Научная статья на тему 'Характеристика морфогенетических реакций Nicotiana langsdorffii при трансформации штаммами агробактерий дикого типа in vitro'

Характеристика морфогенетических реакций Nicotiana langsdorffii при трансформации штаммами агробактерий дикого типа in vitro Текст научной статьи по специальности «Биологические науки»

CC BY
137
55
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Экологическая генетика
Scopus
ВАК
RSCI
Область наук
Ключевые слова
ТРАНСФОРМАЦИЯ / NICOTIANA LANGSDORFFII / AGROBACTERIUM TUMEFACIENS / AGROBACTERIUM RHIZOGENES / TRANSFORMATION

Аннотация научной статьи по биологическим наукам, автор научной работы — Матвеева Т. В., Пигичка Т. Ю., Лутова Л. А.

Охарактеризована способность к трансформации Nicotiana langsdorffii штаммами дикого типа Agrobacterium tumefaciens (T37, C58, A6) и A. rhizogenes (15834, 8196, A4). Показана более низкая эффективность трансформации данного вида штаммами T37, A6,15834, 8196, A4 по сравнению с модельным объектом N. tabacum. обнаружена склонность опухолей, индуцированных штаммами A. tumefaciens на листовых эксплантах N. langsdorffii, к побегообразованию.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по биологическим наукам , автор научной работы — Матвеева Т. В., Пигичка Т. Ю., Лутова Л. А.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Characteristics of morphogenetic responses of Nicotiana langsdorffii on transformation with wild type strains of Agrobacterium in vitro

Ability to transformation by wt strains of Agrobacterium tumefaciens (T37, C58, A6) and A. rhizogenes (15834, 8196, A4) was characterized for Nicotiana langsdorffii. It was shown that effectivity of transformation of this species by strains T37, A6,15834, 8196, A4 was lower comparing to the model object N. tabacum. Tumors induced by A. tumefaciens on leaf disks of N. langsdorffii, tend to shoot formation

Текст научной работы на тему «Характеристика морфогенетических реакций Nicotiana langsdorffii при трансформации штаммами агробактерий дикого типа in vitro»

симбиогенетика

%

© т. В. матвеева,

т. ю. Пигичка, Л. А. Лутова

Санкт-Петербургский государственный университет

' охарактеризована способность к трансформации Nicotiana langsdorffii штаммами дикого типа Agrobacterium tumefaciens (137, C58, Д6) и Л. rhizogenes (15834, 8196, Л4). Показана более низкая эффективность трансформации данного вида штаммами Т37, Л6,15834, 8196, Л4 по сравнению с модельным объектом N. tabacum. Обнаружена склонность опухолей, индуцированных штаммами A. tumefaciens на листовых эксплантах N. langsdorffii, к побегообразованию.

' Ключевые слова: Шсойапа langsdorffii, трансформация, Agrobacterium tumefaciens, Agrobacterium rhizogenes

ХАРАКТЕРИСТИКА МОРФОГЕНЕТИЧЕСКИХ РЕАКЦИЙ NICOTIANA LANGSDORFFII ПРИ ТРАНСФОРМАЦИИ ШТАММАМИ АГРОБАКТЕРИЙ ДИКОГО ТИПА IN VITRO

ВВЕДЕНИЕ

Род Nicotiana является на сегодняшний день одним из наиболее активно изучаемых с физиологической, эколого-генетической и морфологической точек зрения. В пределах этого рода отмечен и исследуется феномен генетического опухолеобразования. Он выражается в том, что при скрещивании некоторых видов рода Nicotiana друг с другом у гибридов отмечено образование опухолей, напоминающих корончатые галлы, индуцируемые агробактериями. Для объяснения данного феномена виды этого рода были условно подразделены на две группы: « + » и « — ». Скрещивания внутри группы не ведут к опухолеобразованию. Гибриды, полученные от скрещиваний видов из « + » и « — » групп, являются опухолеобразующими [5]. При характеристике морфогенетических процессов в культуре in vitro было показано, что большинство видов из группы «+» склонно к побегообразованию, в то время как для представителей группы « — » характерна склонность к образованию корней [3]. У представителей группы « — » обнаружены последовательности, подобные Т-ДНК из Agrobacterium rhizogenes (гены, гомологичные rolB, rolC, ORF13, ORF14), как результат горизонтального переноса генов в процессе эволюции [ 13, 7]. В пределах группы « + » таковых не обнаружено. Предполагается, что у побегообразующих видов Nicotiana повышено отношение цитокининов к ауксинам, в то время как у корнеобразующих видов повышено отношение ауксинов к цитокининам вследствие функционирования генов, гомологичных агробактериальным [6].

Несмотря на достаточно детальное изучение роли горизонтального переноса генов от агробактерий к растениям в процессе эволюции рода, на сегодняшний день сведения о способности отдельных видов к агротрансформации остаются фрагментарными. По данному параметру подробно охарактеризован только вид N. tabacum, являющийся модельным объектом для культуры in vitro. Имеются отдельные сведения об агротрансформации N. glauca [2, 14]. Оба эти вида относятся к группе « — ». Виды группы « + » охарактеризованы значительно слабее. Вместе с тем, такая характеристика представляет интерес, поскольку может подтвердить информацию о гормональном статусе (повышенном уровне цитокининов) данных видов и дать новые сведения о возможной функции онкогеноподобных последовательностей в межвидовых гибридах у Nicotiana. Одним из типичных представителей группы « + » является N. langsdorffii. Характеристика морфогенетических реакций листовых эксплантов при трансформации данного вида штаммами агробактерий дикого типа, а также изучение эффективности данного процесса являлось задачей представленной работы.

МАТЕРИАЛ И МЕТОДЫ

В качестве материала использовали семена растений N. tabacum и N. langsdorffii, любезно предоставленные Институтом табака и махорки (Краснодар), а также штаммы дикого типа Л. tumefaciens (Т37, С58, А6) и Л. rhizogenes (15834, 8196, А4), предоставленные проф. Нестером (Вашингтонский университет, Сиэтл, США).

Получение асептических растений

Для получения асептических растений семена обрабатывали 30%-м раствором перекиси водорода в течение 15 минут, промывали дистиллированной водой 3 раза по 5 минут. В условиях ламинарного бокса семена высевали для проращивания на питательную среду Мурасиге — Ску-га (МС) [11] без гормонов. Культивирование проводили в условиях 16-часового светового дня. Асептические растения использовали для получения листовых эксплантов.

Эксперименты по трансгенозу были проведены согласно методу трансформации листовых дисков [4]. Учет морфогенетических реакций проводили через 1,5 месяца с момента эксплантации.

Проверку трансгенности тканей проводили методом ПЦР с праймерами к онкогенам агробактерий:

tmsl L R

rolB L R

AGGCTGGCCGATGGTCGCTTCCCC;

GCCGATCCGTCCACTATCGGAACA;

CAATGGATCCCAAATTGCTATTCC;

CGGCTTTAGGCTTCTTTCTTGAGG.

Праймеры синтезированы компанией Syntol.

Объем реакционной смеси для ПЦР составлял 50мкл. В ее состав входили 300 нг матричной ДНК, 2,5 единицы Taq полимеразы (Sileks M), буфер, предложенный фир-мой-производителем фермента, 200 мкМ каждого dNTP и 250 пкМ каждого праймера. ПЦР проводили по программе: 1 цикл — 5 мин 93 °C, 1 мин 60 °C, 1 мин 72 °C, 33 цикла — 15 сек — 93 oC, 40 сек. — 60 °C, 40 сек 72 °C; далее 5 мин 72 °C.

Фрагменты разгоняли в 1 % агарозном геле в буфере ТВЭ при напряженности электрического поля 5В/см. В качестве маркера молекулярных весов использовали 100bp+1,5kb ladder (Сибэнзим).

Статистическая обработка

Для каждого варианта опыта вычисляли процент эксплантов с каждой конкретной реакцией и его стандартную ошибку. Абсолютные частоты альтернативных проявлений каждого из исследованных признаков сравнивали между разными вариантами опыта при помощи критерия х2 [1].

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

При культивировании листовых эксплантов табака на среде Мурасига — Скуга без добавления фитогормонов

характерной реакцией являлось формирование мелких каллусов в местах поранения. В дальнейшем эти каллусы не увеличиваются в размерах и подвергаются некрозу. Кроме того, в ряде случаев можно наблюдать образование корней нормальной морфологии, а на эксплантах N. langsdorffii с низкой частотой формируются побеги.

При трансформации N. langsdorffii и контрольного вида N. tabacum штаммами Agrobacterium tumefaciens и Agrobacterium rhizogenes дикого типа наблюдали три типа морфогенетических реакций: опухолеобразование (рис. 1А), образование бородатых корней (рис. 1Б), побегообразование (рис. 1В). Проявление конкретного типа реакции зависело от генотипа растения и штамма бактерии. Для доказательства трансгенной природы тканей проводили ПЦР с праймерами к онкогенам соответствующей агробактерии. Образование продукта ожидаемой длины (рис. 2) свидетельствует об успешном результате агротрансформации.

При трансформации контрольного вида N. tabacum штаммами A. tumefaciens наблюдали образование опухолей беловатого или желтоватого цвета (рис. 1А). Эти опухоли были способны к гормоннезависимому росту. При трансформации данного вида штаммами A. rhizogenes наблюдали образование корней, характеризующихся агравиотропным ростом (рис. 1Б). Полученные результаты полностью согласуются с литературными данными [2, 4]. Количественные характеристики каждой морфогенетической реакции для данного вида представлены на рисунках 3 и 4.

Реакция на агротрансформацию N. langsdorffii отличалась от таковой у N. tabacum качественно и количественно (рис. 3, 4). Нами показано, что все штаммы, за исключением C58, трансформируют N. langsdorffii с достоверно (р = 95 %) более низкой эффективностью

Рис. 1. Морфогенетические реакции Nicotiana в ответ на аг-робактериальную трансформацию:

А — образование опухолей Б — образование бородатых корней В — образование побегов

(от 0 до 8 %), чем N. tabacum. Опухоли, индуцированные Agrobacterium tumefaciens на эксплантах N. langsdorffii, существенно отличались по морфологии от опухолей на эксплантах N. tabacum. Они были зеленого цвета и на них отмечено интенсивное образование побегов (рис. 1В, 3). Склонность опухолей, индуцированных А.^те!ааеш на листовых эксплантах N. langsdorffii, к побегообразованию согласуется с представлениями о повышенном соотношении цитокининов к ауксинам у данного вида растений, как представителя группы « + ».

Нетипичная реакция на трансформацию агробакте-риальными штаммами дикого типа является особенностью растительных форм с измененным гормональным балансом. Кроме того, измененный ответ на трансформацию агробактериями возможен при воздействии экзогенными фитогормонами. Так, при добавлении цитокинина A. rhizogenes индуцирует на каланхоэ образование не корней, а опухолей, похожих на корончатые галлы [2]. Подобную реакцию мы ожидали увидеть у N. langsdorffii. Однако результат был отличным от ожидаемого. Возможно, это связано с крайне низкой способностью исследуемого вида к трансформации штаммами A. rhizogenes, использованными в работе (рис. 4).

100

90

80

га

60

50

40

30

20

10

о

IL

О опухоли В корни из побеги

N.t 1 N1 N.t [ N.l N.t 1 N1 N.t 1 N1

ft C58 T37 A6

А Б

Рис. 2. Результаты ПЦР с праймерами к генам ^й1 (А) и го1В (Б) на ДНК, выделенной из трансгенных эксплантов Nicotiana langsdorffn.

1. Маркер молекулярного веса 100 Ьр + 1,5 кЬ, Сибэнзим.

2. Результат ПЦР на ДНК A. tumefaciens, штамм С58 (А) или A. rhizogenes, штамм 8196 (Б) — положительный контроль.

3. Результат ПЦР на ДНК из нетрансгенных тканей N. langsdorffii — отрицательный контроль.

4. Результат ПЦР на ДНК из трансгенных тканей N. langsdorffii, полученных при трансформации штаммом С58(А)или 15838(Б)

варианты опыта

Рис. 3. Проценты эксплантов с различными морфогенетическими реакциями, как результат трансформации N. tabacum и N. langsdorffii штаммами Agrobacterium tumefaciens дикого типа.

Названия штаммов и виды растений (N.1. — Nicotiana tabacum, N.1. — Nicotiana langsdorffii) обозначены на рисунке; К — контроль, вариант без использования агробактерий

100

90

80

70

60

50

40

30

20

10

О

'

' я X lV-

Я 1

; І !

ї і

T ! І і 1

TTI M It Ї It .ай 2 ГЇ 1 r££w

Nt 1 N.l It N.t 1 N.l 15838 N.l 1 N.l f M It 1 N.l 8196

□ опухоли Qкорни и побеги

варианты опыта

Рис. 4. Проценты эксплантов с различными морфогенетическими реакциями, как результат трансформации N. tabacum и N. langsdorffii штаммами Agrobacterium rhizogenes дикого типа.

Названия штаммов и виды растений (N.t. — Nicotiana tabacum, N.l. — Nicotiana langsdorfii )обозначены на рисунке; К — контроль, вариант без использования агробактерий

Из литературных источников известно, что штаммы агробактерий с различной эффективностью трансформируют разные виды растений. Это связано с различиями в функционировании продуктов vir генов, генов T-ДНК и некоторых хромосомных генов агробактерий, а также ряда факторов со стороны растения. Данное явление получило название хозяйской специфичности [8, 9, 10, 12]. С другой стороны, описанное явление можно характеризовать в терминах устойчивости растений к патогенам и утверждать, что N. langsdorffii является устойчивым к инфекции исследованными штаммами A. rhizogenes.

На сегодняшний день роль горизонтального переноса генов от агробактерий к растениям рода Nicotiana активно изучается. Было показано, что такие события происходили в эволюции рода неоднократно, тем не менее вопрос о том, почему часть видов подверглась агротрансформации и последовательности Т-ДНК закрепились в ряду поколений, а другая часть видов не содержит таких последовательностей, оставался практически без внимания. Продемонстрированная нами низкая способность к трансформации изучаемого вида всеми исследованными штаммами A. rhizogenes может служить одним из возможных объяснений того, почему данный вид не был вовлечен в горизонтальный перенос генов от агробактерий в процессе его эволюции.

Работа выполнена при поддержке программы BRHE фонда CRDF и Министерства образования и науки РФ, грант ST-012-0, а также гранта Президента РФ для молодых кандидатов наук МК-5352.2006.4.

Литература

1. Лакин Г. Ф. Биометрия / Лакин Г. Ф. // Москва: Высшая школа. — 1990.

2. Пирузян Э. С. Основы генетической инженерии растений / Пирузян Э. С. // М: Наука. — 1988. — 304 с.

3. Bogani P. A physiological and molecular analysis of the genus Nicotiana / Bogani P., Lio P., Intrieri M. // Molecular Phylogenetics and Evolution. — 1997. — Vol. 7 —P. 62-70.

4. Draper J. Plant genetic transformation and gene expression. A laboratiry manual / Draper J., Scott R. // Blackwell Scientific Publications. — 1988. — 408 p.

5. Goodspeed T. H, Ed. “The genus Nicotiana." Waltham, 1954.

6. Ichikawa T. Tobacco genetic tumors. / Ichikawa T., Syono K. // Plant Cell Physiol. — 1991 Vol. 32 (8) — P. 1123-1128.

7. Intrieri M. C. The horizontal transfer of Agrobacterium rhizogenes genes and evolution of the genus Nicotiana / Intrieri M. C., Buiatti. M. // Molecular Phylogenetics and evolution. 2001. — Vol. 20, N 1. — P. 100-110.

8. Jin S. Genes responsible for the supervirulence phenotype of Agrobacterium tumefaciens A281. / Jin S., Komari T., Gordon M. P, Nester E. W // J. Bacteriol. — 1987. — Vol. 169, N 10. — P 4417-4425.

9. Knauf V. C. Comparison of Ti plasmids from three different biotypes of Agrobacterium tumefaciens isolated from grapevines / Knauf V. C. Panagopoulos C. G., Nester E. W. // J. Bacteriol. — 1983. — Vol. 153, N 3. — P. 1535-42.

10. Limited-host-range plasmid of Agrobacterium tumefaciens: molecular and genetic analyses of transferred DNA. / Yanofsky M., Montoya A., Knauf V [et al.] // J. Bacteriol. — 1985. — Vol. 163, N 1. — P. 341-348.

11. Murashige T. A revised medium for rapid growth and bioassay with tobacco tissue culture / Murashige T Skoog F. // Physiol. Plant. — 1962. — Vol. 15.

12. Otten L. Evolution of agrobacteria and their Ti plasmids — a review. / Otten L., Canaday J., Gerard J. C. [et al.] // Mol. Plant-Microbe Interact. -1992 — Vol. 5, N 4. — P. 279-287.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

13. Sequence homologous to Agrobacterium rhizogenes T-DNA in the genomes of uninfected plants. / F. F. White, D. J. Garfinkel, G. A. Huffman [et al.] // Nature, 1983. — Vol. 301. — P. 348-350.

14. White F. F. Tumor induction by Agrobacterium rhizo-genes involves the transfer of plasmid DNA to the plant genome. / Ghidossi G, Gordon M. P., Nester E. W // Proc Natl Acad Sci U S A. — 1982. — Vol. 79 (10). — P. 3193-3197.

Characteristics of morphogenetic responses of Nicotiana langsdorffii on transformation with wild type strains of Agrobacterium in vitro.

Matveeva T. V., Pigichka T. Yu., Lutova L. A.

' SUMMARY: Ability to transformation by wt strains of Agrobacterium tumefaciens (T37, C58, A6) and A. rhizogenes (15834, 8196, A4) was characterized for Nicotiana langsdorffii. It was shown that effectivity of transformation of this species by strains T37, A6,15834, 8196, A4 was lower comparing to the model object N. tabacum. Tumors induced by A. tumefaciens on leaf disks of N. langsdorffii, tend to shoot formation

' Key woRDS: Nicotiana langsdorffii, transformation, Agrobacterium tumefaciens, Agrobacterium rhizogenes

i Надоели баннеры? Вы всегда можете отключить рекламу.