Научная статья на тему 'Изменения ангиогенных свойств ММСК жировой ткани с возрастом у больных ишемической болезнью сердца'

Изменения ангиогенных свойств ММСК жировой ткани с возрастом у больных ишемической болезнью сердца Текст научной статьи по специальности «Биотехнологии в медицине»

CC BY
199
81
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
МУЛЬТИПОТЕНТНЫЕ МЕЗЕНХИМНЫЕ СТРОМАЛЬНЫЕ КЛЕТКИ ЖИРОВОЙ ТКАНИ / СТАРЕНИЕ / АНГИОГЕНЕЗ / ИШЕМИЧЕСКАЯ БОЛЕЗНЬ СЕРДЦА / ADIPOSE-DERIVED MULTIPOTENT MESENCHYMAL STROMAL CELLS / AGING / ANGIOGENESIS / CORONARY ARTERY DISEASE

Аннотация научной статьи по биотехнологиям в медицине, автор научной работы — Ефименко А. Ю., Джояшвили Н. А., Калинина Н. И., Кочегура Т. Н., Акчурин Р. С.

Мультипотентные мезенхимные стромальные клетки жировой ткани (ММСК-ЖТ) способны стимулировать ангиогенез посредством продукции факторов роста и стабилизации формирующихся сосудов, поэтому являются перспективным материалом для аутологичной клеточной терапии заболеваний ишемического генеза. Однако с возрастом пациентов функциональная активность ММСК-ЖТ, а, следовательно, и эффективность клеточной терапии могут снижаться. Целью нашей работы было определить изменения ангиогенных свойств ММСК-ЖТ больных ишемической болезнью сердца (ИБС) при старении. ММСК были выделены из подкожной жировой ткани пациентов с ИБС (n=64, возраст 43-77 лет). Иммунофенотип клеток был определен с помощью проточной цитофлуорометрии: CD90 +/CD73 +/CD105 +/CD45 -/CD31 — для всех образцов, и была подтверждена мультипотентность клеток путем индукции адипогенной и остеогенной дифференцировки. Кондиционированная среда ММСК-ЖТ стимулировала образование капилляроподобных структур эндотелиальными клетками (линия EA.hy926), и этот эффект уменьшался с возрастом пациентов. Мы не обнаружили связанных с возрастом изменений содержания мРНК ангиогенных факторов в ММСК-ЖТ. Однако содержание проангиогенных факторов роста, таких как фактор роста эндотелия сосудов, плацентарный фактор роста, фактор роста гепатоцитов, ангиопоэтин-1 и ангиогенин в кондиционированной среде ММСК-ЖТ, оцененное с помощью метода ELISA, было значимо ниже для пожилых больных по сравнению с более молодыми пациентами, в то время как уровень антиангиогенных факторов (тромбоспондина-1 и эндостатина) существенно не менялся с возрастом пациентов. Таким образом, при старении ангиогенные свойства ММСК-ЖТ ухудшаются в результате снижения секреции ключевых ангиогенных факторов. Полученные результаты раскрывают механизмы снижения терапевтического потенциала ММСК-ЖТ с возрастом и обосновывают необходимость разработки методов повышения терапевтических свойств этих клеток, направленных на увеличение их паракринной активности.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по биотехнологиям в медицине , автор научной работы — Ефименко А. Ю., Джояшвили Н. А., Калинина Н. И., Кочегура Т. Н., Акчурин Р. С.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Changes of angiogenic properties of adipose derived MMSC in patients with coronary heart disease with age

Tissue regeneration is impaired in aged individuals. Adiposederived multipotent mesenchymal stromal cells (adMMSC), a promising source for cell therapy, were shown to secrete various angiogenic factors and improve vascularization of ischemic tissues. We analyzed how patient age affected angiogenic properties of adMMSC. adMMSC were isolated from surgically obtained subcutaneous fat tissue of patients (n = 64, 43-77 years old) with coronary artery disease (CAD). adMMSC phenotype characterized by flow cytometry was CD90+/ CD73+/CD105+/CD45-/CD31for all samples and cells were capable for adipogenic and osteogenic differentiation. adMMSC conditioned media stimulated formation of capillary-like tubes by endothelial cells (EA.hy926) and this effect significantly decreased with age of patients. There was no age-associated difference in angiogenic factors gene expression (evaluated by real-time PCR). Level of proangiogenic factors in adMMSC conditioned media measured by ELISA significantly declined with age of patients, but level of anti-angiogenic factors did not. Thus, angiogenic properties of adMMSC from aged patients with CAD decline due to the decreasing of proangiogenic factors secretion. Our data provide new insights into mechanisms of age-associated impairment of autologous adMMSC therapeutic potential.

Текст научной работы на тему «Изменения ангиогенных свойств ММСК жировой ткани с возрастом у больных ишемической болезнью сердца»

Изменения ангиогенных свойств ММСК жировой ткани с возрастом у больных ишемической болезнью сердца

A.Ю. Ефименко 1, Н.А. Джояшвили 1, Н.И. Калинина 1, Т.Н. Кочегура 1, Р.С. Акчурин 2,

B.А. Ткачук12, Е.В. Парфенова 12

1 Московский государственный университет им. М.В. Ломоносова, Москва

2 Российский кардиологический научно-производственный комплекс Министерства здравоохранения РФ, Москва

Changes of angiogenic properties of adipose derived MMSC in patients with coronary heart disease with age

A.Y. Efimenko 1, N.A. Dgoyashvili1, NJ. Kalinina 1, T.N. Kochegura 1, R.S. Achkurin 2, V.A. Tkachuk 1 2, E.V. Parfenova 1 2

1 M.V. Lomonosov Moscow State University, Moscow

2 Russian Cardiology Research and Production Complex of the Ministry of Health, Moscow

Мультипотентные мезенхимные стромальные клетки жировой ткани (ММСК-ЖТ) способны стимулировать ан-гиогенез посредством продукции факторов роста и стабилизации формирующихся сосудов, поэтому являются перспективным материалом для аутологичной клеточной терапии заболеваний ишемического генеза. Однако с возрастом пациентов функциональная активность ММСК-ЖТ, а, следовательно, и эффективность клеточной терапии могут снижаться. Целью нашей работы было определить изменения ангиогенных свойств ММСК-ЖТ больных ише-мической болезнью сердца (ИБС) при старении.

ММСК были выделены из подкожной жировой ткани пациентов с ИБС (n=64, возраст 43-77 лет). Иммунофенотип клеток был определен с помощью проточной цитофлуоро-метрии: CD90+/CD73+/CD105+/CD45VCD31- - для всех образцов, и была подтверждена мультипотентность клеток путем индукции адипогенной и остеогенной дифференцировки. Кондиционированная среда ММСК-ЖТ стимулировала образование капилляроподобных структур эндотелиальными клетками (линия EA.hy926), и этот эффект уменьшался с возрастом пациентов. Мы не обнаружили связанных с возрастом изменений содержания мРНК ангиогенных факторов в ММСК-ЖТ. Однако содержание проангиогенных факторов роста, таких как фактор роста эндотелия сосудов, плацентарный фактор роста, фактор роста гепатоцитов, ангиопоэтин-1 и ангиогенин в кондиционированной среде ММСК-ЖТ, оцененное с помощью метода ELISA, было значимо ниже для пожилых больных по сравнению с более молодыми пациентами, в то время как уровень антиангиогенных факторов (тромбоспондина-1 и эндостатина) существенно не менялся с возрастом пациентов.

Таким образом, при старении ангиогенные свойства ММСК-ЖТ ухудшаются в результате снижения секреции ключевых ангиогенных факторов. Полученные результаты раскрывают механизмы снижения терапевтического потенциала ММСК-ЖТ с возрастом и обосновывают необходимость разработки методов повышения терапевтических свойств этих клеток, направленных на увеличение их пара-кринной активности.

Ключевые слова: мультипотентные мезенхимные стромальные клетки жировой ткани, старение, ангиогенез, ишемическая болезнь сердца.

Tissue regeneration is impaired in aged individuals. Adipose-derived multipotent mesenchymal stromal cells (adMMSC), a promising source for cell therapy, were shown to secrete various angiogenic factors and improve vascularization of ischemic tissues. We analyzed how patient age affected angiogenic properties of adMMSC.

adMMSC were isolated from surgically obtained subcutaneous fat tissue of patients (n = 64, 43-77 years old) with coronary artery disease (CAD). adMMSC phenotype characterized by flow cytometry was CD90+/ CD73+/CD105+/CD45-/CD31- for all samples and cells were capable for adipogenic and osteogenic differentiation. adMMSC conditioned media stimulated formation of capillary-like tubes by endothelial cells (EA.hy926) and this effect significantly decreased with age of patients. There was no age-associated difference in angiogenic factors gene expression (evaluated by real-time PCR). Level of pro-angiogenic factors in adMMSC conditioned media measured by ELISA significantly declined with age of patients, but level of anti-angiogenic factors did not.

Thus, angiogenic properties of adMMSC from aged patients with CAD decline due to the decreasing of pro-angiogenic factors secretion. Our data provide new insights into mechanisms of age-associated impairment of autologous adMMSC therapeutic potential.

Key words: adipose-derived multipotent mesenchymal stromal cells, aging, angiogenesis, coronary artery disease.

Сердечно-сосудистые заболевания, в том числе ишемическая болезнь сердца (ИБС), занимают первое место в структуре причин смертности в большинстве стран, несмотря на значительный прогресс в развитии медикаментозных методов лечения и хи-

e-mail: efimenkoan@gmail.com

рургической и эндоваскулярной реваскуляризации. Одним из перспективных подходов к их лечению является терапевтический ангиогенез, основанный на введении в ишемизированные ткани генетических конструкций с генами факторов роста или стволовых/

прогениторных клеток. Мультипотентные мезенхим-ные стромальные клетки (ММСК), выделенные из костного мозга или жировой ткани (ММСК-ЖТ), считаются перспективным инструментом для терапевтического ангиогенеза благодаря своей способности стимулировать рост кровеносных сосудов, в частности путем секреции ангиогенных факторов роста. Причем ММСК-ЖТ, обладающие теми же свойствами, что и ММСК костного мозга, значительно легче получить в достаточно большом количестве при ма-лоинвазивной процедуре ограниченной липосакции [1, 2]. На моделях ишемии конечностей и миокарда у животных нами и другими авторами показано, что локальное и системное введение ММСК-ЖТ способствует увеличению количества сосудов в тканях с нарушенным кровоснабжением и улучшению перфузии тканей кровью [3—12]. Восстановление кровотока в ишемизированной ткани при трансплантации ММСК-ЖТ обусловлено несколькими механизмами. Во-первых, эти клетки секретируют широкий набор ангиогенных факторов роста, которые способствуют миграции и пролиферации эндотелиальных клеток и их предшественников, а также формированию новых сосудов [6, 9, 12-14]. Во-вторых, ММСК-ЖТ се-кретируют активаторы плазминогена и матриксные протеазы, что способствует локальному разрушению внеклеточного матрикса и миграции клеток, участвующих в образовании сосудистой стенки, а также высвобождению связанных с матриксом ангиогенных факторов [15]. В-третьих, ММСК-ЖТ могут дифференцироваться в гладкомышечные и эндотелиаль-ные клетки, встраивающиеся в растущие сосуды, а также стабилизировать вновь образованные сосуды, выполняя функцию перицитов [7, 16-18]. Это согласуется с данными, демонстрирующими, что во всех тканях организма ММСК являются компонентами сосудистой стенки и, по-видимому, играют важную роль в развитии и поддержании сосудистой сети как в норме, так и при патологическом ремоделировании тканей [19].

Хотя ММСК-ЖТ уже используются в различных фазах клинических исследований по клеточной терапии заболеваний ишемического генеза, в том числе ИБС [1, 20-22], их свойства у больных с этими заболеваниями практически не изучены. Подавляющее большинство результатов, касающихся ангиогенных и регенеративных свойств ММСК-ЖТ человека, получено на клетках, выделенных из жировой ткани относительно здоровых молодых доноров. В то же время известно, что старение и само заболевание может оказывать негативное влияние на состояние ММСК [23-27]. В единичных работах показано, что при старении снижается пролиферативный потенциал ММСК-ЖТ и их способность к дифференци-ровке [28, 29], а также ухудшаются их ангиогенные свойства [29, 30]. Поскольку ММСК входят в состав сосудистой стенки и принимают участие в процессах ее репарации при повреждении, изменения, происходящие с ними при старении, могут являться важным патогенетическим фактором заболеваний, ассоциированных с возрастом, включая атеросклероз, сахарный диабет и гипертоническую болезнь. Изменения свойств ММСК, в том числе их способности стимулировать рост сосудов, могут снижать эффективность аутологической клеточной терапии у пациентов с ИБС или хронической ишемией нижней конечностей, с тяжелым диффузным поражением

сосудистого русла, в возрасте, как правило, старше 60 лет, являющихся наиболее вероятными кандидатами для клеточной терапии. Для повышения эффективности клеточной терапии собственными клетками пациента, а также для разработки методов стимуляции эндогенных регенеративных процессов необходимо изучение молекулярных механизмов, обусловливающих снижение терапевтических свойств клеток, в частности, их способности стимулировать васкуляризацию ишемизированных тканей. Таким образом, целью нашей работы было оценить, как изменяются с возрастом ангиогенные свойства ММСК-ЖТ пациентов с ИБС.

Материал и методы

Клиническая характеристика пациентов,

включенных в исследование

В исследование были включены 64 пациента с ишемической болезнью сердца, стенозирующим коронарным атеросклерозом, по данным коронаро-ангиографии, стабильной стенокардией II-IV функционального класса (по классификации Канадского общества по изучению сердечно-сосудистых заболеваний), которым проводилось аортокоронарное шунтирование в Отделе сердечно-сосудистой хирургии Института клинической кардиологии им. А.Л. Мяс-никова ФГУ РКНПК МЗ РФ (рук. академик РАМН Р.С. Акчурин). В ходе операции у них были выделены образцы подкожной жировой ткани. Все исследования, связанные с образцами жировой ткани, выполнялись на основании разрешения Этического комитета ФГБУ РКНПК МЗ РФ, и все пациенты подписывали добровольное информированное согласие на выделение и использование в научных целях образцов жировой ткани.

Критериями невключения являлись: наличие аутоиммунных патологий; наличие злокачественных новообразований, в том числе в анамнезе; наличие острых или хронических воспалительных заболеваний; де-компенсированный сахарный диабет (HbA1c >8%); длительная гормональная или антибактериальная терапия; анемия (гемоглобин <10 г/дл) и гематологические заболевания; острые нарушения мозгового кровообращения в предшествующие 12 мес.

Пациенты были разделены на подгруппы по возрасту, согласно классификации ВОЗ (1963). Основные клинико-анамнестические характеристики подгрупп представлены в таблице 1.

Выделение и культивирование

ММСК-ЖТ

Выделение ММСК из подкожной жировой ткани проводили с помощью ферментативной обработки [31]. Выделенные клетки высаживали на чашки Петри в концентрации 5х104/см3 и инкубировали при 37°С, 5% СО2. На следующий день в чашках меняли среду. Выход клеток при использованном нами методе выделения составлял 4—7х104 прикрепившихся клеток на 1 мл ткани. Полученные клетки выращивали на стандартном культуральном пластике (Corning Costar, США) в СО2 - инкубаторе (5% СО2; 95% воздуха; 37°С), используя среду, поддерживающую рост недифференцированных мезенхимальных про-гениторных клеток — Advance Stem Cell Basal Medium (HyClone, США), содержащую 10% смеси факторов роста — Advance Stem Cell Growth Supplement

(HyClone, США), 100 Ед/мл пенициллина и 100 Ед/ мл стрептомицина/фунгизона (HyClone, США). При достижении 70—80% конфлуентности монослоя клетки рассаживали в соотношении 1:3 с использованием 0,25% раствора трипсина/0,02% ЭДТА. Для получения кондиционированной среды клетки 2 пассажа в течение 24 ч депривировали в среде роста, не содержащей сыворотку, затем меняли среду на свежую, также не содержащую сыворотку, и культивировали клетки в течение 48 ч. Затем среду собирали, центрифугировали при 200g 5 мин, добавляли коктейль ингибиторов протеаз (1:500, Sigma, кат. № Р1860), аликвоты по 1,5 мл замораживали в жидком азоте и хранили при -70°С.

Характеристика ММСК-ЖТ

Чтобы оценить содержание ММСК в клеточной популяции, культуры 2 пассажа иммунофеноти-пировали антителами к CD14 (eBioscience, США), CD34, CD45, CD73, CD90, CD105, PDGFRB (BD Pharmingen, США) и NG2 (Chemicon, США), конъю-гированными с различными флуорохромами, и оценивали с помощью проточного сортера клеток MoFlo (Dako Cytomation, Дания).

Для анализа способности к адипогенной и остео-генной дифференцировке ММСК-ЖТ культивировали в индукционных средах, используя наборы реагентов (Invitrogen, США) по методике, приложенной к набору. В качестве отрицательного контроля использовали фибробласты кожи и ММСК-ЖТ того же пациента, культивируемые в обычной среде роста.

Анализ экспрессии генов ангиогенных факторов

ММСК-ЖТ

Содержание мРНК исследуемых факторов, участвующих в регуляции ангиогенеза, проводили методом ПЦР в реальном времени. Для этого из клеток выделяли РНК при помощи набора реагентов RNeasy Miny Kit (QIAGEN, США), затем на матрице РНК строили кДНК, используя набор Fermentas Reverse Transcription Reagents (Fermentas, Литва). Далее проводили ПЦР в реальном времени с использованием интеркалирующего красителя SYBR Green I (Ев-роген, Россия) и подобранных праймеров (табл. 2) в амплификаторе BIO-RAD iQ5 Multicolor Real-time PCR detection system (Bio-rad, США). Данные для каждого образца нормировали по экспрессии генов 17, b-actin и gapdh.

Таблица 1. Клинико-анамнестические характеристики подгрупп больных с ИБС разного возраста

Пациенты (n = 64) р

Группа А 43-48 лет Группа Б 52-59 лет Группа В старше 60 лет

Количество пациентов 7 18 39

Средний возраст, лет 47 54,5 69 р < 0,001

Пол, муж/жен 7/0 16/2 32/7 р = 0,81

Функциональный класс стенокардии напряжения II ФК - 1 (14%), III ФК - 5 (72%), IV ФК - 1 (14%) II ФК - 4 (22%), III ФК - 7 (39%), IV ФК - 7 (39%) II ФК - 5 (13%), III ФК-24 (62%), IV ФК-10 (25%) р = 0,58

Инфаркт миокарда в анамнезе 4 (57%) 13 (72%) 26 (67%) р = 0,63

ХСН 1-11А (1-11 ФК по МЧА) 0 (0%) 6 (33%) 11 (28%) р = 0,38

Гипертоническая болезнь 5 (72%) 16 (89%) 33 (85%) р = 0,20

Курение 4 (57%) 9 (50%) 19 (49%) р = 0,92

Ожирение 3 (43%) 13 (89%) 29 (74%) р = 0,22

ИМТ, кг/м2 30,3±6,4 32,5±3,8 28,1±2,9 р = 0,51

Дислипидемия 4 (57%) 13 (72%) 21 (54%) р = 0,65

Сахарный диабет 2-го типа 2 (29%) 10 (55%) 16 (41%) р = 0,38

Нарушение толерантности к глюкозе 1 (14%) 5 (28%) 5 (13%) р = 0,31

Медикаментозная терапия до АКШ

ß-блокаторы 6 (86%) 16 (89%) 34 (87%) р = 0,81

Антиагреганты 7 (100%) 18 (100%) 39 (100%) р = 1,0

Статины 5 (72%) 16 (89%) 37 (95%) р = 0,31

Ингибиторы АПФ 2 (29%) 9 (50%) 21 (54%) р = 0,22

Антагонисты кальция 1 (14%) 4 (22%) 8 (21%) р = 0,92

Диуретики 2 (29%) 7 (39%) 13 (33%) р = 0,38

Нитраты 7 (100%) 17 (94,4%) 37 (95%) р = 0,81

Примечание: ФК — функциональный класс; ХСН — хроническая сердечная недостаточность; ИМТ — индекс массы тела, АКШ — аортокоронарное шунтирование.

Таблица 2. Последовательности использованных олигонуклеотидных праймеров

Ген ПЦР продукт, пн Sequence 5'-3'

VEGFA fw 164 CAACATCACCATGCAGATTATGC

VEGFA rv GCTTTCGTTTTTGCCCCTTTC

PIGF fw 124 TGCGGCGATGAGAATCTGC

PIGF rw AGCGAACGTGCTGAGAGAAC

HGF fw 67 AGGGGCACTGTCAATACCATT

HGF rv CGTGAGGATACTGAGAATCCCAA

ANGPT1 fw 136 CTCGCTGCCATTCTGACTCAC

ANGPT1 rv GACAGTTGCCATCGTGTTCTG

bFGFfw 89 AAGCGGCTGTACTGCAAAAAC

bFGF rw TGAGGGTCGCTCTTCTCCC

Ang fw 113 CTGGGCGTTTTGTTGTTGGTC

Ang rw GGTTTGGCATCATAGTGCTGG

ENDS fw 103 GGCTGGCCTACGTCTTTGG

ENDS rw CGGATGTGGAACAGCAGTGAG

THBS1 fw 212 CCTGACCGTCCAAGGAAAGC

THBS1 rw CCTTTGCGATGCGGAGTCT

L7 fw 66 CTCCGTCTGCGGCAGATC

L7 rv CAGCATGTTAATTGAAGCCTTGTT

ActB fw 144 CCTGGCACCCAGCACAAT

ActB rw GGGCCGGACTCGTCATAC

GAPDHfw 187 TGGTCACCAGGGCTGCTTTTA

GAPDHrw TCCTGGAAGATGGTGATGGGATTT

Анализ содержания факторов роста в кондиционированной среде

Содержание сосудистого эндотелиального фактора роста (VEGF), плацентарного фактора роста (PIGF), фактора роста гепатоцитов (HGF), ангиопоэтина-1 (ANGPT1), ангиогенина (ANG), тромбоспондина-1 (THBS1) и эндостатина (ENDS) в среде культивирования ММСК-ЖТ оценивали с помощью наборов реагентов для иммуноферментного анализа (ELISA) компании R&D Systems (США). Уровень поглощения раствора в лунках определяли при длине волны 450 нм с корректировкой при 620 нм. Полученные значения концентрации исследуемого белка в образцах кондиционированных сред нормировали на количество клеток.

Формирование капилляроподобных структур эндотелиальными клетками на Матригеле Ангиогенную активность суммарных продуктов секреции ММСК-ЖТ в среде культивирования оценивали с помощью методики образования капилляроподобных структур эндотелиальными клетками линии EA.hy926 на Матригеле, обедненном факто-

рами роста (Growth factors reduced Matrigel, BD Biosciences) [32] в присутствии кондиционированной среды ММСК-ЖТ. В качестве отрицательного контроля использовали среду роста эндотелиальных клеток, не содержащую сыворотку, в качестве положительного контроля — среду роста эндотелиальных клеток, содержащую 20% сыворотки. Суммарную длину образованных трубчатых структур в 5 случайно выбранных полях зрения в лунке подсчитывали на изображениях, полученных при использовании объектива х10 с помощью программы MetaMorph 5.0 (Universal Imaging).

Статистический анализ

Статистическую обработку результатов и графическое представление данных производили с использованием пакетов статистических программ SigmaStat 9.0 и Statistica 6.0. При подтверждении нормальности распределения признака методами Колмогорова-Смирнова и Шапиро-Уилксона для сравнения двух независимых групп использовали t-критерий Стью-дента, для анализа данных в нескольких независимых группах — метод ANOVA, в случаях малочисленных выборок (n<10) и распределений, отличных от нормального, для тех же целей использовали U-критерий Манна — Уитни и ANOVA по методу Крускал — Уоллиса, соответственно. Для сравнения распределений порядковых и номинальных признаков применяли тест х2. Корреляционный анализ проводили с использованием метода Пирсона для нормально распределенных выборок и метода Спирмена — в остальных случаях. Для оценки тесноты связи по значению коэффициента корреляции использовали шкалу Чеддо-ка. Различия считали статистически значимыми при уровне значимости p < 0,05. Данные в тексте и на графиках представлены в виде среднее±стандартное отклонение (SD) или как медиана (25-й и 75-й про-центили), если не указано иначе.

Результаты

Характеристика ММСК-ЖТ, полученных

от пациентов с ИБС разного возраста

Клетки, выделенные из жировой ткани с помощью ферментативной обработки, представляли собой смешанную популяцию различных клеточных типов, однако при культивировании в среде, поддерживающей рост недифференцированных ММСК, ко 2 пассажу в культуре оставались клетки, имеющие фибробла-стоподобную морфологию. Заметных различий в части морфологии клеток, полученных от пациентов разных возрастных групп, выявлено не было.

Анализ иммунофенотипа культивированных до 2 пассажа ММСК-ЖТ с помощью метода проточной цитофлуориметрии показал, что эти клетки экспрес-сируют мезенхимальные маркеры CD73 (>85%), CD90 (>95%) и CD105 (>99%) в сочетании со сниженной продукцией CD14 (<10%), CD19 (<10%), CD34(<5%), CD45 (<2%), CD79 (<10%). Такой профиль экспрессии является типичным для ММСК, согласно определению Международного общества клеточной терапии (International Society for Cellular Therapy Statement) [33]. ММСК-ЖТ также экспрес-сируют маркеры, характерные для перицитов, такие как NG2 (>99%) и PDGFRB (>80%). Доля клеток, «несущих» мезенхимальные маркеры, была одинаковой в разных возрастных группах (табл. 3).

Таблица 3. Экспрессия маркеров мезенхимальных клеток и перицитов на поверхности ММСК, выделенных из жировой ткани пациентов разного возраста

Маркеры 43-48 лет Старше 60 лет

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

CD90 97 (96-98)% 96 (95-97)%

CD73 92 (88-95)% 93 (92-94)%

CD105 >99% >99%

PFGFRB 83 (82-84)% 85 (83-88)%

NG2 >99% >99%

Одной из определяющих характеристик ММСК является их мультипотентность, т.е. способность к направленной дифференцировке в адипогенном, остеогенном и хондрогенном направлениях [7, 29, 31]. Мы культивировали выборочные образцы клеток в соответствующих индукционных средах и показали, что ММСК-ЖТ и молодых, и пожилых пациентов способны к адипогенной и остеогенной дифференцировке.

Изменение ангиогенной активности ММСК-ЖТ с возрастом

Способность ММСК-ЖТ стимулировать рост кровеносных сосудов обусловлена в значительной степени продукцией ими широкого набора ангиогенных факторов [4—9, 12—14]. Учитывая это, мы проанализировали ангиогенную активность суммарных продуктов секреции клеток в среду культивирования на модели образования капилляроподобных структур эндотелиальными клетками на Матригеле in vitro.

Было обнаружено, что способность кондиционированной среды ММСК-ЖТ стимулировать образование тубулярных структур снижается с возрастом, что выражалось в обратной корреляции между общей длиной тубулярных структур и возрастом пациентов (r = -0,38, p = 0,02). Кондиционированная среда клеток, выделенных из жировой ткани пациентов старшего возраста (старше 60 лет), стимулировала образование тубулярных структур в достоверно меньшей степени, чем среда клеток, полученных от более молодых пациентов (рис. 1).

Для того чтобы установить, изменение продукции каких именно ангиогенных факторов лежит в основе снижения ангиогенной активности ММСК-ЖТ пациентов старшего возраста, мы оценили содержание проангиогенных (VEGF, PlGF, HGF, Angptl и ANG) и антиангиогенных (THBS1 и ENDS) факторов в кондиционированных средах ММСК-ЖТ пациентов разного возраста (табл. 4).

Мы обнаружили, что средние значения содержания ангиогенных факторов в среде культивирования ММСК-ЖТ были в несколько раз ниже в старших возрастных группах, чем в более молодых, статистически значимые различия наблюдали для VEGF, HGF и ANG, достоверных различий для остальных факторов из-за выраженного разброса показателей не было получено. Корреляционный анализ показал наличие достоверных обратных связей между содержанием проангиогенных факторов VEGF, PlGF, HGF и ANG в кондиционированной среде ММСК-ЖТ и возрастом пациентов (см. табл. 4; рис. 1А—Д). В то же время содержание антиангиогенных факторов (THBS1 и ENDS) в кондиционированной среде ММСК-ЖТ менялось с возрастом незначительно (рис. 3В-Г).

Таблица 4. Содержание ангиогенных факторов роста в кондиционированной среде ММСК-ЖТ (нг/млн клеток), полученных от пациентов разных возрастных групп

Факторы Группа А 43-48 лет (n = 7) Группа Б 52-58 лет (n = 18) Группа В > 60 лет (n = 39) р A vs. B

VEGF 18,9 (13,4-23,1) 14,2 (7,1-24,4) 7,9 (3,0-16,6) 0,026

r* -0,40, р = 0,002 (связь умеренная)

PlGF 0,169 (0,15-0,84) 0,089 (0,01-0,22) 0,075 (0,04-0,18) 0,15

r -0,35, р = 0,005 (связь умеренная)

ANGPT1 1,00 (0,88-2,98) 0,43 (0,29-0,85) 0,47 (0,15-1,14) 0,071

r **

HGF 9,7 (1,3-19,3) 2,5 (1,2-8,2) 1,4 (1,1-2,6) 0,027

r -0,42, р = 0,047 (связь умеренная)

ANG 4,70 (1,97-8,93) 2,61 (0,84-3,89) 0,86 (0,52-1,83) 0,005 0,037*

r -0,54, р < 0,001 (связь умеренная)

THBS1 159,1 (70,7-656) 133,3 (133,2-303) 198,6 (87,7-420) >0,15

r **

ENDS 2,8 (1,8-3,7) 5,0 (4,1-7,6) 4,6 (3,3-7,1) 0,3

r **

Примечание: r — коэффициент корреляции между содержанием фактора роста и возрастом пациентов; * — уровень значимости р при сравнении групп Б и В; ** — корреляции нет, уровень значимости p > 0,05; VEGF — сосудистый эндо-телиальный фактор роста; PlGF — плацентарный фактор роста; HGF — фактор роста гепатоцитов; Angptl — ангиопоэтин-1; ANG — ангиогенин; THBS1 — тромбоспондин-1; ENDS — эндостатин.

200 1500 100 50 0

_ts_

£1

43-48 лет 52-59 лет

Возраст пациентов

Рис. 1. Капилляроподобные структуры, образованные эндотелиоцитами на Матригеле в присутствии кондиционированной среды мМсК-ЖТ, полученных от пациентов разного возраста. На графике изображены результаты количественной оценки суммарной длины тубулярных структур для групп пациентов разного возраста. *-р = 0,13, **-р = 0,046

>60 лет

Jl hgf

25 Л *

10 Л

Ii *

ID -..... * * Л

5 .......—

0 б

Ii 50

45 io w во ej те к so 4C «s w и so ei то 75 so

Возраст пациентов

Рис. 2. Зависимость между содержанием ангиогенных факторов роста в кондиционированной среде ММСК-ЖТ (нг/млн клеток) и возрастом пациентов-доноров:

А - VEGF, Б - HGF, B - PIGF, Г - Angptl, Д - ANG; Е - содержание мРНК PIGF в ММСК-ЖТ пациентов разного возраста. А-Д: иммуноферментный анализ (ELISA); Е - ПЦР. *-p = 0,071

Следует отметить, что ангиогенная активность суммарных продуктов секреции ММСК-ЖТ в среде культивирования сильнее всего коррелировала с содержанием ангиогенина (г = 0,66, р = 0,05), ангио-поэтина-1 (г = 0,77, р < 0,0001) и HGF (г = 0,65, р < 0,0001), но несколько слабее с уровнем VEGF (г = 0,51, р < 0,0001), что указывает на существенный вклад уровня продукции этих ангиогенных факторов на выраженность ангиогенной активности ММСК-ЖТ.

Чтобы выявить механизмы снижения секреции ангиогенных факторов ММСК-ЖТ, мы проанализировали содержание мРНК генов основных регуляторов ангиогенеза в клетках пациентов разных возрастных

групп. Мы наблюдали статистически значимое снижение содержания мРНК Р^ в ММСК-ЖТ пациентов старшего возраста (рис. 2Е), в то время как содержание мРНК других про- и антиангиогенных факторов (рис. 3А—Б) с возрастом изменялось незначительно, что позволяет предполагать наличие посттрансляционных механизмов снижения секреции проангиогенных факторов ММСК-ЖТ при старении организма.

Таким образом, снижение при старении продукции основных проангиогенных факторов (VEGF, Р^, HGF, Апдр^, ангиогенина) может лежать в основе ухудшения ангиогенных свойств ММСК-ЖТ пожилых пациентов.

■ер oíso

I4Q

oCO

Ï10 EiO

А

43-4S 53-59

>60

Í.

Ъ

CL

if FF

4>4S 52-59

>60

с о * О) I о Ю I H

Sc s ¡5 s2

I О Ä

rag- i

&Н gf1

u Ü

Возраст пациентов

Рис. 3. Содержание мРНК антиангиогенных факторов в ММСК-ЖТ пациентов разного возраста: А - THBS1, *- p = 0,6; **- p = 0,66; Б - ENDS, *- p = 0,075; В, Г - корреляция между содержанием антиангиогенных факторов роста в кондиционированной среде и возрастом пациентов. А, Б: ПЦР, В, Г: иммуноферментный анализ (ELISA).

Обсуждение

Стволовые клетки опосредуют физиологическое обновление и регенерацию тканей организма в течение всей жизни. Возможно, что снижение способности организма к регенерации с возрастом обусловлено влиянием старения на активность стволовых и прогениторных клеток. Подавление функциональной активности клеток-предшественниц при старении может быть обусловлено несколькими механизмами, включая укорочение длины теломер и снижение активности теломеразы [34], уменьшение пролиферационного потенциала, ослабление антиоксидантной защиты клеток и (или) увеличение оксидативного стресса [35], необратимую модификацию белков, а также нарушение репарации геномной ДНК и изменение паттерна ее метилирования. Следует учитывать, что описанные механизмы отражают процессы «внутреннего» старения клеток, в то время как даже большее значение, по современным представлениям, может иметь воздействие измененного при старении микроокружения прогениторных клеток. Так, в работе Y. Sun с соавт. (2011) показано, что ММСК от старых животных восстанавливают способность к самообновлению и остеогенезу при культивировании на внеклеточном матриксе, синтезированном клетками молодых животных [27]. Аналогичным образом эндотелиальные предшественники, выделенные из крови старых крыс, восстанавливают свои функции in vitro и in vivo после культивирования в присутствии сыворотки крови молодых животных [28].

Влияние старения организма на ММСК хорошо изучено на клетках костного мозга. Так, многие авторы показали снижение количества ММСК в аспирате костного мозга с возрастом [26, 36, 37], снижение

пролиферации и потенциала к дифференцировке в различных направлениях ММСК пожилых пациентов [23, 24, 27]. A. Wilson с соавт. (2010) выявили более 8000 генов, по-разному экспрессирующих-ся в ММСК костного мозга мышей в возрасте 2, 8 и 26 мес. [38].

□ публикованы отдельные данные, касающиеся влияния возраста на количество и свойства ММСК-ЖТ. В большинстве работ показано, что количество ММСК в жировой ткани, оцененное с помощью проточной цитофлуорометрии, не уменьшается с возрастом [39, 40], однако их клоногенность, про-лиферативный потенциал [29, 41, 42], способность к дифференцировке [28, 39, 43] и продукции VEGF [30] снижаются при старении.

Ранее нами было показано, что в ММСК-ЖТ жировой ткани старых мышей происходят изменения, характерные для стареющих клеток: укорочение те-ломер, снижение скорости пролиферации, усиление оксидативного стресса, и ухудшается их способность стимулировать рост кровеносных сосудов на моделях in vitro и in vivo [44, 45]. В настоящей работе мы проанализировали, как изменяются с возрастом ангиогенные свойства ММСК-ЖТ пациентов с ИБС — одних из наиболее вероятных кандидатов для клеточной терапии аутогенными клетками.

По экспрессии основных маркеров ММСК, принятых Международным обществом клеточной терапии (International Society for Cellular Therapy) [33], а также маркеров, характерных для перицитов (NG2 и PDGFRB), культивированные ММСК-ЖТ пациентов разного возраста не различались, что может свидетельствовать в пользу того, что с возрастом доля ММСК в жировой ткани не снижается.

Для оценки ангиогенной активности суммарных продуктов секреции ММСК-ЖТ мы анализировали формирование капилляроподобных структур эн-дотелиальными клетками в присутствии кондиционированной среды ММСК-ЖТ и обнаружили, что кондиционированная среда ММСК-ЖТ пожилых пациентов хуже стимулирует образование тубулярных структур эндотелиальными клетками, чем среда ММСК-ЖТ более молодых пациентов. Схожие результаты были получены нами ранее при сравнении ММСК-ЖТ, полученных от мышей разных возрастных групп [44, 45], что подтверждает, что этот эффект, по-видимому, связан именно с возрастом пациентов.

Секреция паракринных факторов является основным, хотя и не единственным механизмом ангиоген-ного и регенеративного эффекта ММСК-ЖТ [3—9, 13, 14, 21]. Роль конкретных факторов, секретируе-мых ММСК-ЖТ, в паракринных эффектах клеток изучена мало. В одном из исследований было определено, что антиапоптотический эффект ММСК-ЖТ на неонатальные кардиомиоциты на 62,5% обусловлен действием инсулинового фактора роста (IGF-1), а на 34,2% - действием VEGF [46]. В работе L. Cai с со-авт. (2007) с помощью стабильного подавления HGF shRNA было показано, что продукция HGF ММСК-ЖТ является принципиально важной для реализации их способности восстанавливать васкуляризацию ише-мизированной ткани [47]. Мы показали, что секреция важнейших проангиогенных факторов — VEGF, PIGF, HGF, ангиопоэтина-1 и ангиогенина ММСК-ЖТ, полученными от больных ИБС, снижается с возрастом. Однако содержание мРНК ангиогенных факторов в клетках, за исключением PlGF, меняется с возрастом незначительно, что позволяет предполагать наличие посттрансляционных механизмов снижения секреции проангиогенных факторов ММСК-ЖТ человека при старении.

Снижение продукции VEGF ММСК-ЖТ было продемонстрировано в уже упоминавшейся работе S. El-Ftesi c соавт. (2009) [30]. Более выраженная экспрессия VEGF была показана для ММСК костного мозга молодых крыс по сравнению с клетками старых животных [48]. Снижение экспрессии VEGF и увеличение экспрессии антиангиогенного фактора TBS2 с возрастом наблюдались в ММСК мышей в возрасте 24 мес. по сравнению с 6-мес. животными [49]. Мы впервые показали, что секреция ММСК-ЖТ не только VEGF, но и целого комплекса проангиогенных факторов роста снижается при старении.

Самую сильную связь с ангиогенной активностью ММСК-ЖТ мы наблюдали для содержания в кондиционированной среде ANG и Angpt1. ANG относится к семейству рибонуклеаз со специальными биологическими функциями и обладает проангиогенной активностью. Связывание ANG с актином и последующее открепление образовавшегося комплекса играет важную роль в индуцируемой им инвазии эндотели-альных и гладкомышечных клеток путем активации клеточноассоциированных протеаз [50]. ANG также стимулирует пролиферацию эндотелиальных клеток и способствует образованию тубулярных структур in vitro [51], что подтверждают наши данные.

Angpt1 принципиально важен для ангиогене-за как в норме, так и при патологии, поскольку он регулирует стабилизацию кровеносных сосу-

дов и обеспечивает формирование стабильной, зрелой сосудистой сети. Как и остальные ангио-поэтины, он связывается с Tie2 рецептором, что является необходимым для ветвления образующихся сосудов, их ремоделирования и стабилизации [52, 53]. В отсутствие Angpt1 под действием VEGF образуются незрелые сосуды с высокой проницаемостью, в то время как совместная экспрессия этих двух факторов приводит к формированию полноценных сосудов [54]. На животных моделях ишемии было показано, что Angpt1 увеличивает количество сосудистых коллатералей [55]. Таким образом, способность ММСК-ЖТ се-кретировать не только VEGF, но и другие факторы, такие как Angpt1, ANG и др., обусловливает их ан-гиогенную активность, а с возрастом происходит снижение продукции этих факторов, что приводит к ухудшению ангиогенных свойств ММСК-ЖТ.

Ассоциированное с возрастом пациентов снижение ангиогенной активности ММСК-ЖТ может быть обусловлено усилением продукции антиангиогенных факторов клетками пожилых пациентов. Выраженным антиангиогенным действием обладает эндоста-тин, представляющий собой биологически активный С-концевой фрагмент коллагена XVIII, существенно модулирующий паттерн генной экспрессии эндо-телиальных клеток и подавляющий их пролиферацию [56]. Другой фактор — THBS1 — является ма-триксным белком, постоянно экспрессирующимся в ММСК человека и являющимся аутокринным фактором для сосудистых гладкомышечных клеток. THBS1 напрямую подавляет миграцию, пролиферацию, выживаемость и апоптоз эндотелиальных клеток, в том числе за счет антагонизма с VEGF [57]. Было показано, что содержание мРНК THBS1 повышено в фи-бробластах от 24-мес. крыс по сравнению с 3-мес. [58]. Однако мы не обнаружили значимой зависимости между продукцией антиангиогенных факторов (THBS1 и ENDS) ММСК-ЖТ и возрастом пациентов с ИБС.

Заключение

Использование аутогенных ММСК-ЖТ открывает широкие перспективы для разработки новых методов лечения заболеваний ишемического гене-за, благодаря их способности стимулировать рост кровеносных сосудов, в основном путем продукции ангиогенных факторов роста и цитокинов. Однако в нашей работе показано, что возраст пациентов может оказывать значительное влияние на ангио-генные свойства ММСК-ЖТ, в том числе у больных ИБС. Мы установили, что ММСК, выделенные из жировой ткани пожилых пациентов с ИБС, несмотря на сохранение иммунофенотипа, свойственного ММСК, и мультипотентности, секретируют меньше проангиогенных факторов, чем клетки пациентов молодого и среднего возраста, что подтверждается на модели образования капилляроподобных структур эндотелиальными клетками на Матригеле. Это накладывает определенные ограничения на применение аутологичных клеточных препаратов у пожилых пациентов, которые составляют самую большую когорту среди кандидатов на проведение клеточной терапии заболеваний ишемического генеза. Кроме того, полученные нами результаты и значительный разброс данных между пациентами по ангиогенным свойствам ММСК-ЖТ указывают на необходимость

тестирования пригодности аутогенных клеток стимулировать рост кровеносных сосудов, а также актуальность разработки методов предтрансплантационной подготовки ММСК-ЖТ пожилых пациентов, способствующих усилению ангиогенных свойств клеток. К таким методам можно отнести гипоксическое пре-кондиционирование, эффективность которого была продемонстрирована нами ранее [44], а также генетическую модификацию ММСК-ЖТ конструкциями, несущими гены факторов роста [28, 59], продукция которых снижена у пожилых больных.

ЛИТЕРАТУРА:

1. Gimble J.M., Bunnell B.A., Chiu E.S. et al. Concise review: adipose derived stromal vascular fraction cells and stem cells: let's not get lost in translation. Stem Cells 2011; 29(5): 749-54.

2. Strem B.M., Hicok K.C., Zhu M. et al. Multipotential differentiation of adipose tissue-derived stem cells. Keio J. Med. 2005; 54: 132-41.

3. Парфенова Е.В., Цоколаева З.И., Трактуев Д.О. и др. Поиск новых «инструментов» для терапевтического ангиогенеза. Молекулярная медицина 2006; 2: 10-23.

4. Трактуев Д.О., Марч К.Л., Ткачук В.А. и др. Стромальные клетки жировой ткани — мультипотентные клетки с терапевтическим потенциалом для стимуляции ангиогенеза при ишемии тканей. Кардиология 2006; 46(6): 53-63.

5. Трактуев Д.О., Парфенова Е.В., Ткачук В.А. и др. Стро-мальные клетки жировой ткани - пластический тип клеток с высоким терапевтическим потенциалом. Цитология 2006; 48(2): 83-94.

6. Rehman J., Traktuev D., Li J. et al. Secretion of angiogenic and antiapoptotic factors by human adipose stromal cells. Circulation 2004; 109: 1292-8.

7. Miyahara Y., Nagaya N., Kataoka M. et al. Monolayered mesenchymal stem cells repair scarred myocardium after myocardial infarction. Nat. Med. 2006; 12: 459-65.

8. Nakagami H., Morishita R., Maeda K. et al. Adipose tissue-derived stromal cells as a novel option for regenerative cell therapy. J. Atheroscler. Thromb. 2006; 13: 77-81.

9. Gimble J. M., Katz A. J., Bunnell B. A. Adipose-derived stem cells for regenerative medicine. Circ. Res. 2007; 100: 1249-60.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

10. Zhang D.Z., Gai L.Y., Liu H.W. et al. Transplantation of autologous adipose-derived stem cells ameliorates cardiac function in rabbits with myocardial infarction. Chin. Med. J. (Engl). 2007; 120: 300-7.

11. Cai L., Johnstone B.H., Cook T.G. et al. IFATS collection: human adipose tissue-derived stem cells induce angiogenesis and nerve sprouting following myocardial infarction, in conjunction with potent preservation of cardiac function. Stem Cells 2009; 27: 230-7.

12. Kondo K., Shintani S., Shibata R. et al. Implantation of adipose-derived regenerative cells enhances ischemia-induced angiogenesis. Arterioscler. Thromb. Vasc. Biol. 2009; 29: 61-6.

13. Rubina K., Kalinina N., Efimenko A. et al. Adipose stromal cells stimulate angiogenesis via promoting progenitor cell differentiation, secretion of angiogenic factors, and enhancing vessel maturation. Tissue Eng. Part A. 2009; 15: 2039-50.

14. Madonna R., De Caterina R. Adipose tissue: a new source for cardiovascular repair. J. Cardiovasc. Med. (Hagerstown). 2010; 11: 71-80.

15. Kachgal S., Putnam A.J. Mesenchymal stem cells from adipose and bone marrow promote angiogenesis via distinct cytokine and protease expression mechanisms. Angiogenesis 2011; 14(1): 47-59.

16. Miranville A., Heeschen C., Sengenes C. et al. Improvement of postnatal neovascularization by human adipose tissue-derived stem cells. Circulation 2004; 110: 349-55.

17. Planat-Benard V., Silvestre J. S., Cousin B. et al. Plasticity of human adipose lineage cells toward endothelial cells: physiological and therapeutic perspectives. Circulation 2004; 109: 656-63.

18. Sumi M., Sata M., Toya N. et al. Transplantation of adipose stromal cells, but not mature adipocytes, augments ischemia-induced angiogenesis. Life Sci. 2007; 80: 559-65.

19. Nombela-Arrieta C., Ritz J., Silberstein L.E. The elusive nature and function of mesenchymal stem cells. Nat. Rev. Mol. Cell Biol. 2011; 12(2): 126-31.

20. Madonna R., Geng Y.J., De Caterina R. Adipose tissue-derived stem cells: characterisation and potencial for cardiovascular repair. Arterioscler. Thromb. Vasc. Biol. 2009; 29: 1723-729.

21. Murohara T., Shintani S., Kondo K. Autologous adipose-derived regenerative cells for therapeutic angiogenesis. Curr. Pharm. Des. 2009; 15(24): 2784-90.

Благодарности

Работа выполнена при финансовой поддержке Государственного контракта № 16.512.11.2251 Министерства образования и науки Российской Федерации, а также гранта №241558 (SICA-HFJ Седьмой рамочной программы Европейского союза [FP7/2007-2013], Государственного контракта №02.527.11.0007 Министерства образования и науки Российской Федерации и гранта №16.512.11.2262 Федерального агентства науки и инноваций Российской Федерации.

22. Bailey A.M., Kapur S., Katz A. J. Characterization of adipose-derived stem cells: an update. Curr. Stem Cell. Res. Ther. 2010; 5(2): 95-102.

23. Fehrer C., Lepperdinger G. Mesenchymal stem cell aging. Exp. Gerontol. 2005; 40: 926-30.

24. Sethe S., Scutt A., Stolzing A. Aging of mesenchymal stem cells. Ageing Res. Rev. 2006; 5: 91-116.

25. Stolzing A., Sethe S., Scutt A. M. Stressed stem cells: Temperature response in aged mesenchymal stem cells. Stem Cells Dev. 2006; 15: 478-87.

26. Katsara O., Mahaira L.G., Iliopoulou E.G. et al. Effects of donor age, gender and in vitro cellular aging on the phenotype, functional and molecular characteristics of mouse bone marrow-derived mesenchymal stem cells. Stem Cells Dev. 2011; 20(9): 1549-61.

27. Sun Y., Li W., Lu Z. et al. Rescuing replication and osteogenesis of aged mesenchymal stem cells by exposure to a young extracellular matrix. FASEB 2011; 25(5): 1474-85.

28. Zhu M., Kohan E., Bradley J. et al. The effect of age on osteogenic, adipogenic and proliferative potential of female adipose-derived stem cells. J. Tissue Eng. Regen. Med. 2009; 3: 290-301.

29. Huang S.C., Wu T.C., Yu H.C. et al. Mechanical strain modulates age-related changes in the proliferation and differentiation of mouse adipose-derived stromal cells. BMC Cell Biology 2010; 11: 18.

30. El-Ftesi S., Chang E.I., Longaker M.T. et al. Aging and diabetes impair the neovascular potential of adipose-derived stromal cells. Plast. Reconstr. Surg. 2009; 123: 475-85.

31. Zuk P.A., Zhu M., Ashjian P. et al. Human adipose tissue is a source of multipotent stem cells. Mol. Biol. Cell. 2002; 13: 4279-95.

32. Aranda E., Owen G.I. A semi-quantitative assay to screen for angiogenic compounds and compounds with angiogenic potential using the EA.hy926 endothelial cell line. Biol. Res. 2009; 42(3): 377-89.

33. Dominici M., Le Blanc K., Mueller I., et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006; 8(4): 315-7.

34. Flores I., Blasco M. A. The role of telomeres and telomerase in stem cell aging. FEBS Lett. 2010; 584: 3826-30.

35. Dasgupta J., Kar S., Liu R. et al. Reactive oxygen species control senescence-associated matrix metalloproteinase-1 through c-Jun-N-terminal kinase. J. Cell Physiol. 2010; 225: 52-62.

36. Baxter M.A., Wynn R.F., Jowitt S.N. et al. Study of telomere length reveals rapid aging of human marrow stromal cells following in vitro expansion. Stem Cells 2004; 22: 675-82.

37. Stolzing A., Jones E., McGonagle D., Scutt A. Age-related changes in human bone marrow-derived mesenchymal stem cells: consequences for cell therapies. Mech. Ageing Dev. 2008; 129: 163-73.

38. Wilson A., Shehadeh L.A., Yu H. et al. Age-related molecular genetic changes of murine bone marrow mesenchymal stem cells. BMC Genomics 2010; 11: 229.

39. de Girolamo L., Lopa S., Arrigoni E. et al. Human adipose-derived stem cells isolated from young and elderly women: their differentiation potential and scaffold interaction during in vitro osteoblastic differentiation. Cytotherapy 2009; 11(6): 793-803.

40. Harris L.J., Zhang P., Abdollahi H. et al. Availability of adipose-derived stem cells in patients undergoing vascular surgical procedures. J. Surg. Res. 2010; 163(2): e105-12.

41. van Harmelen V., Skurk T., Hauner H. Primary culture and differentiation of human adipocyte precursor cells. Methods Mol. Med. 2005; 107: 125-35.

42. Schipper B.M., Marra K.G., Zhang W. et al. Regional anatomic and age effects on cell function of human adipose-derived stem cells. Ann. Plast. Surg. 2008; 60: 538-44.

43. Khan W.S., Adesida A.B., Tew S.R. et al. The epitope characterisation and the osteogenic differentiation potential of human fat pad-derived stem cells is maintained with ageing in later life. Injury 2009; 40: 150-7.

44. Efimenko A.Yu., Starostina E.E., Kalinina N.I. et al. Angiogenic properties of aged adipose derived mesenchymal stem cells after hypoxic conditioning. Translat. Med. 2011; 9: 10.

45. Ефименко А.Ю., Старостина Е.Е., Калинина Н.И. и др. Влияние возраста на ангиогенные свойства мезенхимальных стволовых клеток жировой ткани. Клеточная трансплантология и тканевая инженерия 2011; VI(3): 48—57.

46. Sadat S., Gehmert S., Song Y. H. et al. The cardioprotective effect of mesenchymal stem cells is mediated by IGF-I and VEGF. Biochem. Biophys. Res. Commun. 2007; 363(3): 674—9.

47. Cai L., Johnstone B. H., Cook T. G. et al. Suppression of hepatocyte growth factor production impairs the ability of adipose-derived stem cells to promote ischemic tissue revascularization. Stem Cells 2007; 25(12): 3234—43.

48. Jiang S., Kh Haider H., Ahmed R.P. et al. Transcriptional profiling of young and old mesenchymal stem cells in response to oxygen deprivation and reparability of the infarcted myocardium. J. Mol. Cell Cardiol. 2008; 44: 582—96.

49. Sadoun E., Reed M.J. Impaired angiogenesis in aging is associated with alterations in vessel density, matrix composition, inflammatory response, and growth factor expression. J. Histochem. Cytochem. 2003; 51: 1119—30.

50. Gao X., Xu Z. Mechanisms of action of angiogenin. Acta Biochim. Biophys. Sin. 2008; 40(7): 619—24.

51. Jimi S., Ito K., Kohno K. et al. Modulation by bovine angiogenin of tubular morphogenesis and expression of plasminogen activator in bovine endothelial cells. Biochem. Biophys. Res. Commun. 1995; 211(2): 476—83.

52. Distler J.W., Hirth A., Kurowska-Stolarska M. Angiogenic and angiostatic factors in the molecular control of angiogenesis. Q. J. Nucl. Med. 2003; 47: 149—61.

53. Reiss Y. Angiopoietins. Recent. Results Cancer Res. 2010; 180: 3—13.

54. Thurston G., Suri C., Smith K. et al. Leakage-resistant blood vessels in mice transgenically overexpressing angiopoietin-1. Science 1999; 286: 2511—14.

55. Chae J.K., Kim I., Lim S.T. et al. Coadministration of angiopoietin-1 and vascular endothelial growth factor enhances collateral vascularization. Arterioscl. Thromb. Vasc. Biol. 2000; 20: 2573—8.

56. Song N., Ding Y., Zhuo W. et al. The nuclear translocation of endostatin is mediated by its receptor nucleolin in endothelial cells. Angiogenesis 2012; 15(4): 697—711.

57. Lawler PR, Lawler J. Molecular basis for the regulation of angiogenesis by thrombospondin-1 and -2. Cold Spring Harb. Perspect. Med. 2012; 2(5): a006627.

58. Olson B.A., Day J.R., Laping N.J. Age-related expression of renal thrombospondin 1 mRNA in F344 rats: resemblance to diabetes-induced expression in obese Zucker rats. Pharmacology 1999; 58: 200—8.

59. Шевченко Е.К., Макаревич П.И., Цоколаева З.И. и др. Эффективная трансдукция стромальных клеток жировой ткани человека с помощью рекомбинантного аденоассоциированного вируса. Клеточная трансплантология и тканевая инженерия 2010; V(1): 60—64.

Поступила 24.09.2012

i Надоели баннеры? Вы всегда можете отключить рекламу.