Научная статья на тему 'Характеристика смешанных биопленок бактерий семейства Enterobacteriaceae Yersinia pseudotuberculosis и S. Enteritidis in vitro'

Характеристика смешанных биопленок бактерий семейства Enterobacteriaceae Yersinia pseudotuberculosis и S. Enteritidis in vitro Текст научной статьи по специальности «Биологические науки»

CC BY
392
53
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
YERSINIA / SALMONELLA / БИОПЛЕНКА / СМЕШАННЫЕ КУЛЬТУРЫ / BIOFILM / MIXED CULTURES

Аннотация научной статьи по биологическим наукам, автор научной работы — Тимченко Нэлли Федоровна, Раков Алексей Владимирович, Терентьева Наталья Александровна, Псарева Екатерина Константиновна, Яковлев Анатолий Алексеевич

В сравнительном аспекте с помощью полимеразной цепной реакции (ПЦР), бактериологического и спектрометрического анализов в динамике 3 и 6 суток при температуре 20-22˚С и 37˚C проведены исследования биопленкообразования моно и смешанными культурами Y.pseudotuberculosis и S. Enteritidis. Выявлена способность микроорганизмов сохранять жизнеспособность в этих условиях, а также формировать биопленки на абиотической поверхности. Обнаружено, что в ПЦР Y. pseudotuberculosis и S. Enteritidis давали специфическую реакцию. Результаты свидетельствуют о наличии в среде в исследуемый период времени ДНК монои смешанных культур Y. pseudotuberculosis и S. Enteritidis.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по биологическим наукам , автор научной работы — Тимченко Нэлли Федоровна, Раков Алексей Владимирович, Терентьева Наталья Александровна, Псарева Екатерина Константиновна, Яковлев Анатолий Алексеевич

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Characteristic of the mixed bacteria of the Enterobacteriaceae family Yersinia pseudotuberculosis and S. Enteritidis in vitro

In a comparative aspect, biofilm formation of monoand mixed cultures of Y.pseudotuberculosis and S. Enteritidis was carried out using the polymerase chain reaction (PCR), bacteriological and spectrometric analyzes for 3 and 6 days at temperatures of 20-22C and 37˚C. The ability of microorganisms to maintain viability under these conditions, as well as to form biofilms on the abiotic surface, was revealed. It was found that PCR of Y. pseudotuberculosis and S. Enteritidis gave a specific reaction. The results indicate the presence of monoand mixed cultures of Y. pseudotuberculosis and S. Enteritidis in the medium during the studied period of time.

Текст научной работы на тему «Характеристика смешанных биопленок бактерий семейства Enterobacteriaceae Yersinia pseudotuberculosis и S. Enteritidis in vitro»

© Коллектив авторов, 2019 г DOI: 10.5281/zenodo.2592503

Удк 636:619: [579.62+591.8

Н.Ф. Тимченко1, А.В. Раков1, Н.А. Терентьева2, Е.К. Псарева1, А.А. Яковлев1

характеристика смешанных биопленок бактерий семейства

ENTEROBACTERIACEAE YERSINIA PSEUDOTUBERCULOSIS и SALMONELLA enteritidis IN VITRO

1 НИИ эпидемиологии и микробиологии им.Г.П. Сомова, Владивосток

2 Тихоокеанский институт биоорганической химии ДВО РАН, Владивосток

В сравнительном аспекте с помощью полимеразной цепной реакции (ПЦР), бактериологического и спектрометрического анализов в динамике 3 и 6 суток при температуре 20-22°С и 37C проведены исследования биопленкообразования моно- и смешанными культурами Y pseudotuberculosis и S. Enteritidis. Выявлена способность микроорганизмов сохранять жизнеспособность в этих условиях, а также формировать биопленки на абиотической поверхности. Обнаружено, что в ПЦР Ypseudotuberculosis и S. Enteritidis давали специфическую реакцию. Результаты свидетельствуют о наличии в среде в исследуемый период времени ДНК моно- и смешанных культур Y. pseudotuberculosis и S. Enteritidis.

Ключевые слова: Yersinia, Salmonella, биопленка, смешанные культуры.

Для цитирования: Тимченко Н.Ф., Раков А.В., Терентьева Н.А., Псарева Е.К., Яковлев А.А. Характеристика смешанных биопленок бактерий семейства Enterobacteriaceae Yersinia pseudotuberculosis и S. Enteritidis in vitro// Здоровье. Медицинская экология. Наука. 2019; 1: 19-22. DOI: 10.5281/zenodo.2592503.

Для корреспонденции: Тимченко Нэлли Федоровна, e-mail: ntimch@mail.ru

Поступила 10.12.18

N.F. Timchenkoi, A.V. Rakov, N.A. Terentyeva2, E.K. Psareval A.A. Yakovlev characteristics of mixed biofilms of bacteria

of the enterobacteriaceae yersinia pseudotuberculosis families and salmonella enteritidis in vitro

1 GPSomov Research Institute of Epidemiology and Microbiology, Vladivostok, Russia

2 Pacific Institute of Bioorganic Chemistry, Far East Branch, Russian Academy of Sciences, Vladivostok, Russia

In a comparative aspect, biofilm formation of mono- and mixed cultures of Y pseudotuberculosis and S. Enteritidis was carried out using the polymerase chain reaction (PCR), bacteriological and spectrometric analyzes for 3 and 6 days at temperatures of20-22°C and 37°C. The ability of microorganisms to maintain viability under these conditions, as well as to form biofilms on the abiotic surface, was revealed. It was found that PCR of Y. pseudotuberculosis and S. Enteritidis gave a specific reaction. The results indicate the presence of mono- and mixed cultures of Y pseudotuberculosis and S. Enteritidis in the medium during the studied period of time.

Key words: Yersinia, Salmonella, biofilm, mixed cultures.

For citation: Timchenko N.F., Rakov A.V, Terentyeva N.A., Psareva E.K., Yakovlev A.A. Characteristic of the mixed bacteria of the Enterobacteriaceae family Yersinia pseudotuberculosis and S. Enteritidis in vitro// Health. Medical ecology. Science. 2019; 1: 19-22 (in Russia). DOI: 10.5281/zenodo.2592503.

For correspondence: Timchenko Nelly F., е-mail: ntimch@mail.ru Conflict of interests. The authors are declaring absence of conflict of interests. Financing. The study had no sponsor support.

Received 10.12.18 Accepted 25.01.19

Введение

К настоящему времени получены данные, свидетельствующие о способности микроорганизмов, в том числе возбудителей сапронозов и зоонозов, обитать в разных условиях окружающей среды, формируя при этом биопленки [11-13, 15, 17, 18]. Концепция о роли биопленок бактерий и их важности в медицине была сформулирована еще в начале 1970-х годов на осно-

вании обнаружения скоплений клеток Pseudomonas aeruginosa в мокроте и легочной ткани у пациентов с хроническим кистозным фиброзом (Левенгук и Пастер). Термин биопленка был введен в медицину в 1985 году J.W. Costerton [цит. по 15, 16].

В результате многочисленных исследований определено, что биопленка представляет собой сообщество одного или нескольких видов бактерий,

HEALTH. MEDICAL ECOLOGY. SCiENCE 1 (77) - 2019 19

• Микробиология

прикрепленных к поверхности или друг к другу и заключенных в матрикс, состоящий из экзополисаха-ридов, белков, внеклеточной ДНК и других веществ. Биопленка защищает бактерии от неблагоприятных абиотических и биотических факторов среды обитания. Бактерии в биопленке могут «общаться» между собой посредством секреторных интермедиаторов, которые служат основой их «социального» поведения или "Quorum Sensing" [1, 3, 4].

Известно, что микроорганизмы семейства Enterobacteriaceae рода Yersinia, широко распространены в окружающей среде, они выделены из овощей, почвы, воды, разных видов животных и человека [8-10, 14, 16, 19, 21]. Установлено, что бактерии этого рода формируют биопленки на абиотической поверхности [2, 5-7]. В частности, патогенный вид Y pseudotuberculosis, возбудитель сапронозов, способен образовывать биопленку, которая защищает его от неблагоприятных экологических условий [1, 3, 5]. Выявлено, что эти микроорганизмы в разных средах обитания (эндо- и эктотермные организмы, растения, почва, водная среда, в том числе морская) продуцируют и используют факторы пато-генности с адгезивной, инвазивной, антифагоцитарной и токсической функциями [15, 20].

Другой представитель семейства Enterobacteriaceae рода Salmonella - возбудитель зоонозов S. Enteritidis, также формирует биопленки на разных поверхностях и при разных условиях [2, 9, 10].

Имеются данные о том, что в естественных условиях биопленки образуются чаще всего несколькими видами бактерий, а не одним [21]. Ввиду этого имеет большую фундаментальную и практическую значимость изучение, прежде всего именно таких биопленок, чем экспериментальные исследования структур, образованных одним видом микроорганизмов. В текущий период времени особый интерес представляют следующие проблемы: 1) видовой состав биопленки; 2) изучение бактериальных клеток разных видов бактерий, присутствующих в биопленке, в том числе роль клеток персисторов (а также дормантов, некультивируемых форм, которые могут составлять до 1% клеток в биопленке); 3) темпы роста клеток различных видов микробов в биопленке; 4) тип взаимоотношений между клетками разных видов бактерий (конкуренция, кооперация и т.д.), доминирование одних видов бактерий над другими в биопленке, а также факторы, чем это может быть обусловлено.

В настоящей статье представлены данные, полученные нами при исследовании формирования смешанных биопленок возбудителями сапронозов (Y. pseudo-tuberculosis) и зоонозов (S. Enteritidis).

Материалы и методы

В работе использованы штаммы из коллекции ФГБНУ НИИЭМ имени Г.П. Сомова: Y pseudotuberculosis 696 серотип 1b (изолирован из свежей капусты

в Приморском крае РФ), 2517 серотип 03 (Mollaret, Франция), и S. Enteritidis S-118 (изолирован от больного в Приморском крае). Бактерии сохраняли при температуре -20°С. Для исследования предварительно Y. pseudotuberculosis высевали на среду 67 [11], а S. Enteritidis - на среду Эндо. Через 1-2 сут роста изолированные колонии пересевали на свежий скошенный питательный агар (рН 7,2-7,3). Образцы культивировали при температуре 20-22 С.

Выявление моно- и смешанных биопленок микроорганизмов проводили, используя спектрофотоме-трический метод [16]. Исходная концентрация бактерий была 0,05 OE/мл при 600 нм. Бактерии вносили по 200 мкл в лунки 96-луночного планшета, затем инкубировали систему при температуре 20-22 C в течение 3-6 сут. После инкубации из лунок удаляли не-прикрепившиеся клетки, трижды промывали лунки 0,85% NaCl и окрашивали биопленки 0,5% кристаллическим фиолетовым (CV) в течение 20 мин при комнатной температуре. Краситель удаляли из лунок, и несвязавшийся CV отмывали водопроводной водой. Планшеты высушивали на воздухе, в каждую лунку добавляли по 200 мкл 2% уксусной кислоты в 95% этаноле и определяли оптическую плотность при 600 нм. Все эксперименты проводили в 4-кратной повтор-ности. При статистической обработке использовали программу MS Excel 2010.

Проводили пробоподготовку для ПЦР и выделение ДНК. При этом исходную дозу бактерий перед исследованиями определяли по стандарту мутности. Для контроля результатов использовали раздельно культуры Y pseudotuberculosis и S. Enteritidis в LB бульоне (рН 7,2-7,3), посеянные с изолированных колоний на питательном агаре. В опыты взята смесь культур Y pseudotuberculosis и S. Enteritidis. Все пробы культивировали при 37°С в течение 1-2 сут. Бульон кипятили в течение 5 минут при 100°С. Клетки из бульона осаждали с помощью центрифугирования в микропробирках при 3000 об/мин в течение 5 минут. Супернатант переносили в новую микропробирку и использовали в качестве образца в ПЦР.

Для полимеразной цепной реакции взяты специфические праймеры на видоспецифические гены cnf для Y pseudotuberculosis [9] и invA для S. Enteritidis [24]. Последовательности праймеров были следующими: cnfY 1F GTTGCAAACTTTCCGTCCCCA, cnfY 2R ACGGCGAACTTGATAATTGCTT, invA-1 CAGTGCTCGTTTACGACCTGAAT, invA-2 AGACGACTGGTACTGATCGATAAT.

Реакцию выполняли в объеме 25 мкл с использованием набора ScreenMix-HS (Евроген, Россия). В каждую пробирку добавляли: образец ДНК 1 мкл, праймеры по 1 мкл каждого, 5*реакционный буфер 5 мкл, вода до общего объема смеси 25 мкл. Проводили ПЦР в амплификаторе «Терцик» (ООО «ДНК-Технология», Россия). Программа состояла из сле-

дующих этапов: 1 цикл 94°С 5 мин, 30 циклов 94°С 1 мин, 55°С 1 мин, 72°С 1 мин и 1 цикл 72°С 5 мин. Электрофорез продуктов ПЦР вели в 1% агарозном геле (Serva Electrophoresis GmbH, ФРГ) и в трисбо-ратном буфере. Гели окрашивали в бромистом эти-дии и фотографировали в УФ-свете в системе гель-документирования Bio-Rad XR (Bio-Rad Laboratories Inc., США). В качестве маркера молекулярного веса использовали PCR Markers (Promega Corp., США).

Как видно из табл.1, монокультуры Y pseudotuberculosis, S. Enteritidis и смешанные культуры этих микроорганизмов формировали биопленки. Отмечался рост показателей биопленкообразования в течении всего срока исследований. Однако следует отметить, что к 6 сут в одинаковых условиях рост биопленки Y pseudotuberculosis по сравнению с S. Enteritidis замедлялся более чем в три раза. Количество биопленки, образованной смешанными культурами, соответствует количеству биопленки S. Enteritidis. Можно предположить, что данные условия более благоприятны для роста S. Enteritidis.

1 2 3

Рис.1. Планшет с окрашенными лунками. Инкубация при 20-22 С

в течение 6 суток. 1 - Y. pseudotuberculosis, 2 - Y. pseudotuberculosis + S. Enteritidis, 3 - S. Enteritidis

Нами также установлена возможность использования ПЦР при анализе бактерий в разных объектах в биопленках и вне их (рис. 2). С помощью ПЦР определено, что Y. pseudotuberculosis и S. Enteritidis давали специфическую реакцию в виде полосы ДНК требуемого размера, что указывает на наличие

Результаты и обсуждение

При изучении динамики формирования биопленки монокультурами Y pseudotuberculosis и S. Enteritidis, а также смешанными культурами на абиотической поверхности установлен рост показателей за период 3-6 сут. наблюдения (табл. 1; рис. 1). В табл 1 приведены количественные показатели формирования биопленок Y. pseudotuberculosis и S. Enteritidis при инкубации в течение 3 и 6 суток при температуре 20-22 С.

клеток данных микроорганизмов в смешанной биопленке и соответствующих контролях для каждого по отдельности микроорганизма (рис. 2).

6 5 4 Ä13 2 1

Рис. 2. Электрофорез ДНК Y. pseudotuberculosis (штамм 696 1b) и S. Enteritidis (штамм S-118) в динамике 3 и 6 сут культивирования.

1,2 - контроли: исходные культуры Y. pseudotuberculosis и S. Enteritidis; 3, 5 - Y. pseudotuberculosis 3 и 6 сутки; 4, 6 - S. Enteritidis 3 и 6 сутки. М - маркер мол. массы

Таким образом, результаты, полученные с помощью разных методов исследования при температуре 20-22 С и 37C в течение 3-6 сут, позволяют сделать вывод о том, что Y pseudotuberculosis и S. Enteritidis. возбудители сапронозов и зоонозов, способны в этих условиях и периоды времени формировать смешанные биопленки.

В условиях смешанной биопленки помимо конкуренции за питательные вещества необходимо учитывать, прежде всего, нетрофические факторы, например, такие как температуру, pH среды и т.д. При изменении какого-либо параметра полученные результаты могут значительно отличаться от результатов, полученных в данной работе.

Однако в дальнейшем для количественного определения ДНК в смешанных биопленках при разных условиях сред культивирования микроорганизмов требуется продолжение изучения этого явления с помощью ПЦР в реальном времени или цифровой ПЦР. Полученные

Таблица 1

Биопленки Y. pseudotuberculosis и S. Enteritidis

№ п/n Моно- и смешанные культуры бактерий А600

3 суток 6 суток

1. Y. pseudotuberculosis 0,574±0,086 0,625±0,089

2. S. Enteritidis 1,617±0,171 1,779±0,180

3. Y. pseudotuberculosis + S. Enteritidis 1,572±0,124 1,790±0,169

HEALTH. MEDiCAL ECOLOGY. SCiENCE 1 (77) - 2019 21

• Микробиология

новые результаты откроют возможность выявить в динамике доминирование в системе одного из исследованных видов микроорганизмов семейства Enterobacteriaceae (Y. pseudotuberculosis или S. Enteritidis).

ЛИТЕРАТУРА

1. Ахметова Д.Г., Бердыгулова Ж.А., Евтыхова Е.Б., Шустов А.В. Сальмонеллы: молекулярные механизмы приспособленности и факторы вирулентности // Биотехнология. теория и практика. 2012; 1: 13-24.

2. Бухарин О.В., Гинцбург А.Л., Романова Ю.М., Эль-Регистан Г.И. Механизмы выживания бактерий -М.: Медицина, 2005. 366 с.

3. Диденко Л.В., Константинова Н.Д., Соло-хина Л.В. и соавт. Ультраструктура Yersinia pseudo-tuberculosis в процессе обратимого перехода в покоящееся (некультивируемое) состояние в ассоциации с сине-зелеными водорослями // Ж. микробиол., эпи-демиол, иммунобиол. 2002. № 1. С. 17-23.

4. Псарева Е.К., Ермолаева С.А., Тимченко Н.Ф. ПЦР-система для детекции Yersinia pseudotuberculosis // Мол. генетика, микробиология и вирусология. 2018. № 2. C. 89-93.

5. Терентьева Н.А., Тимченко Н.Ф., Рассказов В.А. Исследование влияния биологически активных веществ на формирование бактериальных биопленок // Здоровье. Медицинская экология. Наука. 2014. № 3(57). С.54-55.

6. Терентьева Н.А., Псарева Е.К., Тимченко Н.Ф., и др. Влияние токсинов Yersinia pseudotuberculosis на формирование биопленки // Ж. микробиол., эпи-демиол., иммунобиол., 2017, № 6. С. 37-42.

7. Тимченко Н.Ф., Недашковская Е.П., Долматова Л.С., Сомова-Исачкова Л.М. Токсины Yersinia pseudotuberculosis - Владивосток. 2004. 220 с.

8. Adcox H E., Vasicek E.M., Dwivedi V. et al. Salmonella extracellular matrix components influence biofilm formation and gallbladder colonization // Infec. Immun. 2016. V 84.N 11. P. 3243-3251.

9. Almeida F.A., Pimentel-Filho N.J., Pinto U.M, et al. Acyl homoserine lactone-based quorum sensing stimulates biofilm formation by Salmonella Enteritidis in anaerobic conditions // Arch Microbiol. 2017. V199. N 3, P. 475-486.

10. Atkinson S., Chang C.Y., Patrick H.L. et al. Functional interplay between the Yersinia pseudotuberculosis YpsRI and YtbRI quorum sensing systems modulates swimming motility by controlling expression of flhDC and fliA. Mol. Microbiol. 2008; 69(1): 137-151.

11. Borges KA, Furian TQ, de Souza SN, et al. Biofilm formation by Salmonella Enteritidis and Salmonella Typhimurium isolated from avian sources is partially related with their in vivo pathogenicity// Microb Pat-hog. 2018;118: 238-241.

12. Dyszel J.L., Smith J,N., Lucas D.E. et al. Salmonella enterica serovar Typhimurium can detect acyl homoserine lactone production by Yersinia enterocolitica in mice // J. Bacteriol., 2010. N 192. P. 29-37.

13. Gobbetti M., DeAngelis M., DiCagno R. et al. Cell—cell communication in food related bacteria // Int. J. Food Microbiol. 2007. 120(1-2). P. 34-45.

14. Guan J, Xiao X, Xu S, et al. Roles of RpoS in Yersinia pseudotuberculosis stress survival, motility, biofilm formation and type VI secretion system expression // J. Microbiol. 2015. 53 (9): 633-642.

15. Hermans K., Roberfroid S., Thijs I.M. et al. FabR regulates Salmonella biofilm formation via its direct target FabB // BMC Genomics. 2016. N 17. P. 253-268.

16. Hall CW, Mah TF. Molecular mechanisms of bio-film-based antibiotic resistance and tolerance in pathogenic bacteria // FEMSMicrobiol Rev. 2017. 1; 41(3): 276-301.

17. H0iby N. A short historyof microbial biofilms and biofilm infections // APMIS. 2017. V 125. N 4, P. 272-275.

18. Kramer A., Schwebke I., Kampf G. How long do nosocomial pathogens persist on inanimate surfaces? A systematic review // BMC Infectious diseases. 2006. V6. N 130. P. 1-8.

19. Leite B., Werle C.H,, Carmo CPD, et al. Integration host factor is important for biofilm formation by Salmonella enterica Enteritidis // Pathog. Dis. 2017.

V 75. N 6. P. 74-78.

20. Moser C, Pedersen HT, Lerche CJ et al. Biofilms and host response - helpful or harmful// APMIS. 2017.

V 125. N4. P. 320-338.

21. Yaron S., Romling U. Biofilm formation by enteric pathogens and its role in plant colonization and persistence // Microbial Biotechnology. 2014. V7. N6. P. 496-516.

Сведения об авторах

Тимченко Нэлли Федоровна, д.м.н., профессор, в.н.с. лаборатории молекулярной микробиологии НИИЭМ имени Г.П. Сомова, Владивосток; e-mail: ntimch@mail.ru;

Раков Алексей Владимирович, к.м.н., с.н.с. лаборатории молекулярной эпидемиологии и экологии патогенных бактерий НИИЭМ имени Г.П. Сомова, Владивосток;

Псарева Екатерина Константиновна, м.н.с. лаборатории молекулярной микробиологии НИИЭМ имени Г.П. Сомова, Владивосток;

Терентьева Наталья Александровна, к.б.н., с.н.с., Тихоокеанский институт биоорганической химии (ТИБОХ) ДВО РАН имени Г.Б. Елякова, Владивосток;

Яковлев Анатолий Александрович, д.м.н., лабораторией молекулярной эпидемиологии и экологии патогенных бактерий эпидемиологии НИИЭМ имени Г.П. Сомова, Владивосток.

i Надоели баннеры? Вы всегда можете отключить рекламу.