Научная статья на тему 'Индуцированные плюрипотентные стволовые клетки гибридов полёвок Microtus levis × Microtus arvalis: условия, необходимые для получения и поддержания'

Индуцированные плюрипотентные стволовые клетки гибридов полёвок Microtus levis × Microtus arvalis: условия, необходимые для получения и поддержания Текст научной статьи по специальности «Биология»

116
36
Поделиться
Журнал
Acta Naturae (русскоязычная версия)
ВАК
RSCI
PubMed
Область наук
Ключевые слова
РЕПРОГРАММИРОВАНИЕ / ИНДУЦИРОВАННЫЕ ПЛЮРИПОТЕНТНЫЕ СТВОЛОВЫЕ КЛЕТКИ / ОБЫКНОВЕННЫЕ ПОЛЁВКИ

Аннотация научной статьи по биологии, автор научной работы — Григорьева Е.В., Шевченко А.И., Медведев С.П., Мазурок Н.А., Железова А.И., Закиян С.М.

Культуры плюрипотентных стволовых клеток уникальный инструмент, расширяющий экспериментальные возможности исследования и моделирования различных биологических процессов, и с каждым годом увеличивается список видов млекопитающих, для которых получены такие культуры. В представленной работе получены индуцированные плюрипотентные стволовые клетки (ИПСК) гибридов от скрещивания двух видов Microtus levis × Microtus arvalis из группы обыкновенных полёвок объекта исследования молекулярно-генетической организации генома и механизмов процесса инактивации Х-хромосомы. ИПСК обыкновенных полёвок получены и поддерживаются в культуральной среде, содержащей цитокин LIF, основной фактор роста фибробластов bFGF, аскорбиновую кислоту и эмбриональную бычью сыворотку. Поддержание недифференцированного состояния в линиях ИПСК обыкновенных полёвок обеспечивается за счет активации собственных генов плюрипотентности: Nanog, Oct4, Sox2, Sall4, Esrrb. ИПСК способны поддерживать недифференцированное состояние на протяжении по крайней мере 28 пассажей без изменения морфологии и образовывать производные трех первичных зародышевых листков: эктодермы, мезодермы и энтодермы при дифференцировке.

Похожие темы научных работ по биологии , автор научной работы — Григорьева Е.В., Шевченко А.И., Медведев С.П., Мазурок Н.А., Железова А.И., Закиян С.М.,

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Текст научной работы на тему «Индуцированные плюрипотентные стволовые клетки гибридов полёвок Microtus levis × Microtus arvalis: условия, необходимые для получения и поддержания»

ЭКСПЕРИМЕНТАЛЬНЫЕ СТАТЬИ

УДК 576.3:602.9:599.323.4

Индуцированные плюрипотентные стволовые клетки гибридов полёвок Microtus levis х Microtus arvalis: условия, необходимые для получения и поддержания

Е. В. Григорьева1,2,3, А. И. Шевченко1,2,3, С. П. Медведев1,2,3,4, Н. А. Мазурок1,2,3, А. И. Железова1, С. М. Закиян1 2 3 4*

Федеральный исследовательский центр Институт цитологии и генетики СО РАН, 630090, Новосибирск, просп. Академика Лаврентьева, 10

2Институт химической биологии и фундаментальной медицины СО РАН, 630090, Новосибирск, просп. Академика Лаврентьева, 8

3Новосибирский научно-исследовательский институт патологии кровообращения

им. академика Е.Н. Мешалкина Министерства здравоохранения РФ, 630055, Новосибирск,

ул. Речкуновская, 15

4Новосибирский национальный исследовательский государственный университет, 630090, Новосибирск, ул. Пирогова, 2 *E-mail: zakian@bionet.nsc.ru Поступила в редакцию 15.04.2015

РЕФЕРАТ Культуры плюрипотентных стволовых клеток - уникальный инструмент, расширяющий экспериментальные возможности исследования и моделирования различных биологических процессов, и с каждым годом увеличивается список видов млекопитающих, для которых получены такие культуры. В представленной работе получены индуцированные плюрипотентные стволовые клетки (ИПСК) гибридов от скрещивания двух видов Microtus levis х Microtus arvalis из группы обыкновенных полёвок - объекта исследования молекулярно-генетической организации генома и механизмов процесса инактивации Х-хромосомы. ИПСК обыкновенных полёвок получены и поддерживаются в культуральной среде, содержащей цитокин LIF, основной фактор роста фибробластов bFGF, аскорбиновую кислоту и эмбриональную бычью сыворотку. Поддержание недифференцированного состояния в линиях ИПСК обыкновенных полёвок обеспечивается за счет активации собственных генов плюрипотентности: Nanog, Oct4, Sox2, Sall4, Esrrb. ИПСК способны поддерживать недифференцированное состояние на протяжении по крайней мере 28 пассажей без изменения морфологии и образовывать производные трех первичных зародышевых листков: эктодермы, мезодермы и энтодермы при дифференцировке.

КЛЮЧЕВЫЕ СЛОВА репрограммирование, индуцированные плюрипотентные стволовые клетки, обыкновенные полёвки.

СПИСОК СОКРАЩЕНИЙ ИПСК - индуцированные плюрипотентные стволовые клетки; мЭСК - эмбриональные стволовые клетки мыши; ПСК - плюрипотентные стволовые клетки; ЭСК - эмбриональные стволовые клетки; ЩФ - щелочная фосфатаза; OSKM - транскрипционные факторы Oct4, Sox2, Klf4 и c-Myc; ОТ-ПЦР - обратная транскрипция с последующей полимеразной цепной реакцией.

ВВЕДЕНИЕ

В настоящее время, помимо традиционного способа выделения плюрипотентных стволовых клеток (ПСК) из ранних эмбрионов млекопитающих, появилась возможность индуцировать плюрипотентность с помощью репрограммирования разных типов терминально дифференцированных соматических кле-

ток [1—4]. Репрограммирование соматических клеток к плюрипотентному состоянию дает возможность получать неограниченное количество аутологичных ИПСК любого млекопитающего, в том числе и человека. Технология репрограммирования открывает широчайшие перспективы не только для персонифицированного подхода к лечению различных заболе-

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

ваний, но и служит инструментом для генетического моделирования множества биологических процессов, в том числе для изучения раннего эмбрионального развития, сигнальных путей и факторов, участвующих в поддержании плюрипотентности и запуске дифференцировки.

Репрограммирование дифференцированных клеток различных видов млекопитающих к плюрипо-тентному состоянию возможно за счет повышенной экспрессии в них генов четырех транскрипционных факторов: Oct4, Sox2, Klf4 и c-Myc (OSKM). У млекопитающих эти гены эволюционно консервативны [5, 6], а их продукты имеют существенно перекрывающийся спектр ключевых генов-мишеней, поэтому зачастую при репрограммировании клеток разных видов удается использовать генетические конструкции, экспрессирующие OSKM человека или мыши [7-10]. В настоящее время получены ИПСК мыши, человека, макаки, крысы, собаки, многих сельскохозяйственных животных и ряда других видов млекопитающих, включая степную полёвку Microtus ochrogaster. Условия, в которых происходит индукция и поддержание плюрипотентности, имеют межвидовые различия [11-19]. Отчасти это обусловлено видоспецифичностью сигнальных каскадов, участвующих в активации и поддержании недифференцированного состояния in vitro, а также связано с различными требованиями к составу среды для культивирования, например, к присутствию или отсутствию в среде сыворотки крупного рогатого скота. Индукции и поддержанию плюрипотентности способствует наличие в среде ингибиторов различных сигнальных путей, ингибиторов деацетилаз ги-стонов, метилтрансфераз гистонов и ДНК, а также антиоксидантов.

В представленной работе подобраны условия получения и поддержания клеток с индуцированной плюрипотентностью видов группы обыкновенных полёвок рода Microtus. Четыре близкородственных криптических вида M. arvalis, M. levis, M. transcaspicus и M. kirgisorum, выделяемых в группу обыкновенных полёвок, являются объектом исследования молекулярно-генетической организации генома и механизмов процесса инактивации Х-хромосомы [20-28]. Для этих видов изучены гены, вовлеченные в установление и поддержание плюри-потентности, показана их консервативность, включая паттерн экспрессии [5, 6, 29]. Наличие плюрипотент-ных клеток обыкновенных полёвок могло бы стать подходящим инструментом для проведения молеку-лярно-генетических работ на видах данной группы.

Ранее нами предпринимались многочисленные попытки по получению ПСК видов группы обыкновенных полёвок рода Microtus из ранних предым-

плантационных бластоцист и терминальных клеток [30]. Были получены мультипотентные линии клеток предымплантационного эмбриона, такие, как трофо-бластные стволовые клетки и клетки экстраэмбриональной энтодермы [25, 31-33]. Однако ПСК обыкновенных полёвок получены не были. В представленной работе в экспериментах по репрограммированию соматических клеток нам впервые удалось подобрать условия, в которых возможно получение и поддержание ПСК обыкновенных полёвок.

ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ

Культуры клеток и состав сред для их культивирования

Из эмбрионов гибридов M. levis х M. arvalis на 19 день эмбрионального развития (Е19) выделяли и культивировали фибробласты кожи и клетки головного мозга. Фибробласты растили в среде DMEM/F12 (F12, Nutrient Mixture/Dullbecco's Modified Eagle Medium; Gibco) в соотношении 1 : 1, содержащей 10% эмбриональной бычьей сыворотки (Fetal Bovine Serum, FBS; Gibco), 1x Non-Essential Amino Acids (NEAA; Gibco), 1x Pen Strep (100 ед./мл пенициллина, 100 мкг/мл стрептомицина; Gibco), 1x GlutaMAX (Gibco). Клетки мозга первые 3 дня культивировали в среде DMEM/F12 (1 : 1), 10% FBS, 1x NEAA, 1x Pen Strep, 1x GlutaMAX, далее переводили их в среду Снайдера: DMEM/F12 (1 : 1), 10 нг/мл bFGF (StemCell), 10 нг/мл EGF (Sigma), 2 мкг/мл гепарина (Sigma), 1x N2 Supplement (Gibco), 1x Pen Strep, 1x GlutaMAX.

В первом эксперименте для индукции плюрипо-тентности в клетках гибридов M. levis x M. arvalis использовали две среды, позволившие получить ИПСК полевки M. ochrogaster [16]. Среды готовили на основе Advanced DMEM/F12 (1 : 1) (Gibco), содержащей 15% заменителя сыворотки (Knockout Serum Replacement, KSR; Gibco), 1x NEAA, 0.1 iM 2-мер-каптоэтанол, 1x Pen Strep, 1x GlutaMAX. В первую среду добавляли ингибиторы сигнальных путей 3iR: CHIR99021 (3 мкМ, StemRD), PD0325901 (1 мкМ, StemRD), A83-01 (0.5 мкМ, Stemgent) и ROCK-ингибитор (Y-27632, 10 мкМ, StemRD), второй вариант среды не содержал ингибиторов. Обе среды содержали 1000 ед./мл LIF мыши (mLIF, Invitrogen) и 2 мкг/мл доксициклина (Sigma), который добавляли лишь на начальных этапах культивирования. Для получения и культивирования ИПСК полёвки в качестве фидерной подложки использовали эмбриональные фибробласты мыши, митотически инакти-вированные раствором митомицина С (10 мкг/мл, Sigma) в течение 2 ч. Пересадку первичных индивидуальных колоний на первом пассаже проводили

при помощи стеклянного капилляра, а в дальнейшем - с использованием TrypLE (Gibco).

В дальнейших экспериментах по репрограммиро-ванию в среде на основе Advanced DMEM/F12 (1 : 1), дополненной 1х NEAA, 0.1 мМ 2-меркаптоэтанолом, 1х Pen Strep, 1х GlutaMAX, варьировали содержание 3iR, mLIF, PKCi (Gö6983,Tocris, 5 мкМ), bFGF, аскорбиновой кислоты, KSR и FBS. В состав культу-ральной среды, в которой были получены ИПСК гибридов M. levis х M. arvalis, входили следующие компоненты: Advanced DMEM/F12 (1 : 1), 7% KSR (Gibco), 7% FBS (Gibco), 0.1 iM 2-меркаптоэтанол, 1х Pen Strep, 1х GlutaMAX, 1000 ед./мл mLIF (Invitrogen), 10 нг/мл bFGF (StemCell), 50 мкг/мл аскорбиновой кислоты (Wako). Первоначально данная среда содержала 2 мкг/мл доксициклина (Sigma), который отменяли на 14-й день репрограммирования. ИПСК полёвки замораживали в 90% FBS и 10% DMSO.

Плазмидные конструкции, получение лентивирусов, схема трансдукции

В экспериментах использовали три плазмиды: 1) TetO-FUW-OSKM (Addgene Plasmid 20321), кодирующую репрограммирующие факторы OSKM мыши; 2) FUdeltaGW-rtTA (Addgene Plasmid 19780), несущую кДНК тетрациклинового трансактиватора, необходимого для регуляции транскрипционной активности конструкции с OSKM, путем добавления в культуральную среду доксициклина; 3) pGpur, содержащую ген зеленого флуоресцентного белка EGFP, для контроля эффективности трансдукции. Лентивирусы получали путем котрансфекции указанных плазмид с плазмидами pxPAX2 (Addgene Plasmid 12260) и pMD2.G (Addgene Plasmid 12259), которые кодируют белки, необходимые для упаковки вирусных частиц, в клетки линии 293FT [34, 35]. Клетки 293FT рассаживали с плотностью 6 х 106 на культуральные флаконы Т75 и инкубировали

в течение ночи. Трансфекцию осуществляли кальций-фосфатным методом [36]. Среду с вирусными частицами собирали через 48, 72 и 96 ч после трансфек-ции и пропускали через фильтр 0.45-мкм (Millipore). Вирусы концентрировали на ультрацентрифуге (Beckman Coulter, Optima XE-90 Ultracentrifuge) в течение 90 мин при 70000 g. Осадок вирусных частиц растворяли в 200 мкл F12/DMEM и хранили в аликвотах при -70оС.

За 1 сут до трансдукции фибробласты и клетки, выделенные из мозга, рассаживали на 12-луночные планшеты с плотностью 50 и 75 тыс. клеток на лунку соответственно. Трансдуцировали клетки 4-6 пассажа. В день трансдукции к клеткам на 14-16 ч добавляли среду с лентивирусами, полученными на основе плазмид TetO-FUW-OSKM, FUdeltaGW-rtTA или pGpur, с титром около 3 X 107 инфицирующих единиц в 1 мл (MOI 5-7.5) для каждого из лентивирусов и 4 мкг/мл полибрена (Hexadimethrine bromide, Sigma). Клетки, трансдуцированные лентивирусами с репрограммирующими факторами и тетрацикли-новым трансактиватором, через 4 сут пересаживали с использованием TrypLE в разведении от 1 : 10 до 1 : 20 (в зависимости от плотности клеток в лунке) на митотически инактивированные эмбриональные фибробласты мыши в культуральные среды, различающиеся по составу. Для определения эффективности трансдукции использовали клетки, трансду-цированные лентивирусами, содержащими pGpur, подсчитывая через 4 сут долю «зеленых» клеток, при помощи флуоресцентного микроскопа и/или проточной цитометрии.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Гистохимическое выявление активности эндогенной щелочной фосфатазы

Активность эндогенной щелочной фосфатазы (ЩФ) выявляли гистохимически согласно [37]. Клетки фиксировали, высушивая на воздухе, и инкубиро-

Таблица 1. Список используемых антител

Антитела Источник Каталожный номер Тип Рабочее разведение

SSEA1 Santa Cruz Biotechnology sc-21702 ^М мыши моноклональные 1 : 50

OCT4 Santa Cruz Biotechnology sc-5279 IgG2b мыши моноклональные 1 : 100

SOX2 Santa Cruz Biotechnology sc-20088 IgG кролика поликлональные 1 : 100

KLF4 Abcam ab104846 IgG1 мыши моноклональные 1 : 200

ß-III-тубулин Covance MMS-435P-100 IgG2a мыши моноклональные 1 : 1000

Нестин Abcam ab6142 IgG1 мыши моноклональные 1 : 400

a-SMA Dako M0851 IgG2a мыши моноклональные 1 : 100

CD90 Millipore MAB1406 IgG2b мыши моноклональные 1 : 100

KRT18 Millipore MAB3234 IgG мыши моноклональные 1 : 200

SOX17 Millipore 09-038 IgG кролика поликлональные 1 : 100

вали в растворе красителя: 100 мкМ Трис-HCl pH 9.0; 100 мкМ NaCl; 5 мкМ MgCl2; 0.4 мкг/мл нафтол-фосфата (Sigma); 1 мкг/мл Fast Violet B Salt (Sigma), в течение 15-20 мин в темноте при комнатной температуре.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Иммунофлуоресцентный анализ

Клетки фиксировали 4% формальдегидом в течение 10-15 мин при комнатной температуре. Промывали PBS и инкубировали с 0.1% Triton Х-100 и 2.5% FBS (или бычьим сывороточным альбумином), растворенными в PBS, в течение 30 мин при комнатной температуре. Иммунопреципитацию с первыми антителами проводили в течение ночи при 4оС. Список первых антител, использованных в работе, приведен в табл. 1. Локализацию первых антител визуализировали при помощи вторых антител к иммуноглобулинам кролика или мыши, конъюгированных с флуоресцентными красителями Alexa 488 и Alexa 568 (Life Technologies). Ядра окрашивали DAPI (Vector Laboratories).

Дифференцировка линий клеток in vitro в эмбриоидных телах

Колонии недифференцированных клеток механически переносили на чашки Петри, покрытые тонким слоем 1% агарозы, в среду DMEM/F12 (1 : 1) с 10% FBS, 1х Pen Strep, 1х GlutaMAX. Образовавшиеся эмбриоидные тела культивировали в течение 7 дней в суспензии и переносили на чашки Петри, покрытые 0.1% желатином, где они распластывались. В распластанном состоянии эмбриоидные тела культивировали в течение 14-20 дней, после чего дифференцированные клетки анализировали иммунофлуо-ресцентным способом либо дезагрегировали TrypLE, выделяли РНК и проводили ОТ-ПЦР.

Выделение РНК, ОТ-ПЦР

РНК выделяли при помощи реагента Trizol Reagent (Ambion). Образцы обрабатывали ДНК-азой I (Turbo DNA-free, Ambion), чтобы избавиться от контаминации ДНК. кДНК синтезировали с использованием Super-ScriptIII (Invitrogen). Последовательности праймеров и условия реакций, использованные в ОТ-ПЦР, приведены в табл. 2. Для анализа транскрипции с привнесенных лентивирусов экзогенной кДНК OSKM мыши использовали праймеры и условия ОТ-ПЦР, приведенные в [34]. Для каждой пары праймеров проводили реакцию негативного контроля (ОТ-), в которой в качестве матрицы использовали реакционную смесь, содержащую все компоненты, необходимые для синтеза кДНК, за исключением обратной транскриптазы.

Бисульфитное секвенирование ДНК промоторной области гена Oct4 полёвки

Бисульфитную модификацию и очистку геномной ДНК (500 нг) проводили с помощью набора реагентов EZ DNA Methylation - Direct Kit (Zymo Research). Модифицированную ДНК использовали в реакции ПЦР с праймерами:

Oct4_Reg2_f2 (5'-TAAGAGGATGGGGGGGTAGTG-AAAG-3')

Oct4_Reg2_r2 (5'-GAAATCTAAAACCAAATATC-CAACCATAAA-3').

Полученные продукты ПЦР клонировали с помощью pGEM-T Easy Vector System I (Promega). С использованием универсального праймера M13 Reverse секвенировали 10 случайно отобранных плазмидных клонов каждого образца ДНК. Нуклеотидные последовательности анализировали с использованием программы QUMA (Quantification tool for Methylation Analysis, http://quma.cdb.riken.jp/, [38]).

Таблица 2. Праймеры и условия ПЦР

Гены Последовательность нуклеотидов Праймеры Концентрация ионов Mg2+, мM Температура отжига, °С

ß-актин gacggggtcacccacactgt gagtacttgcgctcaggaggag ß-actin-1 ß-actin-2 3 60

Nanog agtgtcttaaggacgcagaa atctcctaattgccaatacc Nanog QF1 Nanog QR1 3 60

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Oct4 ccaagctgctgaagcagaaga tttgaatgcatgggagagcccag OCT4-2F OCT-5R 4 53

Sox2 tccatgaccagctcgcagacctac ccctcccaattcccttgtttctct Sox2F Sox2R2 3 60

Sall4 tcaccaacgccgtcatgttacagc ggtgggctgtgctcggataaatgt Sall4F Sall4R 2 60

Esrrb agctgcggctccttcatcaag cttgtacttctggcggcctcc ESRRB1F ESRRB4R 1.5 63

Цитогенетический анализ

Клетки фиксировали по стандартной методике [39] с некоторыми модификациями: время инкубации с бромистым этидием (0.05%) - 3 ч, с колцемидом (10 мкг/мл, Gibco) - 2 ч, время гипотонии - 15-20 мин.

Перед окрашиванием препараты инкубировали в течение ночи при 50оС. Hoechst 33258 (Sigma) в концентрации 0.05 мкг/мл готовили на сбалансированном растворе Хенкса (HBSS, Gibco). Метафазные пластинки окрашивали в растворе Hoechst 33258 в течение 10 мин, после чего препараты промывали водой и заключали в ацетатный буфер рН 5.5. Метафазы визуализировали при помощи микроскопа Ni-E (Nikon), программа Lucia.

Анализ клеток методом проточной цитометрии

Число EGFP- и SSEAl-позитивных клеток оценивали на приборах BD FACS Aria и BD FACSCanto II с использованием программы BD FACS Diva. Поверхностный антиген SSEA1 выявляли с помощью антител (sc-21702, Santa Cruz Biotechnology) по методике фирмы-производителя.

РЕЗУЛЬТАТЫ

Получение доксициклин-зависимых ИПСК-подобных клеток полёвки и их характеристика

ИПСК обыкновенных полёвок получали с использованием лентивирусов, экспрессирующих кДНК четырех ключевых репрограммирующих факторов OSKM мыши под промотором, регулируемым док-сициклином. Транскрипцией с данного промотора можно управлять, добавляя в среду антибиотик, однако для этого клетки необходимо дополнительно трансдуцировать лентивирусами, экспрессирующи-ми кДНК тетрациклин-зависимого трансактиватора. Эту систему, в которой экспрессию OSKM мыши контролировали, добавляя в среду доксициклин, успешно использовали ранее для получения ИПСК мыши и человека [34]. Мышь и полёвки входят в одно семейство мышевидных грызунов (Muridae) отряда Rodentia и имеют высокое сходство генов OSKM [40]. К достоинствам данной системы, по нашему мнению, относится то, что все четыре репрограммирующих фактора доставляются в клетку в составе одной вирусной частицы.

Лентивирусными конструкциями трансдуцирова-ли клетки, выделенные из эмбрионов гибридов обыкновенных полёвок M. levis х M. arvalis, которые служат моделью для изучения феномена неслучайной инактивации Х-хромосомы [27, 28]. Использовали два типа клеток гибридов: фибробласты кожи и клетки, выделенные из головного мозга. Трансдукцию проводили по следующей схеме (рис. 1А). Эффективность

трансдукции, оцененная с помощью лентивирусов, экспрессирующих зеленый флуоресцентный белок, методами проточной цитометрии и флуоресцентной микроскопии составляла 86.5% в фибробластах (рис. 1Б) и 75% - в клетках мозга (рис. 1В).

Плюрипотентность в клетках обыкновенных полёвок индуцировали с использованием двух вариантов среды, в которых ранее успешно получили ИПСК из фибробластов степной полевки M. ochrogaster [16]. В состав первого варианта входили Advanced DMEM/F12 с добавлением 15% KSR и mLIF, второй вариант содержал те же компоненты, однако включал также коктейль ингибиторов, названный 3iR. В состав коктейля 3iR входят ингибиторы киназ MEK/ERK и GSK3b (PD0325901 и CHIR99021 соответственно), антагонист рецептора I типа TGF-ß (A83-01), используемые для получения и поддержания в недифференцированном состоянии ПСК мыши и крысы, а также ингибитор ROCK, повышающий выживаемость одиночных клеток в культуре [41-46].

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

На 4-е сутки после трансдукции клетки гибридов M. levis х M. arvalis пересаживали на митотически инактивированные эмбриональные фибробласты мыши и добавляли выбранную для получения ИПСК среду с 3iR или без 3iR. Через 24 ч после этого появлялись первые морфологические изменения клеток, усилилась интенсивность их пролиферации. Через 5-8 дней трансдуцированные клетки, выделенные из мозга, начинали сливаться в однородные первичные колонии (рис. 1Г), тогда как трансдуцированные фибробласты не давали ПСК-подобных первичных колоний (табл. 3).

Первичные колонии, полученные при репро-граммировании клеток мозга, на 10-13-е сутки от начала эксперимента пересаживали в индивидуальные лунки, дезагрегируя их стеклянным капилляром. Морфология колоний клеток была такой же, как у мЭСК - объемные плотные колонии с тесными межклеточными контактами (рис. 1Д,Е). Клетки в таких колониях имели большое ядерно-цитоплаз-матическое соотношение, что характерно для ЭСК. После пересадки первичных колоний большинство клеток дифференцировалось уже на первом пассаже, однако около 40% сохранили ЭСК-подобную морфологию. С помощью гистохимического окрашивания в отобранных колониях клеток обнаружен разный уровень эндогенной ЩФ (рис. 1Ж). Линии, в которых активность ЩФ не детектировалась, из дальнейшего анализа исключали. Таким образом, по результатам анализа активности ЩФ на ранних пассажах культивирования отобрали 11 линий клеток, полученных в присутствии ингибиторов (viBr; vole inhibitor Brain) и 10 - в их отсутствие (vBr). Следует отметить, что в основной массе клеток не экспрессировался

А Эмбрион полёвки

(Е19)

Лентивирусная трансдукция

Oct4, Sox2, Klf4, Пересадка Пересадка ХГа^1 ^а'КТеТВа^^Т^иГк'а Фибробласты c-Myc на ЭФМ колоний характеристика

и клетки мозга | 1 : 20 в среду

;летки мозга ■ 1 : 20 в среду

Е19 (5п) I для ИПСК

lili

линий ИПСК полёвок

vEFSkRA

GFP

1о-17

18-36 Vole Brain

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

à 75% EGFP

GFP

■ Д 1 E ШЯШ BUM

ü v.'í* ■ff, y > • . ftfc". — f, <V

viBr3-9dPKCi

viBr3-19dPKCi

4.6% SSEA1

Alexa 488

м1 m1 m' w'

Alexa 488

vBr viBr

bFGF

mLIF bFGF bFGF mLIF PKCi AK AK mLIF AK

bFGF

mLIF bFGF bFGF mLIF PKCi AK AK mLIF AK

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Ocf4 Nanog ß-актин

о

4

К

Рис. 1. Получение и характеристика доксициклин-зависимых ИПСК-подобных линий гибридных клеток M. levis х M. arvalis. А - схема эксперимента по получению ИПСК обыкновенных полёвок рода Microtus. Б, В - оценка эффективности трансдукции эмбриональных фибробластов кожи (линия vEFSkRA) и клеток мозга (Vole Brain) гибридной полёвки лентивирусом, экспрессирующим EGFP (зеленый сигнал), методами флуоресцентной микроскопии и проточной цитометрии. Доля GFP-позитивных клеток среди фибробластов составляет 86.5%, среди клеток мозга - 75%. Г - морфология первичной колонии на 8-й день от начала репрограммирования клеток, выделенных из мозга. Д - морфология колонии на 13-й день репрограммирования клеток, выделенных из мозга. Е - морфология колоний клеток линии viBr3, культивируемых на среде с добавлением mLIF+3iR, 3-й пассаж. Ж — гистохимическое выявление активности эндогенной ЩФ в клетках линии viBr3, 2-й пассаж. З, И — данные иммунофлуоресцентного анализа и проточной цитофлуориметрии о наличии SSEAl-позитивных клеток в линии viBr3 на 9 и 19 день культивирования в присутствии PKCi соответственно. Ядра окрашены DAPI (синий сигнал). К — ОТ-ПЦР-анализ экспрессии генов Oct4 и Nanog в линиях клеток vBr3 и viBr3 после культивирования на протяжении трех пассажей в культуральных средах с добавлением различных компонентов. АК - аскорбиновая кислота. Масштабная линейка Б—Г, З - 100 мкм, Д—Ж, И - 500 мкм

Таблица 3. Условия, проверяемые в экспериментах по получению линий ИПСК межвидовых гибридов полёвок M. levis х M. arvalis

Тип клеток (номер эксперимента) Количество клеток, тыс. Эффективность трансфекции, % Условия культивирования Количество первичных колоний клеток ЩФ+ Число линий ИПСК

Клетки мозга (I эксп.) 37.5 75 KSR, mLIF 85 -

37.5 KSR, mLIF, 3iR 200 -

Фибробласты (I эксп.) 25 86.5 KSR, mLIF -

25 KSR, mLIF, 3iR -

Фибробласты (II эксп.) 12.5 32.9 KSR, mLIF, bFGF, AК -

12.5 KSR, mLIF, bFGF, A^ 3iR -

12.5 KSR, FBS, mLIF, bFGF, AК 70 2

12.5 KSR, FBS, mLIF, bFGF, A^ 3iR 100 -

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Примечание. АК - аскорбиновая кислота.

один из основных ранних маркеров плюрипотентно-сти, характерный для ПСК мыши - поверхностный антигена SSEA1. ИПСК-подобные клетки интенсивно пролиферировали в среде, содержащей доксици-клин, без изменения морфологии около 40 пассажей (более 120 дней). Эти клетки пересаживали через 2-3 дня в разведении от 1 : 8 до 1 : 10, они хорошо переносили многократное замораживание в жидком азоте с последующим размораживанием без изменения фенотипических характеристик.

Мы неоднократно пытались культивировать линии клеток в отсутствие доксициклина, прекращая экспрессию трансгенных OSKM, однако пухлые колонии ИПСК-подобных клеток уплощались и дифференцировались уже на 2-е сутки.

Таким образом, условия культивирования, позволившие успешно получать ИПСК M. ochrogaster, не привели к индукции плюрипотентности в клетках гибридов M. levis х M. arvalis. При репрограммиро-вании в этих средах фибробласты гибридов обыкновенных полёвок не формировали даже первичных колоний, а клетки, выделенные из мозга, хотя и образовывали первичные колонии, но не обнаруживали запуска механизмов самообновления, которые позволяли бы им поддерживать ИПСК-подобную морфологию при отсутствии в них экспрессии трансгенных факторов OSKM.

В дальнейшем мы сосредоточились на подборе компонентов культуральной среды, которые бы сделали возможной индукцию и поддержание плю-рипотентности в клетках обыкновенных полевок in vitro. С этой целью варьировали в различных сочетаниях такие компоненты среды, как mLIF, PKCi, bFGF и аскорбиновую кислоту, которые применяют для получения и поддержания культур плюрипо-тентных клеток других видов млекопитающих [7, 9,

13, 47-55]. Компоненты среды тестировали на двух ИПСК-подобных доксициклин-зависимых линиях, одна из которых получена и культивировалась в среде с добавлением ингибиторов (линия viBr3), а вторая (vBr3) - без ингибиторов. Интересный эффект обнаружен при добавлении в среду вещества GÖ6983 - ингибитора протеинкиназы С (PKCi), способного запускать и поддерживать самообновление плюрипотентных клеток грызунов без активации сигнальных путей LIF/STAT3 или подавления ERK/GSK3 [48, 50]. В присутствии PKCi на 9-й день культивирования в обеих ИПСК-подобных линиях клеток отмечено появление 3-5% SSEA1-позитивных клеток (рис. 1З), доля которых к 19-му дню увеличилась до 80-90% (рис. 1И). Однако, несмотря на экспрессию SSEA1, одного из маркеров культивируемых in vitro плюрипотентных клеток мыши, крысы и М. ochrogaster [16, 56, 57], ИПСК-подобные клетки гибридов M. levis х M. arvalis по-прежнему дифференцировались в отсутствие доксициклина. Более значимый для репрограммирования клеток обыкновенных полёвок результат получен при использовании среды, содержащей одновременно три компонента: mLIF, bFGF и аскорбиновую кислоту, что впервые позволило нам культивировать ИПСК-подобные культуры гибридов M. levis х M. arvalis без видимых изменений в морфологии на протяжении шести пассажей в отсутствие доксициклина. При этом в культурах обнаружен запуск экспрессии собственных генов плюрипотентности Oct4 и Nanog (рис. 1К). При добавлении mLIF, bFGF и аскорбиновой кислоты в культуральную среду для viBr3 и vBr3 по одному или попарно подобного эффекта не наблюдалось. Однако, поскольку viBr3 и vBr3, культивируемые без доксициклина с добавлением mLIF, bFGF и аскорбиновой кислоты, все же начинали диффе-

ренцироваться после шестого пассажа, мы решили провести второй эксперимент по репрограммирова-нию клеток обыкновенных полёвок, используя с самого начала те условия, в которых нам удавалось некоторое время поддерживать ИПСК гибридов M. levis х M. arvalis без доксициклина.

Успешное получение доксициклин-независимых ИПСК полёвки

Новое репрограммирование гибридов M. levis х M. arvalis провели по ранее описанной схеме (рис. 1А), используя эмбриональные фибробласты кожи. Эффективность трансдукции составляла 32.9% (рис. 2А). Учитывая опыт, полученный в предыдущем эксперименте, после трансдукции лентивиру-сами, экспрессирующими OSKM и тетрациклин-зависимый трансактиватор, фибробласты переводили на среды для репрограммирования, содержащие mLIF, bFGF и аскорбиновую кислоту. Как и в предыдущем эксперименте, мы использовали среды с коктейлем ингибиторов 3iR и без него. Кроме того, мы варьировали содержание KSR и FBS в средах: одни среды, как и ранее, содержали 15% KSR, тогда как в состав других сред входила смесь 7% FBS и 7% KSR.

Уже на 3-й день после начала культивирования (7-й день от начала трансдукции) фибробластов на средах для репрограммирования, содержащих смесь FBS и KSR, появились первичные колонии. В средах, содержащих 15% KSR, не наблюдалось образования первичных колоний (табл. 3). На 10-14 день от начала трансдукции из культур, репрограм-мируемых в присутствии KSR и FBS, было пересажено шесть первичных колоний из чашки со средой 3iR и восемь колоний из чашки со средой без 3iR. Доксициклин отменили через 14 дней после начала репрограммирования, т.е. на первом пассаже после пересадки первичных колоний в индивидуальные лунки. В результате культивирования без доксици-клина большая часть колоний дифференцировалась либо была отсеяна в результате первичного анализа активности ЩФ. Таким образом, были отобраны два клона 14vf2 и 14vf7, экспрессирующие ЩФ и культивируемые на среде без ингибиторов. Полученные в данном эксперименте две линии клеток культивировали в среде, содержащей 7% FBS, 7% KSR, mLIF, bFGF и аскорбиновую кислоту, без изменения морфологии на протяжении по крайней мере 28 пассажей (более 4 мес.) без добавления доксицикли-на. Отмена любого из компонентов среды, а именно mLIF, bFGF или аскорбиновой кислоты, а также снижение концентрации FBS ниже 7% приводило к постепенной дифференцировке полученных линий ИПСК.

Характеристика доксициклин-независимых линий клеток полёвки

Клетки полученных линий растут уплощенными колониями с плотными межклеточными контактами и четким краем, напоминая ПСК человека (рис. 2Б). Колонии клеток растут, раздвигая клетки фидера и прикрепляясь к пластику, как ЭСК/ИПСК человека, а не поверх фидера, как мЭСК. Интенсивность пролиферации линий ИПСК обыкновенных полёвок и ПСК человека была сопоставимой. Обнаружено, что добавление ингибитора ROCK в среду для культивирования существенно увеличивает выживаемость клеток при их пересадке как механической (с помощью капилляра), так и с использованием TrypLE.

Более 70% клеток в обеих линиях ИПСК имеют ожидаемое число аутосом, равное 50; X-хромосому M. levis и Y-хромосому M. arvalis (рис. 2В).

По результатам гистохимического анализа активность ЩФ выявлена в линиях клеток в недифференцированном состоянии (рис. 2Г) и не обнаружена после дифференцировки. В стабильных линиях ИПСК гибридов M. levis х M. arvalis, в отличие от докси-циклин-зависимых линий, не детектируется транскрипция привнесенной конструкции с репрограмми-рующими факторами (рис. 2Д). Более того, в обеих линиях клеток произошло деметилирование CpG-динуклеотидов в промоторе гена Oct4 полёвки, что свидетельствует о его реактивации (рис. ЗА).

Иммунофлуоресцентным анализом показано, что полученные линии клеток в недифференцированном состоянии на ранних пассажах экспресси-ровали один из основных маркеров плюрипотент-ности - поверхностный антиген SSEA1 (рис. 2Е), что характерно для мЭСК/ИПСК. На рис. 2Е отчетливо видно, что совместная локализация окраски на ЩФ и SSEA1 наблюдается в более пухлой плотной недифференцированной части колонии, тогда как левый верхний край колонии, содержащий распластанные дифференцированные клетки, не окрашивается ни на ЩФ, ни на SSEA1. Однако через несколько пассажей нам не удалось обнаружить клетки, экс-прессирующие SSEA1. Также в ИПСК гибридов M. levis х M. arvalis выявлена экспрессия ключевых генов плюрипотентного состояния Oct4 и Sox2, которая устойчиво сохранялась в течение культивирования клеток (рис. 2Ж).

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Методом ОТ-ПЦР в обеих линиях ИПСК гибридов M. levis х M. arvalis обнаружена экспрессия собственных генов Nanog, Oct4, Sox2, Sall4, Esrrb, важных для поддержания плюрипотентного состояния клеток млекопитающих. В исходной линии эмбриональных клеток кожи транскрипты этих генов отсутствуют (рис. ЗБ). Таким образом, учитывая ПСК-подобную

vEFSkRA

Л-:' ■ s: ; ■■'■ff

__

GFP

й.

Y 3rV'

X lev.

Д

ПЦР геномная ДНК

viBr 14vf2 14vf7

OSKM OT-ПЦР

кДНК

viBr 14vf2 14vf7 + - + — + —

OSKM ß-актин

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

SSE AI DAPI

Ot SOX2 . W .-jumt £ Щ Совмещение Ш •SfV w * Ш M "

Б

B

Рис. 2. Получение и характеристика ИПСК гибридов обыкновенных полёвок M. levis х M. arvalis. А - эффективность трансдукции эмбриональных фибробластов полёвки (vEFSkRA) лентивирусом, экспрессирующим EGFP (зеленый сигнал), и оценка доли GFP-позитивных клеток (32.9%) методами флуоресцентной микроскопии и проточной цитометрии. Б - морфология колонии клеток линии 14vf7, седьмой пассаж. В — метафазная пластинка 14vf7, 13-й пассаж. X lev. - Х-хромосома M. levis, Y arv. - Y-хромосома M. arvalis. Г - гистохимическое выявление активности эндогенной ЩФ, линия клеток 14vf7, 6-й пассаж. Д — ОТ-ПЦР-анализ экспрессии конструкции с экзогенными факторами репрограммирования (OSKM) в линиях ИПСК гибридов обыкновенных полёвок. Е -иммунофлуоресцентный анализ экспрессии SSEA1 (красный сигнал) и гистохимическая детекция активности ЩФ, линия 14vf7, 4-й пассаж. Ядра окрашены DAPI (синий сигнал). Ж - иммунофлуоресцентный анализ маркеров плюрипотентности OCT4 (красный сигнал) и SOX2 (зеленый сигнал). Ядра окрашены DAPI (синий сигнал). Масштабная линейка А, Г, Е, Ж - 100 мкм, Б - 500 мкм

морфологию колоний клеток, экспрессию ЩФ, деме-тилирование промотора гена Oct4, экспрессию в них генов Nanog, Oct4, Sox2, Sall4, Esrrb, неограниченную пролиферацию в культуре без изменения морфологии в отсутствие доксициклина, можно утверждать, что нам удалось получить плюрипотентные ИПСК межвидовых гибридов M. levis х M. arvalis.

Для исследования способности линий клеток к дифференцировке in vitro из них получили эмбри-оидные тела, которые формировались в суспензионной культуре уже на 2-е сутки (рис. 4А). Анализ дифференцированных производных с помощью им-мунофлуоресцентного окрашивания антителами к маркерам специализированных клеточных типов выявил производные всех трех первичных зародышевых листков: эктодермы (нестин, ß-III-тубулин), энтодермы (SOX17, KRT18) и мезодермы (a-SMA, CD90) (рис. 4Б).

Исследуя спонтанную дифференцировку прошедших успешное репрограммирование ИПСК гибридов M. levis х M. arvalis в культуре c использованием антител, которые выявляют исключительно эндогенные OCT4 и KLF4, мы обнаружили, что экспрессия KLF4 отсутствует в плюрипотентных клетках, но появляется в начале их дифференцировки, коррелируя c утратой транскрипционного фактора OCT4 (рис. 4В).

ОБСУЖДЕНИЕ

Нами была предпринята попытка получить ИПСК гибридов от скрещивания между видами M. levis и M. arvalis, которые относятся к группе обыкновенных полёвок рода Microtus. Первые опыты по получению ИПСК обыкновенных полёвок были выполнены с использованием тех же культуральных сред и факторов, которые ранее позволили индуцировать плюрипотентность и получить ИПСК степной полёвки M. ochrogaster [16]. ИПСК степной полёвки были получены в присутствии заменителя эмбриональной сыворотки крупного рогатого скота KSR, а также ци-токина LIF, который запускает ключевой сигнальный каскад плюрипотентных клеток мыши и крысы [5759]. Получение ИПСК M. ochrogaster возможно в присутствии в составе среды ингибиторов CHIR99021, PD0325901 и A83-01. Тем не менее при репрограмми-ровании клеток обыкновенных полёвок с помощью четырех факторов OSKM с использованием сред, содержащих LIF и KSR, индукции плюрипотентности не происходило. После тщательного подбора условий ИПСК гибридов M. levis х M. arvalis были получены в среде, содержащей mLIF, bFGF, аскорбиновую кислоту, а также смесь 7% FBS и 7% KSR. Интересно, что при репрограммировании клеток M. ochrogaster в средах, содержащих bFGF и FBS, в большинстве

случаев не удавалось получать даже первичные ИПСК-подобные колонии.

Наш опыт показывает, что OSKM мыши, с помощью которых плюрипотентность индуцируют в соматических клетках различного типа и у разных видов, могут быть эффективны при получении ИПСК обыкновенных полёвок. Тем не менее присутствия в среде цитокина LIF, важнейшего фактора в становлении и поддержании недифференцированного состояния ЭСК и ИПСК у грызунов (мышь, крыса, а также степная полёвка) [16, 57-59], недостаточно для индукции и сохранения плюрипотентности in vitro в клетках обыкновенных полёвок. Этот результат согласуется с сообщениями о безуспешных попытках получить ЭСК видов группы обыкновенных полёвок из внутренней клеточной массы бластоцист в присутствии LIF мыши и полёвки M. levis [31]. В совокупности эти данные позволяют предполагать, что сигнальный путь, запускаемый цитокином LIF, в силу каких-то видоспецифических особенностей обыкновенных полёвок не может самостоятельно обеспечивать плюрипотентность в условиях in vitro.

Ключевой для индукции и поддержания плю-рипотентности клеток обыкновенных полёвок стала комбинация факторов bFGF и mLIF. Известно, что bFGF участвует в запуске основного сигнального каскада ПСК у таких видов, как человек, макака, собака, корова, лошадь, овца [7, 9, 13, 15, 17, 51-55, 60-62]. Комбинация bFGF и LIF также применяется для индукции и поддержания плюрипотентности у многих видов млекопитающих, включая человека [63], кролика [13], собаку [62], лошадь [7, 17], овцу [9]. Сравнение ПСК человека, полученных и культивируемых в средах, содержащих только bFGF, а также bFGF и LIF, показало, что именно у ИПСК и ЭСК, поддерживаемых с использованием двух факторов, характеристики транскриптома и эпигенома очень близки к характеристикам плюрипотентных клеток ранних эмбрионов [63].

Важный компонент среды, позволивший осуществить репрограммирование дифференцированных клеток обыкновенных полёвок к плюрипотентному состоянию, - аскорбиновая кислота. Ранее было показано, что аскорбиновая кислота обладает анти-оксидантными свойствами, а также активирует деметилазы гистонов и белки TET, ответственные за важнейшие эпигенетические преобразования при индукции плюрипотентности, что, в частности, необходимо для инициации в репрограммируемых клетках экспрессии собственных генов Oct4 и Nanog [47, 49].

На многих видах млекопитающих показано, что при работе с плюрипотентными клетками предпочтительнее использовать среду с добавлением

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

л

Ген Ocf4

CR4 2A (DE) Oct4-Sox2

ч—(—

TT

•ff*

CR2 1В CR3 1A (PE) (PE)

ir au1!1 vA j" i

" " --1 т.п.н.

CR1 Sp1/Sp3 HRE

2 т.п.н. -1.5 т.п.н.

Ген Oct4 полёвки

V Ш'1'A ШАШ' 'I' lût Al1 11 il

4

49.3 %

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

B -E B -E A R

f2 f7 f2- f7- k S F

vf vf vf vf

4 4 4 4 E

1 1 1 1 v

ЮОООО#ФОООО(

oo»»oo##oooo#o

ооффооооооф9%ф

юооо#®ооо##о ютоофоооффоо ооттоооьтоотт* ••••оо##оооо#о oommmmoommmmoo moomoommmomoi

ЮИ1ФОИ о<

Nanog

Oct4

Sox2

Sall4

Esrrb

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

ß-актин

OT-

10 %

r^i m г4» м сч — — —• — <*> f4- ci ft

vEFSkRA

oooooooooooooo oooooooooooooo oooooooooooooo oooooooooooooo oooooooooooooo oooooooooooooo 14vf2

ООООООООООХООО

oooooooooooooo •o#oooo««oo#oo tooto^tiotuoo

oooooooooooooo oooooooooooooo oooooooooooooo

ООООООООООООФО

•ooooooooooooo

13.6 % öQ'O^OÖOOOO^GÖO 14vf7

oooooooo«o#o#o ooommooomooooo

OOfOOtOMOOOOO

o#o«ooo#«oo»oo

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Рис. 3. Анализ метилирования CpG-динуклеотидов в промоторе гена Oct4 и экспрессии генов, характерных для плюрипотентных клеток, в ИПСК обыкновенных полёвок. Л — сравнение метилирования CpG-динуклеотидов промотора гена Oct4 в полученных линиях ИПСК (14vf2, 14vf7) и исходной линии (vEFSkRA) эмбриональных фибробластов кожи. Вверху приведена схема распределения CpG-динуклеотидов в промоторе гена Oct4 мыши и обыкновенных полёвок. Светлые и темные кружки - неметилированные и метилированные CpG-динуклеотиды соответственно. Б - транскрипционная активность генов, ответственных за плюрипотентное состояние, в линиях ИПСК 14vf2 и 14vf7 и их дифференцированных производных (14vf2-EB и 14vf7-EB). Контроль - исходная линия vEFSkRA. (ОТ-) - негативный контроль реакции обратной транскрипции

мыши

Б

эктодерма

мезодерма

энтодерма

«-8МА ■ — КНТ18 1 в - г' ЖЮЁ'

'■СР90 X щ' V V ■ - 1 • • * , * ■ *

ятт

* т\ * "л*1

Рис. 4. Спонтанная дифференцировка ИПСК обыкновенных полёвок. А - морфология эмбриоидных телец, сформировавшихся в суспензионной культуре за 5 сут из клеток линии 14vf2. Б - иммунофлуоресцентный анализ дифференцированных производных ИПСК обыкновенных полёвок. Выявление маркеров эктодермы: Р-Ш-тубулин (красный сигнал), нестин (зеленый сигнал); мезодермы: а^МА (красный сигнал), CD90 (зеленый сигнал); энтодермы: К^Т18 (красный сигнал), SOX17 (зеленый сигнал). В — иммунофлуоресцентное выявление факторов транскрипции ОСТ4 (красный сигнал) и KLF4 (зеленый сигнал). Ядра окрашены DAPI (синий сигнал). Масштабная линейка А - 500 мкм, Б, В - 100 мкм

KSR, а не FBS [10, 13, 15, 16, 60]. Однако при репро-граммировании фибробластов обыкновенных полёвок к плюрипотентному состоянию получить первичные колонии клеток удалось только на средах, содержащих не менее 7% FBS. Кроме того, замещение в куль-туральной среде FBS на KSR вызывает дифферен-цировку полученных ИПСК обыкновенных полёвок даже в присутствии факторов роста.

Присутствие в культуральной среде mLIF, bFGF, аскорбиновой кислоты, а также FBS необходимо для поддержания самообновления и плюрипотентно-сти ИПСК обыкновенных полёвок. Удаление любого из этих компонентов приводит к запуску дифферен-цировки.

Полученные стабильные линии ИПСК обыкновенных полёвок имеют характерные свойства плюри-потентных клеток. Они обнаруживают активность ЩФ и экспрессируют эндогенные транскрипционные факторы Nanog, Oct4, Sox2, Esrrb и Sall4, которые необходимы для поддержания ПСК в недифференцированном состоянии [64-68]. При этом промоторная область гена Oct4 в ИПСК гипометили-рована сильнее, чем в эмбриональных фибробластах. Полученные линии плюрипотентных клеток обыкновенных полёвок способны неограниченное время самообновляться и дифференцироваться in vitro в производные трех первичных зародышевых листков. Тем не менее, в отличие от ИПСК M. ochrogaster, стабильные линии клеток обыкновенных полёвок с индуцированной плюрипотентностью не поддерживают в процессе культивирования экспрессию SSEA1, а также не экспрессируют KLF4. Вероятно, это может быть связано с тем, что в поддержании плюрипотентности в ИПСК M. ochrogaster и обыкновенных полёвок участвуют разные сигнальные каскады. Экспрессия SSEA1 и KLF4 характерна для ПСК, в которых ключевой сигнальный каскад, обеспечивающий плюрипотентность, запускается цитокином LIF, и варьирует либо отсутствует в ПСК, плюрипотентность которых поддерживается с помощью сигнального каскада, активируемого bFGF [61, 69-71]. Так, линии плюрипотентных клеток, получаемые из постимплантационных эмбрионов мыши, в присутствии bFGF не экспрессируют KLF4, в отличие от ЭСК и ИПСК, культивируемых с LIF [71, 72]. ПСК овцы, макаки и человека, получаемые в присутствии bFGF, не обнаруживают поверхностного антигена SSEA1 [8, 15, 61, 69]. Отмечают, что плюри-потентные клетки, поддерживаемые за счет bFGF, имеют более плоскую морфологию и медленнее делятся [8, 72]. Эти два свойства bFGF-зависимых плю-рипотентных клеток характерны для линий ИПСК обыкновенных полёвок. Судить же о том, насколько полно полученные ИПСК M. ochrogaster и обыкно-

венных полёвок отражают свойства плюрипотентных клеток своих видов, пока невозможно: как у степной, так и у обыкновенной полёвки отсутствуют линии ЭСК, служащие эталоном плюрипотентности. Ничего не известно также о свойствах плюрипотентных клеток пре- и постимплантационных эмбрионов данных видов in vivo.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

Итак, технология репрограммирования с помощью повышенной экспрессии четырех транскрипционных факторов OSKM впервые позволила получить ИПСК обыкновенных полёвок, линии плюрипотентных клеток которых до настоящего времени не удавалось ввести в культуру. Полученные линии планируется использовать для изучения процессов раннего развития и генов плюрипотентности у обыкновенных полёвок. Мы надеемся, что опыт, полученный в ходе данной работы, позволит в дальнейшем разработать более эффективные подходы к репрограммированию соматических клеток обыкновенных полёвок и выделить ЭСК из ранних предымплантационных бласто-цист и герминальных клеток данных грызунов.

ЗАКЛЮЧЕНИЕ

В данном исследовании получены ИПСК гибридов обыкновенных полёвок M. levis х M. arvalis в среде, содержащей цитокин LIF, bFGF, аскорбиновую кислоту и FBS. Полученные в этих условиях ИПСК обыкновенных полёвок способны к самообновлению, экспрессируют гены плюрипотентности Oct4, Nanog, Sox2, Sall4, Esrrb, при дифференцировке in vitro образуют производные трех первичных зародышевых листков. Результаты нашей работы позволят оценить разнообразие и видоспецифические особенности способов индукции и поддержания плюрипотентных клеток у разных видов млекопитающих. •

Авторы признательны И.С. Захаровой за помощь в проведении экспериментов и обработке данных проточной цитофлуориметрии, Е.А. Елисафенко за помощь в подборе праймеров для ОТ-ПЦР, а также Е.А. Васьковой, А.В. Вялковой и Д.Р. Байзигитову за участие в некоторых этапах культуральных работ. Также авторы благодарны Рудольфу Джанишу (Rudolf Jaenisch), Конраду Хочедлингеру (Konrad Hochedlinger) и Дидье Троно (Didier Trono) за плазмиды, размещенные в депозитарии Addgene. Работа на приборе BD FACS Aria выполнена в ЦКП «Проточной цитометрии» ИЦиГ СО РАН.

Работа поддержана грантом РФФИ № 15-0403947 и бюджетным проектом Института цитологии и генетики СО РАН VI.60.1.2.

СПИСОК ЛИТЕРАТУРЫ

1. Evans M.J., Kaufman M.H. // Nature. 1981. V. 292. № 5819. P. 154-156.

2. Martin G.R. // Proc. Natl. Acad. Sci. USA. 1981. V. 78. № 12. P. 7634-7638.

3. Takahashi K., Yamanaka S. // Cell. 2006. V. 126. № 4. P. 663-676.

4. Dutta D. // Int. J. Dev. Biol. 2013. V. 57. № 9-10. P. 667-675.

5. Medvedev S.P., Shevchenko A.I., Elisaphenko E.A., Nesterova T.B., Brockdorff N., Zakian S.M. // BMC Genomics. 2008. V. 9. № 162. doi: 10.1186/1471-2164-9-162.

6. Медведев С.П., Елисафенко А.И., Мазурок Н.А., Закиян С.М // ДАН. 2009. Т. 425. С. 102-105.

7. Breton A., Sharma R., Diaz A.C., Parham A.G., Graham A., Neil C., Whitelaw C.B., Milne E., Donadeu F.X. // Stem Cells Dev. 2013. V. 22. № 4. P. 611-621.

8. Li Y., Cang M., Lee A.S., Zhang K., Liu D. // PLoS One. 2011. V. 6. № 1. e15947.

9. Liu J., Balehosur D., Murray B., Kelly J.M., Sumer H., Verma P.J. // Theriogenology. 2012. V. 77. № 2. P. 338-346.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

10. Wu Z., Chen J., Ren J., Bao L., Liao J., Cui C., Rao L., Li H., Gu Y., Dai H., et al. // J. Mol. Cell Biol. 2009. V. 1. № 1. P. 46-54.

11. Bao L., He L., Chen J., Wu Z., Liao J., Rao L., Ren J., Li H., Zhu H., Qian L., et al. // Cell Res. 2011. V. 21. № 4. P. 600-608.

12. Ezashi T., Telugu B.P., Alexenko A.P., Sachdev S., Sinha S., Roberts R.M. // Proc. Natl. Acad. Sci. USA. 2009. V. 106. № 27. P. 10993-10998.

13. Honda A., Hirose M., Hatori M., Matoba S., Miyoshi H., Inoue K., Ogura A. // J. Biol. Chem. 2010. V. 285. № 41. P. 31362-31369.

14. Liao J., Cui C., Chen S., Ren J., Chen J., Gao Y., Li H., Jia N., Cheng L., Xiao H., et al. // Cell Stem Cell. 2009. V. 4. № 1. P. 11-15.

15. Liu H., Zhu F., Yong J., Zhang P., Hou P., Li H., Jiang W., Cai J., Liu M., Cui K., et al. // Cell Stem Cell. 2008. V. 3. № 6. P. 587-590.

16. Manoli D.S., Subramanyam D., Carey C., Sudin E., van Westerhuyzen J.A., Bales K.L., Blelloch R., Shah N.M. // PLoS One. 2012. V. 7. № 5. e38119.

17. Nagy K., Sung H.K., Zhang P., Laflamme S., Vincent P., Agha-Mohammadi S., Woltjen K., Monetti C., Michael I.P., Smith L.C., et al. // Stem Cell Rev. 2011. V. 7. № 3. P. 693-702.

18. Shimada H., Nakada A., Hashimoto Y., Shigeno K., Shionoya Y., Nakamura T. // Mol. Reprod. Dev. 2010. V. 77. № 1. P. 2.

19. Takahashi K., Tanabe K., Ohnuki M., Narita M., Ichisaka T., Tomoda K., Yamanaka S. // Cell. 2007. V. 131. № 5. P. 861-872.

20. Mazurok N.A., Rubtsova N.V., Isaenko A.A., Pavlova M.E., Slobodyanyuk S.Y., Nesterova T.B., Zakian S.M. // Chromosome Res. 2001. V. 9. № 2. P. 107-120.

21. Dementyeva E.V., Shevchenko A.I., Anopriyenko O.V., Mazurok N.A., Elisaphenko E.A., Nesterova T.B., Brockdorff N., Zakian S.M. // Chromosoma. 2010. V. 119. № 5. P. 541-552.

22. Rubtsov N.B., Rubtsova N.V., Anopriyenko O.V., Karamysheva T.V., Shevchenko A.I., Mazurok N.A., Nesterova T.B., Zakian S.M. // Cytogenet. Genome Res. 2002. V. 99.

P. 323-329.

23. Shevchenko A.I., Malakhova A.A., Elisaphenko E.A., Mazurok N.A., Nesterova T.B., Brockdorff N., Zakian S.M. // PLoS One. 2011. V. 6. № 8. e22771.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

24. Shevchenko A.T., Mazurok N.A., Slobodyanyuk S.Y., Zakian S.M. // Chromosome Res. 2002. V. 10. № 2. P. 117-126.

25. Vaskova E.A., Dementyeva E.V., Shevchenko A.I., Pavlova S.V., Grigor'eva E.V., Zhelezova A.I., Vandeberg J.L., Zakian S.M. // PLoS One. 2014. V. 9. № 2. e88256.

26. Шерстюк В.В. Шевченко А.И., Мазурок Н.А., Закиян С.М.

// ДАН. 2013. Т. 450. № 5. C. 606-608.

27. Nesterova T.B., Slobodyanyuk S.Y., Elisaphenko E.A., Shevchenko A.I., Johnston C., Pavlova M.E., Rogozin I.B., Kolesnikov N.N., Brockdorff N., Zakian S.M. // Genome Res. 2001. V. 11. № 5. P. 833-849.

28. Zakian S.M., Kulbakina N.A., Meyer M.N., Semenova L.A., Bochkarev M.N., Radjabli S.I., Serov O.L. // Genet. Res. 1987. V. 50. № 1. P. 23-27.

29. Сорокин М.А., Медведев С.П., Шевченко А.И., Слынько Н.М., Закиян С.М. // Генетика. 2010. Т. 46. № 2. С. 282-286.

30. Мазурок Н.А., Рубцова Н.В., Григорьева Е.В., Матвеева Н.М., Железова А.И., Шилов А.Г., Слободянюк С.Я., Закиян С.М. // Онтогенез. 2003. Т. 34. С. 193-203.

31. Grigor'eva E.V., Shevchenko A.I., Mazurok N.A., Elisaphenko E.A., Zhelezova A.I., Shilov A.G., Dyban P.A., Dyban A.P., Noniashvili E.M., Slobodyanyuk S.Y., et al. // PLoS One. 2009. V. 4. № 9. e7161.

32. Шевченко A.K, Демина В.В., Мазурок Н.А., Железова А.И., Ефремов Я.Р., Шилов А.Г., Шевела А.И., Белеванцева А.В., Власов В.В., Закиян С.М. // Генетика. 2008. T. 44. № 11.

C. 1477-1485.

33. Григорьева Е.В., Шевченко А.И., Железова А.И., Шилов

A.Г., Мазурок Н.А., Дыбан П.А., Дыбан А.П., Закиян С.М. // Клеточные технологии в биологии и медицине. 2010. № 4. С. 183-194.

34. Carey B.W., Markoulaki S., Hanna J., Saha K., Gao Q., Mitalipova M., Jaenisch R. // Proc. Natl. Acad. Sci. USA. 2009. V. 106. № 1. P. 157-162.

35. Maherali N., Ahfeldt T., Rigamonti A., Utikal J., Cowan C., Hochedlinger K. // Cell Stem Cell. 2008. V. 3. № 3. P. 340-345.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

36. Kingston R.E., Chen C.A., Okayama H. // Curr. Protoc. Cell Biol. 2003. Chapter 9. Unit 9.1.

37. Pain B., Clark M.E., Shen M., Nakazawa H., Sakurai M., Samarut J., Etches R.J. // Development. 1996. V. 122. № 8. P. 2339-2348.

38. Kumaki Y., Oda M., Okano M. // Nucl. Acids Res. 2008. V. 36. Web Server issue. W170-W175.

39. Nesterova T.B., Duthie S.M., Mazurok N.A., Isaenko A.A., Rubtsova N.V., Zakian S.M., Brockdorff N. // Chromosome Res. 1998. V. 6. № 1. P. 41-48.

40. Сорокин М.А., Елисафенко Е.А., Мазурок Н.А., Закиян С.М. // ДАН. 2013. Т. 452. № 1. С. 100-105.

41. Bechard M., Dalton S. // Mol. Cell. Biol. 2009. V. 29. № 8. P. 2092-2104.

42. Buehr M., Meek S., Blair K., Yang J., Ure J., Silva J., McLay R., Hall J., Ying Q.L., Smith A. // Cell. 2008. V. 135. № 7.

P. 1287-1298.

43. Chang M.Y., Kim D., Kim C.H., Kang H.C., Yang E., Moon J.I., Ko S., Park J., Park K.S., Lee K.A., et al. // PLoS One. 2010.

V. 5. № 3. e9838.

44. Chen Y., Blair K., Smith A. // Stem Cell Reports. 2013. V. 1. № 3. P. 209-217.

45. Li P., Tong C., Mehrian-Shai R., Jia L., Wu N., Yan Y., Maxson R.E., Schulze E.N., Song H., Hsieh C.L., et al. // Cell. 2008. V. 135. № 7. P. 1299-1310.

46. Ying Q.L., Wray J., Nichols J., Batlle-Morera L., Doble

B., Woodgett J., Cohen P., Smith A. // Nature. 2008. V. 453. № 7194. P. 519-523.

47. Blaschke K., Ebata K.T., Karimi M.M., Zepeda-Martinez J.A., Goyal P., Mahapatra S., Tam A., Laird D.J., Hirst M., Rao A., et al. // Nature. 2013. V. 500. № 7461. P. 222-226.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

48. Dutta D., Ray S., Home P., Larson M., Wolfe M.W., Paul S. // Stem Cells. 2011. V. 29. № 4. P. 618-628.

49. Esteban M.A., Wang T., Qin B., Yang J., Qin D., Cai J., Li W.,

Weng Z., Chen J., Ni S., et al. // Cell Stem Cell. 2010. V. 6. № 1. P. 71-79.

50. Rajendran G., Dutta D., Hong J., Paul A., Saha B., Mahato B., Ray S., Home P., Ganguly A., Weiss M.L., et al. // J. Biol. Chem. 2013. V. 288. № 34. P. 24351-24362.

51. Medvedev S.P., Grigor'eva E.V., Shevchenko A.I., Malakhova A.A., Dementyeva E.V., Shilov A.A., Pokushalov E.A., Zaidman A.M., Aleksandrova M.A., Plotnikov E.Y., et al. // Stem Cells Dev. 2011. V. 20. № 6. P. 1099-1112.

52. Медведев С.П., Малахова А.А., Григорьева Е.В., Шевченко А.И., Дементьева Е.В., Соболев И.А., Лебедев И.Н., Шилов А.Г., Жимулев И.Ф., Закиян С.М. // Acta Naturae. 2010. Т. 2. № 2. С. 108-110.

53. Медведев С.П., Шевченко А.И., Закиян С.М. // Acta Naturae. 2010. Т. 2. № 3. С. 38-57.

54. Медведев С.П., Шевченко А.И., Закиян С.М. // Acta Naturae. 2010. Т. 2. № 2. С. 18-28.

55. Shutova M.V., Bogomazova A.N., Lagarkova M.A., Kiselev S.L. // Acta Naturae. 2009. V. 1. № 2. P. 91-92.

56. Ginis I., Luo Y., Miura T., Thies S., Brandenberger R., Gerecht-Nir S., Amit M., Hoke A., Carpenter M.K., Itskovitz-Eldor J., et al. // Dev. Biol. 2004. V. 269. № 2. P. 360-380.

57. Vassilieva S., Guan K., Pich U., Wobus A.M. // Exp. Cell Res. 2000. V. 258. № 2. P. 361-373.

58. Smith A.G.., Heath J.K., Donaldson D.D., Wong G.G., Moreau J., Stahl M., Rogers D. // Nature. 1988. V. 336. № 6200. P. 688-690.

59. Williams R.L., Hilton D.J., Pease S., Willson T.A., Stewart C.L., Gearing D.P., Wagner E.F., Metcalf D., Nicola N.A., Gough N.M. // Nature. 1988. V. 336. № 6200. P. 684-687.

60. Han X., Han J., Ding F., Cao S., Lim S.S., Dai Y., Zhang R., Zhang Y., Lim B., Li N. // Cell Res. 2011. V. 21. № 10. P. 15091512.

61. Thomson J.A., Itskovitz-Eldor J., Shapiro S.S., Waknitz M.A., Swiergiel J.J., Marshall V.S., Jones J.M. // Science. 1998. V. 282. № 5391. P. 1145-1147.

Не можете найти то, что вам нужно? Попробуйте наш сервис подбора литературы.

62. Vaags A.K., Rosic-Kablar S., Gartley C.J., Zheng Y.Z., Chesney A., Villagomez D.A., Kruth S.A., Hough M.R. // Stem Cells. 2009. V. 27. № 2. P. 329-340.

63. Gafni O., Weinberger L., Mansour A.A., Manor Y.S., Chomsky E., Ben-Yosef D., Kalma Y., Viukov S., Maza I., Zviran A., et al. // Nature. 2013. V. 504. № 7479. P. 282-286.

64. Chambers I., Colby D., Robertson M., Nichols J., Lee S., Tweedie S., Smith A. // Cell. 2003. V. 113. № 5. P. 643-655.

65. Chambers I., Silva J., Colby D., Nichols J., Nijmeijer B., Robertson M., Vrana J., Jones K., Grotewold L., Smith A. // Nature. 2007. V. 450. № 7173. P. 1230-1234.

66. Masui S., Nakatake Y., Toyooka Y., Shimosato D., Yagi R., Takahashi K., Okochi H., Okuda A., Matoba R., Sharov A.A., et al. // Nat. Cell. Biol. 2007. V. 9. № 6. P. 625-635.

67. Mitsui K., Tokuzawa Y., Itoh H., Segawa K., Murakami M., Takahashi K., Maruyama M., Maeda M., Yamanaka S. // Cell. 2003. V. 113. № 5. P. 631-642.

68. Niwa H., Miyazaki J., Smith A.G. // Nat. Genet. 2000. V. 24. № 4. P. 372-376.

69. Adewumi O., Aflatoonian B., Ahrlund-Richter L., Amit M., Andrews P.W., Beighton G., Bello P.A., Benvenisty N., Berry L.S., Bevan S., et al. // Nat. Biotechnol. 2007. V. 25. № 7. P. 803-816.

70. Osorno R., Chambers I. // Philos. Trans. R. Soc. Lond. B Biol. Sci. 2011. V. 366. № 1575. P. 2230-2237.

71. Posfai E., Tam O.H., Rossant J. // Curr. Top. Dev. Biol. 2014. V. 107. P. 1-37.

72. Tesar P. J., Chenoweth J.G., Brook F.A., Davies T.J., Evans E.P., Mack D.L., Gardner R.L., McKay R.D. // Nature. 2007. V. 448. № 7150. P. 196-199.