поиск соответствующих генов, обеспечивающих резистентность 243 штаммов Salmonella spp. из коллекции ФГУ «ВГНКИ», собранной в период с 1948 по 2010 год. Клиническая устойчивость к стрептомицину и гентамицину обнаружена у 3,7% (n=9) и 0,8% (n=2) штаммов соответственно. Промежуточная устойчивость к стрептомицину выявлена у 9,9% (n=24) штаммов. Для обнаружения генов, обусловливающих резистентность к аминогликозидным антибиотикам, были созданы тест-системы для амплификации и определения нуклеотидной последовательности генов aadAl, aadA2, aadB, aphAl, aphA3, sat, strA, strB, aphA, aacC, rmtB, armA и rpsL. Среди штаммов с промежуточной устойчивостью к стрептомицину выявлено присутствие в геноме генов aadAl, aadA2, strA, strB, кодирующих ферменты модификации аминогликозидных антибиотиков, а также мутации в гене rpsL (K42N, G91D). Генетические механизмы, объясняющие формирование резистентности к ген-тамицину, в ходе исследования не выявлены. Сопоставлением данных бактериологического и генетического тестирования обнаружена группа сальмонелл, несущих гены резистентности к стрептомицину, но не сформировавших выраженную клиническую устойчивость к нему. Обнаружение таких изолятов указывает на необходимость генетического тестирования для своевременного предотвращения распространения лекарственной устойчивости в микробной популяции за счёт горизонтального переноса генов.

Ключевые слова: Salmonella, резистентность, аминогликозидные антибиотики, стрептомицин, гентамицин.

The spread of aminoglycoside resistance phenotype and respective genetic resistance determinants was evaluated in 243 Salmonella strains isolated within 1948—2010 and stored in the Culture Collection of the Russian State Research Institute for Control, Standardization and Certification of Veterinary Preparations (Moscow). The Salmonella strains showed resistance to streptomycin and gentamicin in 3.7% (n=9) and 0.8% (n=2) of the isolates respectively. Intermediate resistance to streptomycin was recorded in 9.9% (n=24) of the isolates. To detect the genes responsible for the aminoglycoside resistance, primers for aadAl, aadA2, aadB, aphAl, aphA3, sat, strA, strB, aphA, aacC, rmtB, armA and rpsL genes amplification and sequencing were designed. The strains with lower susceptibility to streptomycin harbored aadAl, aadA2, strA, strB resistance genes encoding enzymes for aminoglicoside modification and rpsL mutant allele (K42N, G91D). Genetic mechanisms able to explain the gentamicin resistance development were not detected. Some strains carried genetic markers of streptomycine resistance but had no clinically sufficient resistance to it. In this regard, genetic testing is essential for prevention of drug resistance spreading due to horizontal transfer of genes in microbial population.

Keywords: Salmonella, resistance, aminoglycosides, streptomycin, gentamicin.

Є

e

Адрес для корреспонденции: 119435, Москва, ул. Малая Пироговская, д. 1а. Научно-исследовательский институт физико-химической медицины

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Сальмонеллёз относится к полиэтиологичес-ким инфекционным заболеваниям, зоонозам, и вызывается различными серотипами бактерий вида Salmonella enterica. В большинстве случаев сальмонеллёз протекает с преимущественным поражением органов пищеварительного тракта (гас-

© Коллектив авторов, 2011

Введение

троэнтериты, колиты). Заболеваемость сальмонеллезом имеет тенденцию к росту во всём мире, особенно в крупных городах с централизованной системой продовольственного снабжения. Ежегодно до 30% населения промышленно развитых стран страдает болезнями пищевого происхождения. Так, в США, по данным ВОЗ, ежегодно регистрируется около 1,4 миллиона случаев сальмонеллёза, которые приводят примерно к 15000 госпитализаций и 580 смертям [1]. В России сальмонеллёз является основной причиной острых

АНТИБИОТИКИ И ХИМИОТЕРАПИЯ, 2011, 56; 9-10

7

кишечных инфекций бактериальной этиологии; за период 2003—2009 гг. показатель заболеваемости им составлял 30—35 случаев на 100 тыс. населения [2]. Тенденцией последних лет в Российской Федерации, как и в других странах мира, стало распространение сальмонелл, отличающихся резистентностью ко многим современным распространённым антибиотикам и дезинфицирующим средствам, а также повышенной термоустойчивостью.

Массовое применение антибактериальных препаратов в терапии и профилактике сальмонеллёза у сельскохозяйственных животных началось в шестидесятые — семидесятые годы прошлого века. Из антибиотиков наиболее активно применялись тетрациклины, пеницилли-ны и аминогликозидные антибиотики, а также левомицетин, полимиксин М, рифампицин, эритромицин. В настоящее время высокий уровень устойчивости среди Salmonella spp. к тетра-циклинам и пенициллинам не позволяет более рассматривать эти препараты как эффективное средство борьбы с сальмонеллёзом. Однако аминогликозидные антибиотики, наряду с фторхинолонами и цефалоспоринами, активно используются в птицеводческих и животноводческих хозяйствах.

Согласно современной классификации антибактериальных препаратов выделяют три поколения аминогликозидных антибиотиков: I поколение — стрептомицин, канамицин, неомицин; II поколение — гентамицин, тобрамицин, нетилми-цин, сизомицин; III поколение — канамицин, амикацин. Общим в химическом строении ами-ногликозидных антибиотиков является наличие в молекуле аминосахара, соединенного гликозид-ной связью с аминоциклическим кольцом. Антибиотики данной группы необратимо связываются с акцепторным сайтом 30S субъединицы бактериальной рибосомы и нарушают синтез белков. Очевидно, что широкое применение аминогликозид-ных антибиотиков способствует селекции бактериальной флоры, устойчивой, в первую очередь, к стрептомицину и частично перекрёстноустойчивой к другим антибактериальным препаратам этой группы [3]. Особую опасность представляет передача антибиотикоустойчивых сальмонелл от животных к человеку, происходящая как контактным, так и алиментарным путем, и способствующая распространению генов резистентности среди представителей нормальной микрофлоры кишечника [4]. С целью сдерживания распространения генов, обусловливающих лекарственную устойчивость, в микробных популяциях в настоящее время во множестве стран действуют программы генетического мониторинга хозяйственно значимых микроорганизмов [5, 6].

Сегодня описаны различные молекулярные механизмы реализации резистентности к аминог-

ликозидным антибиотикам: это мутации генов rpsL и/или rpsD, кодирующих белки S12 и S4 малой субъединицы рибосомы [7], модификация некоторый оснований 23S рРНК с помощью специфических метилаз, кодируемый генами armA, rmtB [8], либо ферментативная химическая модификация аминогликозидыгх антибиотиков белковыми продуктами генов aadA1, aadA2, aadB, aphA1, aphA3, sat, strA, strB, aacC[6, 9]. Гены, обеспечивающие формирование резистентности по определенному молекулярному механизму, различаются по своей локализации, что в свою очередь отражается на скорости их распространения в популяции бактерий. Несущие мутации гены рибосомных белков входят в состав хромосомной ДНК, а потому распространяются клонально и сравнительно медленно. Гены, кодирующие ме-тилазы и ферменты модификации антибиотика, как правило, входят в состав мобильных элементов (интегроны, плазмиды и др.), и способны с гораздо большей скоростью передаваться в бактериальных популяциях за счёт горизонтального переноса, особенно на фоне воздействия анти-бактериальныгх препаратов [10].

Решение проблемы сдерживания распространения резистентности среди возбудителей сальмонеллёза невозможно без расшифровки молекулярных механизмов, обеспечивающих резистентный фенотип в каждом конкретном случае. Целью настоящей работы было изучение особенностей формирования резистентности к аминогликозидным антибиотикам, в том числе на молекулярном уровне, штаммами Salmonella spp., выделенными в течение длительного времени на территории Российской Федерации.

Материал и методы

В работе использованы штаммы Salmonella spp. из коллекции лаборатории качества и стандартизации лекарственных средств против бактерийных болезней животных ФГУ «ВГНКИ». Для культивирования сальмонелл и проведения тестов на чувствительность использовали триптон-соевый агар и агар Мюллера-Хинтон (HiMedia Laboratories Pvt. Limited, Индия). Чувствительность штаммов к стрептомицину и гентами-цину определяли диско-диффузионным методом [11] с применением соответствующих дисков производства HiMedia Laboratories Pvt. Limited, Индия. Чувствительность штаммов к антибиотикам оценивали согласно критериями CLSI [12].

Принадлежность исследуемыгх штаммов к виду S.enterica подтверждали по технологии прямого масс-спектрометрического профилирования. Для этого свежие бактериальные клетки (1—2 колонии) переносили в 300 мкл деионизированной воды, перемешивали и добавляли 900 мкл этанола. Осадок после центрифугирования (15 мин, 14000 об/мин) растворяли в 20 мкл смеси 50% ацетонитрила, 35% муравьиной кислоты. Полученный в результате последующего центрифугирования супернатант анализировали времяпролётной MALDI масс-спектрометрией. Все использованные реактивы, включая воду, были аналитической чистоты или специальные для масс-спектрометрии.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

В качестве матрицы применяли а-циано-4-гидроксико-ричную кислоту (a-cyano-4-hydroxycinnamic acid, a-CHCA,

Таблица 1. Праймеры, использованные для амплификации фрагментов геномной ДНК, ответственных за реализацию молекулярных механизмов формирования резистентности сальмонелл к аминогликозидным антибиотикам

№ Локус 5'—3' последовательность Tm (°С) Длина ампликона, пн Источник

1 aadAl gctggccttacatttgtacg ttatttgccgactaccttgg 57 709 настоящая статья

2 aadA2 agacataatgagggtagcgg agcgaataaattcttccaagtg 57 761 настоящая статья

3 aadB gttacgcagcagcaacgatg acctcaaccttttccgcccc 60 558 настоящая статья

4 sat tgttttgttcccaacttgcc attatgcaactcatgtcccg 56 671 настоящая статья

5 strA ttcttttcgcaggttgagcc cgctgcccagttctcttcg 56 747 настоящая статья

6 strB aacctgttctcattgcggacacc cgttgctcctcttctccatccg 62 742 настоящая статья

7 aphAl atgggaagcccgatgcgccag gtctgcgattccgactcgtcc 60 542 настоящая статья

8 aphA3 gagtgaggccgatggcgtc ccctgccgcttctcccaag 60 374 настоящая статья

9 aacC tcaggcgatatggtgatgc ttcgatgccgaaggaaacg 60 726 настоящая статья

10 rmtB tcaacgatgccctcacctcc tccatgccttttccacgccc 60 640 настоящая статья

11 armA tctgcctatcctaattgg acctatactttatcgtcgtc 46 313 настоящая статья

12 rpsL cttctgatccgaacttcg cgccctaaaattcgg 58 619 настоящая статья

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

*rpsL (seq) ccaggagctatttaatggc cggagaaccattaagcc 60 399 настоящая статья

13 rpsD ggcaagatatttgggtcc aaggctcaagggtcacc 60 735 настоящая статья

Примечание. Tm - температура отжига праймеров в ПЦР; * - внутренние праймеры, использованные для секвениро-

вания гена rpsL.

Bruker Daltonics, Германия) в виде насыщенного раствора в смеси 50% ацетонитрила, 2,5% трифторуксусной кислоты. Для сокристаллизации матрицы и образца 1 мкл аналита наносили на ячейки стальной мишени для масс-спектрометрии (MSP 96 target ground steel, Bruker Daltonics, Германия), давали подсохнуть 1—2 мин и сверху наслаивали 2 мкл насыщенного раствора матрицы. Кристаллы оставляли на воздухе в течение 5—10 мин до полного высыхания. Влажность и температуру при этом не контролировали.

Масс-спектрометрический анализ осуществляли с помощью времяпролётного MALDI масс-спектрометра MicroflexTM (Bruker Daltonics, Германия), оснащённого азотным лазером 337 нм. Все измерения проводили в линейном режиме, детектируя положительные ионы. Для накопления масс-спектров мощность лазерного излучения устанавливали на уровне минимального порогового значения, достаточного для десорбции-ионизации образца. Параметры масс-спектрометра оптимизировали для диапазона m/z от 2000 до 20000. Внешнюю калибровку проводили с использованием точных значений масс известныгх белков E.coli.

Для записи, обработки и анализа масс-спектров использовали программное обеспечение компании Bruker Daltonics (Германия): flexControl 2.4 (Build 38) и flexAnalysis 2.4 (Build 11). Точность измерения масс составляла ± 2 Да.

Кластерный анализ и видовую идентификацию бактерий путём сопоставления получаемых масс-спектров с имеющимися базами данный: проводили с помощью программного пакета MALDI Biotyper 2.0 (Bruker Daltonics, Германия).

Серологическое типирование штаммов S.enterica проводили с помощью сухих адсорбированных сальмонеллёзных сывороток для реакции агглютинации (ООО «Петромед-Диа-гностика», Санкт-Петербург) в соответствии с прилагаемой инструкцией.

Экстракцию тотальной геномной ДНК исследуемых штаммов сальмонелл осуществляли при помощи набора «ДНК экспресс» (ТУ-9398-450-17253567-03) производства ООО «НПФ Литех», в соответствии с прилагаемыми инструкциями. Растворы ДНК хранили при — 20°С и использовали по мере необходимости.

Подбор специфичных олигонуклеотидных праймеров для амплификации фрагментов геномной ДНК, определяющих генетические детерминанты устойчивости к стрептомицину и гентамицину, осуществляли с использованием пакета программного обеспечения «Vector NTI Suite 11» (Invitrogen, США) на основании последовательностей генов сальмонеллы, представленных в GenBank (accession numbers: BAJ36223., ADF97245, CAG34229, ACF76690, ADK62236, CBO78207, ADK22835, BAE98117, AB041023, ACU81181, ADP55013, ACN47601, ACN47601, BAJ38413).

Амплификацию фрагментов генов-мишеней проводили в 15 мкл реакционной смеси, содержащей 66 мМ трис-HCl pH 9,0; 16,6 мМ (NH4)2S04; 2 мМ MgCl2, по 100 мкМ каждого dNTP, 1,5 ед. Taq-полимеразы (Promega, США), по 3 пмоль каждого праймера (табл. 1), и 1 мкл экстракта тотальной ДНК. Реакцию проводили в амплификаторе DNA Engine Tetrad™ (MJ Research, США). Профиль амплификации различных генов был универсальным, за исключением температуры отжига праймеров (Tm), которую подбирали индивидуально для каждой пары праймеров (см. табл. 1): 94°С — 15 сек, Tm °С — 15 сек, 72° С — 20 сек; 35 циклов.

Продукты амплификации анализировали в 2% агарозном геле. В качестве маркёра электрофоретической подвижности ПЦР-фрагментов использовали маркёр молекулярных масс ДНК производства Fermentas (Евросоюз). Полученные результаты демонстрировали наличие или отсутствие продуктов амплификации соответствующих генов у каждого штамма.

Таблица 2. Распределение генетических детерминант устойчивости к аминогликозидным антибиотикам среди исследованных штаммов сальмонелл

Фенотип штамма (указаны регистрируемые Число штаммов (и % от общей выборки), несущих генетические детерминанты устойчивости

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

диаметры зоны ингибирования роста, число штаммов к стрептомицину мутации в генах наличие генов к гентамицину

и процент от общей выборки) rpsL rpsD aadAl aadA2 aadB sat strA strB aphAl h aph aacC armA rmtB

Чувствительный: 15 мм и более (п=210, 86,4%) 0 0 Стрептомицин 0000 0 0 0 0 0 0 0

Промежуточно-устойчивый: 13—14 мм; («=19, 7,8%) 0 0 0 0 0 0 0 0 0 0 0 0 0

Промежуточно-устойчивый: 12 мм; (п=5, 2,1%) 1 (0,4%) 0 2 (0,8%) 1 (0,4%) 0 0 0 0 0 0 0 0 0

Устойчивый: 0—11 мм; («=9, 3,7%) 1 (0,4%) 0 3 (1,2%) 0 0 0 3 (1,2%) 3 (1,2%) 0 0 0 0 0

Чувствительный: 15 мм и более («=241, 99,2%) 0 0 Гентамицин 0000 0 0 0 0 0 0 0

Устойчивый: 0 мм («=2, 0,8%) 0 0 0000 0 0 0 0 0 0 0

Примечание. STR - стрептомицин; GEN - гентамицин; wt - wild type, дикий тип - вариант последовательности гена, характерный для «дикой», чувствительной к антибактериальным препаратам популяции бактерий.

Мутации в генах rpsL и rpsD регистрировали на основании определения нуклеотидной последовательности ампликона. Для этого проводили дефосфорилирование 5'-концевых фосфатных групп dNTP и деструкцию олигонуклеотидных праймеров, не израсходованных в процессе амплификации, путем прибавления к продуктам ПЦР 5 мкл смеси, содержащей 66 мМ Трис-HCl pH 9,0; 16,6 мМ (NH4)2S04; 2,5 мМ MgCl2, 0,5 ед. акт. щелочной фосфатазы арктических креветок (SAP) и 5 ед акт. эк-зонуклеазы I E.coli (ExoI). Оба фермента производства Fermentas (Евросоюз). Смесь инкубировали в течение 20 мин при 37°С с последующей инактивацией ферментов прогреванием в течение 10 мин при 85°С.

Нуклеотидные последовательности амплифицированных фрагментов ДНК определяли модифицированным методом Сенгера с использованием ABI Prism® BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit и прибора ABI Prism® 3100 Genetic Analyzer (Applied Biosystems, США) в соответствии с прилагаемыми инструкциями. Выравнивание и сравнительный анализ нуклеотидных последовательностей проводили с использованием модулей ContigExpress и AlignX программного пакета «Vector NTI Suite 11» (Invitrogen, США).

Результаты исследования

В исследование вошла группа из 243 коллекционных штаммом возбудителей сальмонеллёза, чья принадлежность к виду S.enterica была подтверждена на основании первичного бактериологического тестирования и проведённого в ходе данной работы прямого масс-спектрометрического профилирования бактериальных белков.

Согласно данным серотипирования, наиболее часто в анализируемой выборке встречались серовары enteritidis (n=52, 21,4%), typhimurium (n=37, 15,2%), choleraesuis (n=33, 13,6%), galli-narum-pullorum (n=27, 11,1%), dublin (n=18, 7,4%), abortus ovis (n=12, 4,9%).

Тестирование чувствительности к стрептомицину и гентамицину отобранных штаммов S.enteri-ca (n=243) позволило выделить группы, отличаю-

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

щиеся по фенотипу (табл. 2). Согласно критериям СЬ81 для сальмонелл было установлено, что чувствительными к стрептомицину являлись 86,4% штаммов («=210, диаметр зоны ингибирования роста 15 мм и более), промежуточно-устойчивыми — 9,9% («=24, диаметр зоны ингибирования роста от 12 до 14 мм), устойчивыми — 3,7% (п=9, диаметр зоны ингибирования роста от 0 до 11 мм). Устойчивыми к гентамицину оказались лишь 0,8% штаммом («=2, диаметр зоны ингибирования роста 0 мм) из всей коллекции. При этом феномен перекрестной устойчивости не наблюдался, оба устойчивых к гентамицину штамма сохраняли чувствительность к стрептомицину.

С целью изучения разнообразия реализуемых молекулярных механизмов формирования устойчивости 5.еПепса к стрептомицину и гентамицину были разработаны оригинальные тест-системы для амплификации и определения нуклеотидной последовательности соответствующих локусов («=13) геномной ДНК сальмонелл (см. табл. 1).

Согласно данным молекулярного тестирования во всех случаях среди чувствительных к стрептомицину (210/210, 100%) и гентамицину (241/241, 100%) штаммов анализируемые детерминанты резистентности обнаружены не были.

Те или иные генетические маркёры резистентности к стрептомицину были выявлены у 10 штаммов, что составило 30,3% от общего числа не чувствительных к этому антибиотику сальмонелл.

Следует отметить, что характерные изменения в геномной ДНК, ассоциированные с различными молекулярными механизмами резистентности к стрептомицину, были обнаружены только среди штаммов, для которых при тестировании чувстви-

О

Таблица 3. Обнаружение генетических детерминант резистентности к стрептомицину в группе штаммов с диаметром зоны ингибирования роста, равной или менее 12 мм. Приведены также данные по определению чувствительности к гентамицину

Серовар

Диаметр зоны ингибирования

Генетические детерминанты (гены), участвующие в формировании устойчивости к стрептомицину

роста, мм STR GEN rpsL rpsD aadAl aadA2 aadB sat strA strB

1 enteritidis 0 20 wt wt pos neg neg neg neg neg

2 dublin 0 27 K42N wt neg neg neg neg neg neg

3 typhimurium 0 21 wt wt pos neg neg neg pos pos

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

4 typhimurium 0 19 wt wt neg neg neg neg pos pos

5 typhimurium 0 15 wt wt neg neg neg neg pos pos

б enteritidis 8 15 wt wt neg neg neg neg neg neg

7 enteritidis 8 1б wt wt neg neg neg neg neg neg

8 typhimurium 11 21 wt wt neg neg neg neg neg neg

9 infantis 11 1б wt wt pos neg neg neg neg neg

10 choleraesuis 12 27 G91D wt neg neg neg neg neg neg

11 infantis 12 1б wt wt pos neg neg neg neg neg

12 infantis 12 18 wt wt pos neg neg neg neg neg

13 typhimurium 12 20 wt wt neg pos neg neg neg neg

14 gallinarum-pullorum 12 25 wt wt neg neg neg neg neg neg

Примечание. STR - стрептомицин; GEN - гентамицин; wt - wild характерный для «дикой», чувствительной к антибактериальным

type, дикий тип - вариант последовательности гена, препаратам популяции бактерий.

тельности диско-диффузионным методом диаметр зоны ингибирования роста быш менее или равным 12 мм (табл. 3). В этой группе («=14) частота выявления генетических маркёров резистентности к стрептомицину составила 71,4%.

Генетические маркёры резистентности к ген-тамицину среди проанализированной группы штаммов обнаружены не были.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Обсуждение

Перспективность применения методов молекулярного типирования для мониторинга лекарственной устойчивости сальмонелл была оценена на основании сравнительной характеристики коллекции штаммов Salmonella spp. двумя способами: определением фенотипических проявлений устойчивости к аминогликозидным антибиотикам и изучением возможных молекулярных механизмов реализации наблюдаемой резистентности.

В исследование были включены два антибактериальны« препарата — стрептомицин и гентамицин, относящиеся к группе аминогликозид-ных антибиотиков согласно классификации РЛС [13], и активно применяемые в животноводстве и птицеводстве для лечения и профилактики сальмонеллёза [14, 15].

Анализ фенотипической устойчивости исследуемой группы сальмонелл к стрептомицину позволил установить, что все штаммы, поступившие в коллекцию в период с 1948 по 1958 гг., проявляли чувствительность к этому антибиотику. Однако, уже начиная с 1958 года, обнаруживаются возбудители, имеющие промежуточно-устойчивыш фенотип, тогда как все устойчивые штаммы быши внесены в коллекцию в период после 1993 года, преимущественно в 2009—2010 годах. Оба устойчи-

вых к гентамицину штамма выделены в 2009 году.

С целью генетической характеристики штаммов были исследованы возможные молекулярные механизмы, обеспечивающие формирование резистентности к стрептомицину и гентамицину [16] (см. табл. 2, 3). Среди исследованных маркёров резистентности гены rpsL, rpsD имели хромосомную локализацию, остальные гены входили в состав плазмидной ДНК.

На основании анализа совокупности включённых в исследование генетических детерминант резистентности удалось выявить штаммы (n=8), несущие гены aadAl, aadA2, strA, strB, передающиеся в микробной популяции за счёт горизонтального переноса в составе мобильных генетических элементов. Гены strA и strB, обнаруженные у трёх штаммов, встречались одновременно, что объясняется их совместной локализацией на транспо-зоне Tn5393 [17]. У двух штаммов, не несущих плазмидных генов резистентности, были обнаружены мутации в гене rpsL, приводящие к аминокислотным заменам в рибосомном белке S12. Одна мутация — K42N обеспечивает высокий уровень резистентности, другая (G91D) — умеренную устойчивость, что хорошо согласуется с фенотипическими характеристиками, полученными нами для этих штаммов.

Согласно данным генетического тестирования, мы можем предположить, что в большинстве случаев (9/10; 90%) наблюдалась реализация какого-то одного молекулярного механизма формирования резистентности к стрептомицину (табл. 3). Для пяти штаммов это была модификация/инактивация антибиотика ферментом стрептомицин 3'-аденилтрансфераза, продуктом генов aadAl или aadA2, для двух — фосфорилиро-вание 3- и 6-гидроксильных групп стрептомици-

-Q-

на продуктами генов strA и strB соответственно, еще два штамма приобрели устойчивый фенотип за счёт мутационного процесса в гене rpsL.

Необходимо отметить, что генетические детерминанты резистентность к стрептомицину были обнаружены нами не у всех штаммов, устойчивых или промежуточно-устойчивых к этому антибиотику. Кроме того, в рамках настоящей работы мы не сумели объяснить на молекулярном уровне механизм резистентности двух штаммов к гентамицину.

Как и другие авторы [18], мы допускаем, что проведённое исследование охватывает не все возможные молекулярные механизмы формирования резистентности. Кандидатами на дополнительное исследование являются, например, клеточные помпы, обеспечивающие множественную неспецифическую лекарственную устойчивость за счёт активации механизмов эффлюкса [9].

При сопоставлении данных генетического тестирования с фенотипом обращает на себя внимание факт, что генетические детерминанты резистентности S.enterica к стрептомицину были выявлены исключительно среди штаммов, для которых диаметр зоны ингибирования роста этим антибиотиком равнялся или был меньше 12 мм. Особый интерес представляют штаммы с диаметром зоны ингиби-

ЛИТЕРАТУРА

1. World Health Organisation — Programmes and projects — Media centre — Fact sheets — Fact sheet N°139. http://www.who.int/mediacentre/factsh eets/fs139/en/ - Revised April 2005.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

2. Онищенко Г. Г. Постановление № 21 от 19 03.2010 Зарегистрировано Министерством Юстиции Российской Федерации № 16959 от 22.04. 2010 г.

3. Miko A, Pries K., Schroeter A. et al. J Antimicrob Chemother 2005; 56: 1025—1033.

4. Angulo F., Nargund V., Chiller T. J Vet Med B Infect Dis Vet Public Health 2004; 51: 374—379.

5. Aarestrup F. M. J Vet Med B 2004; 51: 380—388.

6. Wray C., Gnanou J. C. Int J Antimicrob Agents 2000; 14: 291—294.

7. Paulander W., Maisnier-Patin S., Andersson D. I. Genetics 2009; 183: 2: 539—546.

8. Bogaerts P., Galimand M., Bauraing C. et al. J Antimicrob Chemother 2007; 59: 3: 459—464.

9. Trunck L. A., Propst K. L., Wuthiekanun V. et al. PloS Negl Trop Dis 2009; 3: 9: e519.

рования роста, равным 12 мм. Согласно критериям CLSI интерпретации результатов диско-диффузи-онного метода установления чувствительности такие штаммы имеют промежуточно-устойчивыш фенотип, не представляющий серьезной опасности в распространении резистентности. Однако среди этой группы штаммов (n=5) уже обнаруживаются гены, способствующие формированию резистентного фенотипа. С учётом возможной активизации скрыпых генетических механизмов резистентности [19] молекулярное тестирование таких штаммов представляется особо важным в предотвращении распространения лекарственной устойчивости в микробной популяции. Следует также отметить, что согласно нашим данным среди возможных молекулярных механизмов формирования сальмонеллами устойчивости к стрептомицину доминирует путь приобретения генов резистентности в составе мобильных генетических элементов (плазмид, транспозонов). Настоящее наблюдение указывает на необходимость реализации генетического тестирования при мониторинге возбудителей сальмонеллёза, поскольку весьма вероятен сценарий переноса этих мобильных элементов другим представителям Enterobacteriaceae, в том числе составляющим нормальную микрофлору кишечника человека и сельскохозяйственных животных.

10. Сидоренко С. В. Consilium Medicum 2007; 9: 1. Публикация на сайте издательства http://www.consilium-medicum.com/medicum/arti-cle/15013/

11. Bauer A. W., Kirby W. M. M., Sherris J. C. et al. Am J Clin Pathol 1966; 45: 4: 493-496.

12. Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard - Tenth Edition. Clinical and Laboratory Standards Institute, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087-1898 USA, 2009.

13. Регистр лекарственных средств России. Публикация на сайте издательства http://www.rlsnet.ru/mnn_index_id_1605.htm

14. Aarestrup F. M. Basic & Clinical Pharmacology & Toxicology 2005; 96: 271-281.

15. Regula G. et al. J Antimicrob Chemother 2009; 63: 805—811.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

16. Shaw K. J., Rather P. N., Hare R. S. et al. Microbiological Reviews 1993; 57: 1: 138—163.

17. Pezzella C., Ricci A., DiGiannatale E., Luzzi I., Carattoli A. Antimicrob Agents Chemother 2004; 48: 903—908.

18. Sundel M., Norstrom M. J Antimicrob Chemother 2005; 56: 87—90.

19. Smith C. J., Owen C., Kirby L. Mol Microbiol 1992; 6: 16: 2287—2297.

-e-