Научная статья на тему 'Фенотип и миграционный потенциал мультипотентных мезенхимных стромальных клеток из нативной и криоконсервированной плаценты человека'

Фенотип и миграционный потенциал мультипотентных мезенхимных стромальных клеток из нативной и криоконсервированной плаценты человека Текст научной статьи по специальности «Биотехнологии в медицине»

CC BY
446
113
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Biotechnologia Acta
CAS
Ключевые слова
ПЛАЦЕНТА / МУЛЬТИПОТЕНТНі МЕЗЕНХіМНі СТРОМАЛЬНі КЛіТИНИ / КРіОКОНСЕРВУВАННЯ / КАРДіОМіОПАТіЯ / МіОКАРД / МУЛЬТИПОТЕНТНЫЕ МЕЗЕНХИМНЫЕ СТРОМАЛЬНЫЕ КЛЕТКИ / КРИО КОН СЕРВИРОВАНИЕ / КАРДИОМИОПАТИЯ / МИОКАРД / PLACENTA / MULTIPOTENT MESENCHYMAL STROMAL CELLS / CRYOPRESERVATION / CARDIOMYO PATHY / MYOCARDIUM

Аннотация научной статьи по биотехнологиям в медицине, автор научной работы — Шаблий В. А., Кучма М. Д., Кирик В. М., Онищенко А. Н., Цупиков О. М.

Мультипотентные мезенхимные стромальные клетки плацентарного происхождения используют для лечения критической ишемии нижних конечностей, дилатационной кардиомиопатии и восстановления кроветворения после трансплантации гемопоэтических стволовых клеток. Поэтому актуальными задачами являются разработка методов криоконсервирования ткани плаценты, выделение из нее мультипотентных мезенхимных стромальных клеток, изучение их молекулярно-биологических свойств, способности к мультилинейной дифференцировке и регенеративного потенциала. В работе показано, что такие клетки, выделенные из нативной и криоконсервированной ткани плаценты человека, имеют сходную морфологию, иммунофенотип и способность к мультилинейной дифференцировке. Впервые установлено, что плацентарные мультипотент ные мезенхимные стромальные клетки имеют признаки мезенхимных и эпителиальных клеток, содержат популяции цитокератин 7-положительных клеток, экспрессирующих виментин и CD90. Нами были выделены клетки, мигрирующие из ткани плаценты при культивировании в присутствии сыворотки человека, которые сходны по иммунофенотипу с мультипотентными мезенхимными стромальными клетками. Эти мультипотентные мезенхимные стромальные клетки способны к заселению поврежденной сердечной ткани in vivo.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по биотехнологиям в медицине , автор научной работы — Шаблий В. А., Кучма М. Д., Кирик В. М., Онищенко А. Н., Цупиков О. М.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Multipotent mesenchymal stromal cells of placental origin are used to treat critical limb ischemia, dilated cardiomyopathy, and hematopoiesis recovery after transplantation of hematopoietic stem cells. Therefore development of the methods of placental tissue cryopreservation and isolation of placental-derived multipotent mesenchymal stromal cells and the study of their molecular-biological properties and capacity to multilineage differentiation and regenerative potential is an actual task. It was shown that multipotent mesenchymal stromal cells excreted from native and cryopreserved human placenta tissue had similar morphology, immunophenotype and multilineage differentiation capacity. For the first time, it was established that placental multipotent mesenchymal stromal cells expressed mesenchymal and epithelial cells markers, contained of cytokeratin 7-positive cells that expressed vimentin and CD90. We isolated the cells that migrated from the placental tissue during culturing in cell culture medium with human serum that were similar in immunophenotype to the multipotent mesenchymal stromal cells. These multipotent mesenchymal stromal cells, isolated from native and cryopreserved placental, were able to survive homing and inte grating into damage cardiac tissue of mice in vivo.

Текст научной работы на тему «Фенотип и миграционный потенциал мультипотентных мезенхимных стромальных клеток из нативной и криоконсервированной плаценты человека»

УДК 601.2:575.853+57.86.13

ФЕНОТИП І МІГРАЦІЙНИЙ ПОТЕНЦІАЛ МУЛЬТИПОТЕНТНИХ МЕЗЕНХІМНИХ СТРОМАЛЬНИХ КЛІТИН З НАТИВНОЇ ТА КРІОКОНСЕРВОВАНОЇ ПЛАЦЕНТИ ЛЮДИНИ

В. А. Шаблій1, 2 1Інститут молекулярної біології і генетики НАН України, Київ

М. Д. Кучма1, 2 В. М. Кирик3

Г. М. Онищенко2 2Інститут клітинної терапії, Київ

О. М. Цупіков3 П. П. Клименко3

П. О. Арешков1 3ДУ «Інститут генетичної та регенеративної медицини

О. В. Кучук3 НАМН України», Київ

Л. Л. Лукаш1 Г. С. Лобинцева2

Е-mail: v_shabliy@ukr.net

Отримано 11.09.2012

Мультипотентні мезенхімні стромальні клітини плацентарного походження використовують для лікування критичної ішемії нижніх кінцівок, дилатаційної кардіоміопатії та відновлення кровотворення після трансплантації гемопоетичних стовбурових клітин. З огляду на це актуаль -ними завданнями є розроблення методів кріоконсервування тканини плаценти, виділення з неї мультипотентних мезенхімних стромальних клітин, вивчення їхніх молекулярно-біологічних властивостей, здатності до мультилінійного диференціювання та регенеративного потенціалу. В роботі показано, що такі клітини, отримані з нативної та кріоконсервованої тканини плаценти людини, мають схожі морфологію, імунофенотип та здатність до мультилінійного диференціювання. Уперше встановлено, що плацентарні мультипотентні мезенхімні стромальні клітини мають ознаки мезенхімних та епітеліальних клітин, містять популяції цитокератин 7-позитивних клітин, які експресують віментин та CD90. Нами було виділено клітини, що мігрують з тканини плаценти під час культивування в присутності сироватки людини, схожі за імунофенотипом до мультипотентних мезенхімних стромальних клітин. Ці мультипотентні мезенхімні стромальні клітини здатні до заселення ушкодженої серцевої тканини in vivo.

Ключові слова: плацента, мультипотентні мезенхімні стромальні клітини, кріоконсервування, кардіоміопатія, міокард.

Дослідження останніх років показали, що плацента людини виконує кровотворну функцію, є нішею гемопоетичних стовбурових клітин і може бути потенційним джерелом мультипотентних мезенхімних стромальних клітин (ММСК) для регенеративної медицини [1]. Лікування критичної ішемії кінцівок за допомогою трансплантації ММСК плаценти людини проходить другу стадію клінічних випробувань [2]. Наразі розроблено й упроваджено в клінічну практику технологію виділення, культивування та кріокон-сервування ММСК плаценти людини [3]. Також у роботі Серікова та ін. описано метод кріоконсервування плаценти людини, в якому розчин кріопротекторів (15%-й пропіленглі-коль, 14% -й ДМСО, 14% -й формамід) уводять в плаценту через пуповинну вену і про-

водять заморожування в холодильній камері при -80 °С [4]. Цей метод було розроблено авторами для виділення гемопоетичних про-геніторних клітин шляхом перфузії судин плаценти розчином з антагоністом стромаль-ного фактора (SDF-1) AMD3100. Слід зазначити, що такий підхід потребує використання високих концентрацій кріопротекторів, не дає змоги контролювати процеси кристалоутворення, обмежує повторне використання плаценти для отримання стовбурових клітин. Також було розроблено велику кількість методів кріоконсервування фрагментів тканини плаценти людини [5], однак не описано придатність їх для виділення та культивування ММСК з кріоконсервованої тканини. Нами було розроблено технологію виділення ММСК з кріоконсервованої плаценти людини [6].

Таким чином, на цей час залишаються недостатньо опрацьованими методи збереження тканини плаценти, виділення та культивування MMСК. Не вивчено властивості MMСК, отриманих з нативної і кріоконсервованої тканини плаценти.

Також було висунуто припущення, що клітини плаценти здатні проникати в материнську кров у результаті спрямованої міграції на компоненти плазми крові, мігрувати в тканини материнського організму, особливо за їх ушкодження чи запалення, та диференціюватись у тканинно-специфічні спеціалізовані клітини під впливом мікро-оточення [7]. Однак залишається багато невивчених питань стосовно властивостей цих клітин, їх походження і регенераторного потенціалу.

Матеріали і методи

Кріоконсервування тканини плаценти

Плаценту отримували в умовах пологового залу/операційної після фізіологічних пологів або операції кесаревого розтину на терміні вагітності 39-41 тиждень у пацієнток віком 23-36 років на підставі попередньої інформованої згоди.

Із плаценти виділяли фрагмент тканини клиноподібної форми, що відходить від пуповини, розмірами 10x10x5 см та масою близько 70 г. Тканину плаценти промивали розчином Хенкса з додаванням 50 од/мл амфотерицину, 100 од/мл пеніциліну, 50 мкг/мл стрептоміцину, після чого тканину переносили в ємність з розчином Хенкса та подрібнювали на фрагменти не більше 3 мм.

Для кріоконсервування фрагментовану тканину переносили в кріоампули і додавали розчин 20%-го диметилсульфоксиду ^MTO, Sigma) до кінцевої концентрації 1,4 M.

Кріоконсервування здійснювали за допомогою програмного заморожувача ЗП-6.00.00.00 (спеціальне конструкторсько-технологічне бюро з дослідним виробництвом Інституту проблем кріобіології та кріомедицини НАН України) відповідно до раніше описаної технології [6]. Процес охолодження розпочинали з 20 ос зі швидкістю 1 ос/хв до температури -6 ос, проводили ініціацію кристалоутворення. За цієї температури зразки витримували впродовж 10 хв. Після завершення кристалізації кріоконтейнери охолоджували зі швидкістю 0,3 ос/ хв до -35 ос, потім -5 ос/хв до -50 ос та -10 ос/ хв до -140 ос. За температури -140 ос процес охолодження в заморожу-вачі зупиняли й переносили матеріал у рідкий азот (-196 ос) на довгострокове зберігання.

Зразки тканини відбирали для проведення аналізу на відсутність HCV, HBV, CMV, HSV 1/2, EBV, Trep. pallidum, Toxop. gondii, HIV-1, Chlam. trachom., Mycop. genit., Ureapl. urealyt. і parvum, бактеріальної та грибкової флори.

Кріоконсервовану тканину розморожували на водяній бані за температури 38-40 ос до появи рідкої фази з подальшим відтаю-ванням при кімнатній температурі. Видалення кріозахисного розчину, що містить ДMСO, проводили шляхом повільного додавання розчину Хенкса до препарату кріоконсервованих фрагментів плаценти до концентрації ДMСO 0,5% та подальшим фільтруванням фрагментів плаценти з перенесенням їх у розчин Хенкса.

Отримання MMСK з нативної та кріоконсервованої тканини плаценти

Тканину нативної плаценти промивали розчином Хенкса і подрібнювали. Клітини з нативної та кріоконсервованої тканини плаценти виділяли методом ферментації в розчині 0,1%-ї колагенази І (Serva, Німеччина) і 0,6 од/мл диспази (Gibco, Німеччина) упродовж 10-30 хв за температури 37 ос. Для зниження активності ензимів додавали фетальну бичачу сироватку (ФБС, Sigma, США) до кінцевої концентрації 10%. Отриману суспензію пропускали через фільтр з діаметром пор 70 мкм (Becton Dickinson, сША) і відмивали центрифугуванням упродовж 10 хв при 300 g. Осад клітин ресуспендували в розчині Хенкса та висівали в ростове середовище ДMEM (Sigma, США) зі вмістом 15% ФБС (Gibco, Німеччина), 2 мM глютаміну, 5мM НEРES (Biomedicals), 100 од/мл пеніциліну, 50 мкг/мл стрептоміцину. Культивування проводили в культуральних флаконах для адгезивних клітин з розрахунку 300-400 тис. клітин на 1 см2 за 37 ос в атмосфері з 5% СО2 зі зміною середовища 2 рази на тиждень. Пересів здійснювали після досягнення культурою 80-90% конфлюентності моношару в співвідношенні 1:3. Для пересіву культуру обробляли впродовж 3-5 хв 0,05%-м розчином трипсину-EДТA (Biochrom, Німеччина) до повного відкріплення.

Довготривале культивування адгезив-них клітин нативної та кріоконсервованої плаценти проводили за умов відсутності інфекційних агентів, бактеріальної та грибкової флори.

Фрагменти тканини плаценти також культивували в середовищі ДMEM з 20%-м вмістом сироватки людини впродовж 14 діб.

Вміст флаконів пропускали послідовно через фільтри з діаметром пор 70 та 40 мкм. Суспензію клітин центрифугували впродовж 10 хв при 300 g, осад клітин ресуспен-дували в розчині Хенкса і вводили мишам у хвостову вену. З метою подальшого культивування осад клітин ресуспендували в середовищі ДМЕМ, що містить 15% ФБС (Gibco, Німеччина), 2 мМ глютаміну, 5мМ HEPES (Biomedicals), 100 од/мл пеніциліну, 50 мкг/мл стрептоміцину.

Кріоконсервування ММСК плаценти

ММСК із нативної плаценти знімали з пластику за допомогою 0,05%-го розчину трипсину-ЕДТА (Biochrom, Німеччина). Для інгібування трипсину до суспензії клітин вносили ФБС (Gibco, Німеччина) до кінцевої концентрації 15%. Клітини відмивали від трипсину шляхом центрифугування 5 хв при 300 g, осад клітин ресуспендували в розчині Хенкса. До клітин повільно додавали розчин Хенкса з 10% ДМСО до кінцевої концентрації 5% та кріоконсервували за програмою, що описана в роботі [8]. Заморожування проводили в програмному заморо-жувачі ЗП-6.00.00.00. За температури -140 °С процес охолодження в заморожува-чі зупиняли й переносили матеріал у рідкий азот (-196 °С) на довгострокове зберігання. Життєздатність клітин після розморожування, визначена шляхом фарбування 0,05% трипановим синім, складала 80±3,67% (n = 5).

Проточна цитофлуорометрія культури клітин плаценти Імунофенотипування суспензії клітин проводили методом проточної цитометрії з використанням мишачих моноклональ-них антитіл anti-CD90 FITC (Becton Dickinson, США) у робочій концентрації 0,5 мкг на 106 клітин; первинного кролячого полікло-нального антитіла anti-cytokeratin 7 (Novus Biological, США) у розведенні 1:20 та вторинного антитіла вівці проти кролячих імуноглобулінів, кон’югованого з флюорохромом Cy3 (Novus Biological, США) у розведенні 1:200.

Вимірювання виконували на лазерному проточному цитофлуориметрі-сортері BD FACSAria (Becton Dickinson, США) за допомогою програмного забезпечення BD FACS Diva 6.1, аналізуючи одночасно 2 параметри світлорозсіювання та 6 параметрів флуоресценції. Для налаштування компенсації перекриття спектрів емісії флуорохромів під

час багатопараметричного аналізу використовували контрольні зразки клітин без внесення антитіл (unstained control), зразки з кожним з антитіл окремо (single stained control) та зразки зі вторинним антитілом.

Спрямоване диференціювання ММСК in vitro

Для визначення здатності клітин диференціюватися в остеогенному напрямку культуру клітин упродовж 3 пасажів культивували в середовищі ДМЕМ (Sigma, США) з 10-7 М дексаметазону, 10 мМ Р-гліцерофос-фату і 0,1 мМ аскорбат-2-фосфату протягом 21 доби. Мінералізований матрикс виявляли фарбуванням 1%-м розчином алізаринового червоного (Sigma, США).

Для адипогенного диференціювання клітини культивували в ДМЕМ із додаванням 10% ФБС, 1 мкМ дексаметазону, 0,5 мМ ізо-бутил-метилксантину (Sigma, США), 0,1 мМ індометацину (Sigma, США) і 10 нг/мл інсуліну впродовж 21 доби. Жирові включення виявляли фарбуванням масляним червоним (Sigma, США).

Хондрогенне диференціювання проводили в середовищі ДМЕМ з 6,25 мкг/мл інсулін-трансферин-селеніту, 0,1 мкМ дексаметазону, 0,1 мМ аскорбат-2-фосфату і 10 нг/мл TGF-Р3 протягом 21 доби. Диференціювання здійснювали з досягненням конфлюентності моношару клітин 80% та формуванням клітинами локального скупчення в краплі живильного середовища об’ємом 5 мкм за щільності посіву 1,6107 кл/мл. Для підтвердження хондрогенного диференціювання проводили кількісне оцінювання експресії мРНК колагену 2-го типу шляхом ПЛР в реальному часі.

Контролем слугували клітини, які культивували впродовж тих самих термінів у живильному середовищі без факторів диференціювання.

Виділення РНК і проведення ПЛР РНК виділяли, використовуючи триреа-гент (Sigma, США). Отриману тотальну РНК обробляли ДНК-азою і застосовували для поставлення синтезу кДНК за методикою виробника (Fermentas, Німеччина). Для визначення експресії генів застосовували праймери (таблиця).

Специфічність праймерів і розміри амплікона оцінювали за допомогою програм Primer-3, послуговуючись базою даних NCBI.

Праймери, використовувані для визначення експресії генів

№ п/п Назва гена Послідовність праймера

Прямий (Forward) Зворотний (Reverse)

1 PPAR-Y2 5' TGTCAGTACTGTCGGTTTC3' 5'AATGGTGATTTGTCTGTTG3'

2 SPP1 5' CTAGGCATCACCTGTGCCATACC3' 5' CAGTGACCAGTTCATCAGATTCATC3'

3 COL2A1 5' AGTGGAGACTACTGGATTGA3' 5' AGTGTACGTGAACCTGCTAT3'

4 ОСТ-4 5' AAGCGATCAAGCAGCGACTAT3' 5' GGAAAGGGACCGAGGAGTACA3'

5 NKX2-5 5' CAAGGACCCTAGAGCCGAAAAG3' 5' CCTGCGTGGACGTGAGTTTC3'

6 ACTB 5' GGACTTCGAGCAAGAGATGG3' 5' AGCACTGTGTTGGCGTACAG3'

Розмір амплікона для гена PPAR-y 2 — 257 н, SPP1 — 331 н, COL2A1 — 441 н, O^-4 — 163 н, NKX2-5 — 236 н, ACTB — 234 н.

FISH-аналіз Для проведення FISH-аналізу використовували кріоконсервовані ММСК 3-го пасажу в кількості 200 тис. клітин, що їх було отримано з плаценти новонароджених чоловічої статі. Приготування препаратів для гібридизації виконували за стандартною методикою. Для гібридизації застосовували зонди CEPX SpectrumGreen probe і CEPY SpectrumOrange probe (Abbot Molecular, USA). Ядра фарбували з використанням DAPI (Abbot Molecular, USA). Мікро-химеризм материнських клітин визначали як відсоток ядер із сигналами двох Х-хромо-сом, для аналізу підраховували 500 ядер. Візуалізацію проводили на флуоресцентному інвертованому мікроскопі Olympus IX71.

Імуноцитохімічне дослідження Для здійснення імуноцитохімічного аналізу клітини висівали в 4-лункові планшети з площею лунки 1,9 cм2 (Nunclon™A Surface), фіксували та пермебілізували розчином ацетон/метанол у співвідношенні 1:1. Ендогенну пероксидазну активність інгібували 0,3% -м розчином Н2О2 впродовж 5 хв. Неспецифічне зв’язування антитіл блокували, інкубуючи цитопрепарати за кімнатної температури в розчині 0,1 М фосфатного буфера, що містив 0,5% сироваткового альбуміну бика. Для детекції цитокератину 7 та лужної фосфатази використовували мишачі моноклональні антитіла (Dako, Данія) та поліклональні кролячі антитіла (Abcam, USA) відповідно. Візуалізацію імунних комплексів проводили із застосуванням Mouse/Rabbit Poly Vue HPR/DAB Detection System (DBS, США).

Для подвійного фарбування на цитокератин 7 та віментин використовували первинні поліклональні кролячі антитіла проти цито-

кератину 7 (Novus Biological, США) і моно-клональні мишачі антитіла проти віментину (Dako, Данія). Для візуалізації зв’язування первинних антитіл застосовували вторинні антитіла вівці проти кролячих (Novus Biological, США) та мишачих імуноглобулінів (Invitrogen, Німеччина), кон’югованих із флюорохромами Cy3 та Alexa 488 відповідно.

Одночасне виявлення цитокератину 7 та CD90 проводили з використанням первинних поліклональних кролячих антитіл проти цитокератину 7 (Novus Biological, США), вторинних овечих, кон’югованих з флюорохромом Cy3, та мишачих монокло-нальних проти CD90, кон’югованих з флюорохромом FITC (Becton Dickinson, США).

Дослідження міграційного потенціалу клітин in vivo

Eксперименти з трансплантації MMСК плаценти тваринам було проведено на моделі кардіоміопатії у самок мишей лінії FVB віком 6 міс із масою тіла 25-30 г, яких утримували в стандартних умовах віварію. Усі роботи з експериментальними тваринами виконували з дотриманням вітчизняного та міжнародного законодавства щодо принципів біоетики та норм біологічної безпеки.

Для моделювання кардіоміопатії неіше-мічного генезу у 19 тварин застосовували підшкірне (п/ш) введення ізопротеренолу (Sigma, США) у дозі 100 мг/кг в 0,1 мл 0,9%-го розчину NaCl 5 днів поспіль. Як контрольну групу використовували тварин, яким уводили 0,1 мл 0,9%-го розчину NaCl п/ш за аналогічною схемою.

MMСК із кріоконсервованої тканини знімали з культурального пластику за допомогою 0,05%-го розчину трипсину^ДТА (Biochrom, Німеччина). Для інгібування трипсину до суспензії клітин вносили ФБС (Gibco, Німеччина) до кінцевої концентрації 15%. Клітини відмивали від трипсину шляхом центрифугування 5 хв при 300 g, осад

клітин ресуспендували в розчині Хенкса. На 21-шу добу після моделювання кардіоміопа-тії тваринам вводили нативні ММСК

з кріоконсервованої тканини (група 1, п = 6) та кріоконсервовані ММСК (група 2, п = 6), що отримані з нативної тканини, у хвостову вену тричі по 3,3х 105 клітин в об’ємі 100 мкл розчину Хенкса з проміжком часу 1 год.

Тваринам, які були контролем для групи 1 (п = 2) уводили тричі по 100 мкл розчину Хенкса, для групи 2 (п =2) — розчин Хенкса з 5% DMSO за аналогічною схемою.

До групи 3 входили миші з кардіоміопа-тією (п = 3), яким вводили суспензію клітин, що мігрували із фрагментів тканини плаценти під час культивування в присутності сироватки людини за вище описаною схемою. Тваринам, які були контролем для групи 3, вводили розчин Хенкса.

Проточна цитофлуорометрія клітин серця Для виявлення клітин людини в серці мишей методом проточної цитометрії суспензію клітин отримували шляхом ензиматичного виділення. Тканину серця промивали в PBS і подрібнювали за допомогою ножиць. Клітини виділяли методом ферментації в розчині 0,2%-ї колагенази І (Serva, Німеччина) і 0,6 од/мл диспази (Gibco, Німеччина). Після ферментації тканини впродовж 15 хв при температурі 37 °С розчин ензимів з тканиною піпетували і продовжували інкубувати 40 хв. Для інактивації ензимів до клітин додавали ФБС до кінцевої концентрації 10%. Суспензію клітин фільтрували через клітинний фільтр з діаметром пор 70 мкм (Becton Dickinson, США), центрифугували впродовж 10 хв зі швидкістю 300 g. Супернатант відбирали й до осаду клітин додавали первинні mouse anti-human IgG2b HLAABC-антитіла (Millipore, США) в розведенні 1:50. Клітини інкубували протягом 20 хв при +4 °С, двічі відмивали в буфері CellWash і 20 хв — за температури

4 °С з 20 мкл вторинних rat anti-mouse IgG2a+b PerCP-антитіл (Becton Dickinson, США). Вимірювання проводили на лазерному проточному цитофлуориметрі-сортері BD FAcSAria (Becton Dickinson, США) за допомогою програмного забезпечення BD FACS Diva 6.1. Як контроль використовували клітини, які інкубували зі вторинним антитілом.

Імунофлуоресцентне дослідження міокарда методом імуногістохімії Парафінові зрізи, що були приготовлені за класичною методикою, депарафінували

двічі по 5 хв при 37 °C у хлороформі, регід-ратували 5 хв за кімнатної температури в 100%-му розчині етанолу, 3 хв — у 96%-му,

1 хв — у 70%-му, 1 хв — у 50%-му розчині етанолу та двічі по 5 хв в 0,1 M розчині фосфатно-сольового буфера (рН = 7,4).

Демаскування антигенів проводили в 0,01 M цитратному буфері (рН = 6) упро-довж10 хв.

Для пермеабілізації зразки обробляли 0,3%-м розчином Triton X-100 (Sigma, США) на 0,1 M фосфатному буфері за кімнатної температури протягом 10 хв. Неспецифічне зв’язування блокували впродовж

30 хв за кімнатної температури за допомогою 0,1 M фосфатного буфера, що містив 1% нормальної сироватки кіз (Sigma, США), 0,3% Triton X-100 та 0,5% сироваткового альбуміну бика (Sigma, США).

Первинні мишачі антитіла проти міто-хондрій людини (Millipore, США) у розведенні 1:50 на 0,1 M фосфатному буфері, що містив 0,3% Triton X-100 та 0,5% сироваткового альбуміну бика, наносили на зрізи й інкубували при температурі +4 °C впродовж 18 год. Після інкубації препарати відмивали від первинних антитіл тричі по 10 хв в 0,1 M фосфатному буфері.

Зразки інкубували протягом 1,5 год за кімнатної температури зі вторинними антитілами, кон’югованими з флюорохромом Alexa 488 (Molecular Probes Inc., США), у розведенні 1:1 000 на 0,1 M фосфатному буфері. Після інкубації препарати відмивали від вторинних антитіл тричі по 10 хв в 0,1 M фосфатному буфері.

Статистична обробка результатів

Під час планування експериментів використовували схему рандомізованих блоків. Eкспериментальні дані обробляли загальноприйнятими методами варіаційної статистики: розраховували значення середніх арифметичних величин (М) і помилку середньої (m). Для визначення вірогідних відмінностей між середніми величинами використовували критерії Вілкоксона та Mанна-Уїтні. Зміни показників вважали вірогідними при Р <0,05. Розрахунки проводили з використанням програмного забезпечення Microsoft Office Excel.

Результати та обговорення

Фрагменти тканини плаценти культивували в рідкому середовищі в присутності сироватки крові людини. Після 14 днів культивування в середовищі спостерігали появу великої кількості клітин з багатьма

відростками, тимчасом як у разі культивування з ФБС — поодинокі клітини (рис. 1).

Зі зміною сироватки крові людини на ФБС на 14-ту добу клітини прикріплювалися до пластику і на 19-ту добу утворювали агрегати, навколо яких росли фібробластоподібні та епітеліальні клітини. Імуноцитохімічним аналізом встановлено, що деякі фіброблас-топодібні та епітеліальні клітини були позитивними на цитокератин 7, тоді як невеликі округлі клітини — на лужну фосфатазу. За подальшого культивування навколо агрегатів формувалися ділянки проліферації стро-мальних клітин, що морфологічно подібні до клонів плацентарних MMСК.

■ X

Рис. 1. Клітини, що їх виділено з тканини плаценти в присутності сироватки людини:

а — культура нативних клітин, 7-ма доба культивування із сироваткою людини; б — агрегати стромальних клітин плаценти, 16-та доба культивування в присутності ФБС; імуноцитохімічне виявлення цитокератину 7 (в) та лужної фосфатази (г); коричневий колір — позитивні клітини (позначені стрілками). х50

Таким чином, із тканини плаценти людини в присутності сироватки людини в умовах in vitro можна виділити клітини, які експре-сують лужну фосфатазу, цитокератин 7 і мають проліферативну активність. Виходячи з того, що позаворсинчастий трофобласт (ПВТ) також експресує лужну фосфатазу та цитокератин 7 [9, 10], можна припустити, що отримана популяція клітин представлена ПВТ. Здатність ПВТ до міграції, хемотропізм до факторів сироватки крові [10,11] та високий потенціал до епітеліально-мезенхімальної трансформації (ЕМТ) [12, 13] були описані раніше. Також показано, що агрегати, які утворюються з клітин, виділених із тканини плаценти в присутності сироватки людини, морфологічно подібні до клонів мультипотен-тних клітин цитотрофобласта [9].

Характеристика ММСК кріоконсервованої плаценти Клони фібробластоподібних клітин спостерігали на 8-му та 14-ту доби при культивуванні нативних [14] та кріоконсервованих фрагментів тканини плаценти. MMСК, що отримані з нативної [14] та кріоконсервованої тканини плаценти [15], мали схожий імунофенотип, на першому пасажі продукували лужну фосфатазу (рис. 2), упродовж трьох пасажів - віментин, були позитивними за CD105, CD73, CD90, HLA-ABC і негативними за поверхневими маркерами гемо-поетичних клітин CD34, CD133, CD45, CD14.

Подібно до MMСК з нативної тканини, клітини, що їх отримано з кріоконсервова-ної плаценти, також містили мінорну популяцію клітин, позитивних на цитокератин 7 та віментин, цитокератин 7 і CD90 (рис. 3).

а б

Рис. 2. Культура клітин кріоконсервованої плаценти:

а — нативна культура клітин. x50; б — імуноцитохімічне виявлення лужної фосфатази (коричневий колір). x100

Рис. 3. Подвійне фарбування культури ММСК плаценти:

на цитокератин 7 та віментин (а), цитокератин 7 та СБ90 (б). Двовимірна гістограма (в) популяції ММСК з фенотипом СК7+СБ90+; СК7 — цитокератин 7

а

г

а

б

Слід зазначити, що MMСК, виділені з амніотичної оболонки, також мають мінорну пупуляцію цитокератин 7- та віментин-позитивних клітин [16]. Присутність у плацентарних MMСК популяції клітин, що одночасно несуть маркери клітин трофо-бласта (цитокератин 7) та мезенхімних клітин (віментин, CD90), свідчить про можливе її виникнення внаслідок епітеліально-мезенхімальної трансформації клітин ПВТ. Було встановлено, що в ПВТ у разі мігрування в ендометрій матки спостерігається експресія цитокератину 7 та віментину [17, 18]. Також описано, що трансформація епітеліальних клітин під впливом конституційної експресії генів Snail, Twist, TGF-ß призводить до набуття епітеліальними клітинами імунофенотипу MMСК, а саме експресії CD90, CD105, CD44, CD 73, CD10 та вімен-тину. Eпітеліальні клітини після індукції EMТ мали потенціал до диференціювання в адипогенному, хондрогенному й остеогенному напрямках [19].

За допомогою цитогенетичного аналізу встановлено, що MMСК, отримані з кріокон-сервованої тканини, мали генотип новонародженого і містили 0,33% материнських клітин. ПЛР-аналіз MMСК з кріоконсервованої тканини показав експресію ОСТ-4, SPP1, COL2A1, PPAR-j2 та відсутність NKX2-5 (рис. 4), чого не спостерігається в MMСК з нативної плаценти [14].

Рис. 4. Електрофореграма результатів ПЛР-аналізу кДНК ММСК кріоконсервованої плаценти на 3-му пасажі з праймерами: до PPAR-Y2, SPP1, NKX2-5, COL2A1, ОСТ-4, ACTB (P-actin)

Експресія генів SPP1 і PPAR-y2 також може свідчити про спорідненість ММСК плаценти з трофобластом [14]. У разі трансплантації ММСК плаценти in utero в плоди щурів порівняно високий вміст донорських клітин спостерігали в плаценті під шаром цитотро-фобласта в зоні знаходження прогеніторних клітин трофобласта [20]. Зважаючи на хоумінг клітин до власної ніші, можна припустити, що плацентарні ММСК походять з клітин, які розміщені під шаром цитотро-фобласта.

У культурі in vitro клітини диференціювалися в адипогенному, остеогенному та хондрогенному напрямках (рис. 5, 6).

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

За культивування цих клітин в остеогенному середовищі спостерігається зростання експресії SPP1 майже вдвічі стосовно контролю, тимчасом як у разі культивування ММСК з нативної тканини такого підвищення рівня експресії не відбувається, що, ймовірно, вказує на вищий остеогенний потенціал ММСК, виділених із кріоконсервованої тканини плаценти (рис. 6).

Слід зазначити, що хондрогенне диференціювання відбувалося за умов утворення локального скупчення ММСК під час культивування в краплі, тоді як за індукції культури клітин у моношарі рівень експресії мРНК гена колагену 2-го типу (COL2A1) не зростав.

Рис. 5. Препарати культур стромальних клітин плаценти на 3-му пасажі:

21-ша доба культивування без факторів диференціювання (а, в) і в присутності факторів остеогенного (б) та адипогенного (г) диференціювання; а, б — фарбування Oil Red O; в, г — фарбування Alizarin Red S. x 100

Рис. б. Рівень експресії генів SPP1 і PPAR-gamma-2 в ММСК кріоконсервованої плаценти:

індукція в остеогенному та адипогенному напрямках диференціювання (порівняно з контролем)

ї 2 Рис. 7. Рівень експресії гена COL2A1 в ММСК кріоконсервованої плаценти:

індукція хондрогенного диференціювання у процесі утворення клітинами моношару (ї ) та агрегату (2) порівняно з контролем

Дослідження міграційного потенціалу клітин in vivo, виділених із плаценти в присутності сироватки людини

На 28-му добу (49-та доба моделювання кардіоміопатії) після трансплантації клітин, виділених із плаценти у процесі культивування в присутності сироватки людини, за допомогою імуногістохімічного аналізу виявлено присутність донорських клітин у стінках судин та тканини серця мишей (рис. 8).

Таким чином, можна стверджувати, що плацентарні клітини здатні мігрувати і заселяти ушкоджену тканину, локалізуючись головним чином біля кровоносних судин.

Показано, що цитотрофобласт має здатність до інтеграції та диференціювання в ендотеліальні клітини і слугує основним джерелом неоангіогенезу в матці під час вагітності. Також встановлено, що клітини плода можуть вбудовуватись у судини різних тканин матері, особливо при запальних процесах [21]. Ці результати відповідають

а б

Рис. 8. Гістологічний препарат тканини серця мишей на 28-му добу після трансплантації клітин, отриманих під час культивування тканини плаценти в присутності сироватки людини:

а, б — мітохондрії плацентарних клітин людини (зелений колір); комбінація флуоресцентної мікроскопії та фазового контрасту

нашим гістологічним даним, які свідчать, що трансплантовані клітині, виділені в присутності сироватки людини з тканини плаценти, більшою мірою локалізуються в стінках судин міокарда.

Дослідження міграційного потенціалу in vivo ММСК нативної та кріоконсервованої плаценти Mетодом проточної цитометрії встановлено, що після трансплантації MMСК, які отримані з нативної та кріоконсервованої тканини плаценти, відносна кількість клітин людини в міокарді миші становила через 48 год 0,0025% ± 0,0004 (n = 3) та 0,004% ± 0,0009 (n = 3) відповідно (Р < 0,05), на 28-му добу — 0,0056% ± 0,0021 (n = 2) та

0,0036% ± 0,0020 (n = 3) відповідно.

Імуногістохімічне дослідження показало присутність клітин людини в судинах на препараті міокарда мишей через 48 год після трансплантації MMСК, отриманих із кріоконсервованої тканини плаценти людини (рис. 9).

Імуногістохімічним методом виявлено мітохондрії людини в зразках міокарда тварин через 4 тижні після трансплантації клітин, одержаних із нативної та кріоконсерво-ваної тканини плаценти (рис. 10). Такий метод виявлення клітин людини при ксенотрансплантаціях використовують у багатьох дослідженнях [22-24].

Слід зазначити, що ступінь химеризму тканини міокарда мишей під час трансплантації клітин плаценти людини відповідав даним, отриманим групою дослідників, які проводили трансплантацію MMСК плаценти імунодефіцитним мишам лінії SCID/ NUD

[25], гемопоетичних клітин та MMСК плаценти in utero [13]. Також описано тропність плацентарних MMСК до судин та їхній

б

Рис. 9. Гістологічний препарат міокарда миші на 48-му год після трансплантації ММСК з кріоконсервованої тканини плаценти:

мітохондрії MMСК (зелений колір) людини; а — флуоресцентна мікроскопія; б — комбінація флуоресцентної мікроскопії та фазового контрасту

а

в

Рис. 10. Гістологічний препарат міокарда миші на 28-му добу після трансплантації плацентарних ММСК людини:

а — мітохондрії MMСК (зелений колір) з нативної тканини плаценти; б, в — мітохондрії MMСК (зелений колір) з кріоконсервованної тканини плаценти та ядра клітин міокарда (в, синій колір); а, б — комбінація флуоресцентної мікроскопії та фазового контрасту; в — флуоресцентна мікро ско пія

ендотеліальний потенціал in vitro й in vivo

[26]. Здатність плацентарних ММСК до диференціювання в кардіоміоцити було показано в роботі [27].

Таким чином, культура плацентарних ММСК містить популяцію клітин, що несуть маркери епітелію та мезенхіми і за своїм імунофенотипом споріднені з плацентарним

.4. g .

епітелієм. MMG^ отримані з нативної та кріоконсервованої тканини плаценти людини, мають схожу морфологію, імунофенотип та здатність до диференціювання. Клітини, які мігрують з тканини плаценти під час культивування в присутності сироватки людини, схожі за імунофенотипом до MMG^ Усі ці типи клітин здатні до заселення ушкодженої серцевої тканини in vivo. Імуногістохмічним аналізом міокарда мишей встановлено, що більша частина виявлених донорських клітин, отриманих як з нативної, так і з кріоконсервованої тканини плаценти, локалізуються біля судин міокарда, що також може свідчити про їх функціональну подібність.

Отже, в результаті проведеної роботи встановлено, що MMСК з кріоконсервованої тканини плаценти людини мають схожу морфологію, імунофенотип та здатність до мультипотентного диференціювання з MM^ нативної тканини. Уперше показано, що плацентарні MMСК мають ознаки мезенхі-мальних та епітеліальних клітин, містять популяції подвійно позитивних клітин на цитокератин 7 і віментин, цитокератин 7 та CD90. Клітини, виділені з тканини плаценти у процесі культивування в присутності сироватки людини, утворюють популяцію адге-зивних клітин, подібних за імунофенотипом до MMСК. Клітини, які мігрують з тканини плаценти під час культивування в присутності сироватки людини, MMСК, що виділені з нативної та кріоконсервованої плаценти, здатні до заселення ушкодженої серцевої тканини in vivo.

ЛІТЕРАТУРА

1. Parolini O, Alviano F., Bagnara G. P. et al. Concise review: isolation and characterization of cells from human term placenta: outcome of the first international Workshop on Placenta Derived Stem Cells // Stem Cells. —

2008. — V. 26. — P. 300-311.

2. Safety of Intramuscular Injection of Alloge-

neic PLX-PAD Cells for the Treatment of Critical Limb Ischemia [Електронний ресурс] /інтернет-портал «dinicalTrials.gov», Identifier: NCT00919958, 2012. — Режим доступу: http://clinicaltrials.gov/ct2/

show/NCT00919958?term=limb+ische-mia+Pluristem&rank=1.

3. Brooke G., Rossetti T., Pelekanos R. et al. Manufacturing of human placenta-derived mesenchymal stem cells for clinical trials // Brit. J. Haematol. — 2008. — V. 144. — P. 571-579.

4. Serikov V., Hounshell C., Larkin S. et al. Human Term Placenta as a Source of Hemato -poietic Cells // Exp. Biol. Med. — V. 2009. — N 234. — P. 813-823.

5. Prokopyuk O. S., Prokopyuk V. Yu., Volina V. V., Chizhevsky V. V. Cryopreservation effect on morphofunctional integrity of human placental tissue // Abstract of 47th Annual Meeting of the Society for Cryobiology CRY0-2010, Bristol, UK, 17-20 July 2010. — P. 77.

6. Пат. UA 67620. Спосіб виділення мезенхі-мальних мультипотентних стромальних клітин / Лобинцева Г. С., Шаблій В. А., Кучма М. Д. — Заявл. 30.09.2011; Опубл. 27.02.2012, Бюл. № 4.

7. Kara R. J., Bolli P., Karakikes I. et al. Fetal cells traffic to injured maternal myocardium and undergo cardiac differentiation // Circ. Res. — 2012. — V. 110. — P. 82-93.

8. Пат. UA 4бб73 А. Спосіб консервування гемопоетичних клітин людини/ Лобинце-ва Г. С. — Заявл. 14.01.2002; Опубл. 15.05.2002, Бюл. №5.

9.Spitalieri P., Cortese G., Pietropolli A. et al. Identification of Multipotent Cytotropho-blast Cells from Human First Trimester Chorionic Villi // Clon. Stem Cells. — 2009. — V. 11, N 4. — P. 535-556.

10. Sato Y., Fujiwara H., Zeng B.-X. et al. Platelet-derived soluble factors induce human extravillous trophoblast migration and differentiation: platelets are a possible regulator of trophoblast infiltration into maternal spiral arteries // Blood. — 2005. — V. 106, N 2. — P. 428-435.

11. Hannan N. J., Jones R. L., White C. A. et al. The Chemokines, CX3CL1, CCL14, and CCL4, Promote Human Trophoblast Migration at the Feto-Maternal Interface // Biol. Reprod. — 2006. — V. 74. — P. 896-904.

12. AЪell A. N., Granger D. A., Johnson N. L. et al. Trophoblast Stem Cell Maintenance by Fibroblast Growth Factor 4 Requires MEKK4 Activation of Jun N-Terminal Kinase // Mol. Cell. Biol. — 2009. — V. 29, N 10. — P. 2748-2761.

13. AЪell A. N., Vincent J. N., Huang W. et al. MAP3K4/CBP-Regulated H2B Acetylation Controls Epithelial-Mesenchymal Transition in Trophoblast Stem Cells // Cell Stem Cell. — 2011. — V. 8. — Р. 525-537.

14. ShaMii V., Kuchma M., Kyryk V. et al. Characteristics of hematopoietic and mesenchymal stem cells isolated from cryopre-served human placental tissue // ISSCR, 10th Annual Meeting, Yokohama, Japan, June 13-16, 2012. — P. 95.

15. Шаблий В. А., Кучма М. Д., Кирик В. М. и др. Криоконсервирование ткани плаценты человека — источник гемопоэтических прогениторных клеток и мультипотен-тных мезенхимных стромальных клеток // Кл. трансплант. ткан. инж. — 2012. — Т. 7, № 1. — С. 54-62.

16. Künig J. Endothelial differentiation potential of amnion-derived mesenchymal stromal cells, 2011.

17. Wehrum M. J., Buhimsch I. A., Salafia C. et al. Accreta complicating complete placenta previa is characterized by reduced systemic levels of vascular endothelial growth factor and epithe-lial-to-mesenchymal transition of the invasive trophoblast // Am. J. Obstet Gynecol. — 2011. — V. 204, N 5. — P. 411.e1-411.e11.

18. AЪoagye-Mathiesen G., Laugesen J., Zdravko-vic M., Evesen P. Isolation and Characteri-

zation of Human Placental Trophoblast Subpopulations from First-Trimester Chorionic Villi // Clin. Diagn. Lab. Immun. — 1996. — V. 3 (1). — P. 14-22.

19. Battula V. L., Evans K. W., Hollier B. G. et al. Epithelial-Mesenchymal Transition-Derived Cells Exhibit Multilineage Differentiation Potential Similar to Mesenchymal Stem Cells // Stem Cells. — 2010. — V. 28. — P. 1435-1445.

20. Chen C.-P, Liu S.-H., Huang, J.-P. et al. Engraftment potential of human placenta-derived mesenchymal stem cells after in utero transplantation in rats // Hum. Reprod. — 2009. — V. 24, N 1. — P. 154-165.

21. Huu S. N, Oster M., Uzan S. et al. Maternal neoangiogenesis during pregnancy partly derives from fetal endothelial progenitor cells // Proc. Nath. Acad. Sci. — 2007. — V. 104, N 6. — P. 1871-1876.

22. Sheth R. N., Manzano G., Li X., Levi A. D. Transplantation of human bone marrow-derived stromal cells into the contused spinal cord of nude rats // J. Neurosurg. Spine. —

2008. — V. 8, N 2. — P. 153-162.

23. Walczak P., Chen N, Eve D. et al. Long-term cultured human umbilical cord neural-like cells transplanted into the striatum of NOD SCID mice // Brain Res. Bull. — 2007. — V. 14, N 74 (1-3). — P. 155-163.

24. Hwang D. H., Kim B. G., Kim E. J. et al. Transplantation of human neural stem cells transduced with Olig2 transcription factor improves locomotor recovery and enhances myelination in the white matter of rat spinal cord following contusive injury // BMC Neurosci. — 2009. — V. 10. — 16 p.

25. Lee R. H., Pulin A. A., Seo M. J. et al. Intravenous hMSCs Improve Myocardial Infarction in Mice because Cells Embolized in Lung Are Activated to Secrete the Antiinflammatory Protein TSG-6 // Cell Stem Cell. — 2009. — V. 5. — P. 54-63.

26. Lee M. Y., Huang J. P., Chen Y. Y. et al. Angiogenesis in Differentiated Placental Multipotent Mesenchymal Stromal Cells Is Dependent on Integrin a5b1 // PLoS ONE. —

2009. — V. 4 (10). — P. 1-2.

27. Ventura C., Cantoni S., Bianchi F. et al. Hyaluronan Mixed Esters of Butyric and Retinoic Acid Drive Cardiac and Endothelial Fate in Term Placenta Human Mesenchymal Stem Cells and Enhance Cardiac Repair in Infarcted Rat Hearts // J. Biol. Chem. — 2007. — V. 282 (19). — P. 14243-14257.

ФЕНОТИП И МИГРАЦИОННЫЙ ПОТЕНЦИАЛ МУЛЬТИПОТЕНТНЫХ МЕЗЕНХИМНЫХ СТРОМАЛЬНЫХ КЛЕТОК ИЗ НАТИВНОЙ И КРИОКОНСЕРВИРОВАННОЙ ПЛАЦЕНТЫ ЧЕЛОВЕКА

В. А. Шаблий1' 2, М. Д. Кучма1- 2, В. М. Кирик3, А. Н. Онищенко2, О. М. Цупиков3,

П. П. Клименко3, П. А. Арешков1,

О. В. Кучук3, Л. Л. Лукаш1, Г. С. Лобынцева2

1Институт молекулярной биологии и генетики НАН Украины, Киев

2Институт клеточной терапии, Киев 3ГУ «Институт генетической и регенеративной медицины НАМН Украины», Киев

E-mail: v_shabliy@ukr.net

Мультипотентные мезенхимные стромаль-ные клетки плацентарного происхождения используют для лечения критической ишемии нижних конечностей, дилатационной кардио-миопатии и восстановления кроветворения после трансплантации гемопоэтических стволовых клеток. Поэтому актуальными задачами являются разработка методов криоконсервирования ткани плаценты, выделение из нее мультипотентных мезенхимных стромальных клеток, изучение их молекулярно-биологических свойств, способности к мультилинейной дифференцировке и регенеративного потенциала. В работе показано, что такие клетки, выделенные из нативной и криоконсервирован-ной ткани плаценты человека, имеют сходную морфологию, иммунофенотип и способность к мультилинейной дифференцировке. Впервые установлено, что плацентарные мультипотент-ные мезенхимные стромальные клетки имеют признаки мезенхимных и эпителиальных клеток, содержат популяции цитокератин 7-положительных клеток, экспрессирующих вимен-тин и CD90. Нами были выделены клетки, мигрирующие из ткани плаценты при культивировании в присутствии сыворотки человека, которые сходны по иммунофенотипу с мульти-потентными мезенхимными стромальными клетками. Эти мультипотентные мезенхимные стромальные клетки способны к заселению поврежденной сердечной ткани in vivo.

Ключевые слова: плацента, мультипотентные мезенхимные стромальные клетки, криоконсервирование, кардиомиопатия, миокард.

PHENOTYPE AND MIGRATION POTENTIAL OF MULTIPOTENT MESENCHYMAL STROMAL CELLS FROM NATIVE AND CRYOPRESERVED HUMAN PLACENTA

V. A. Shablyy12, M. D. Kuchma1, 2, V. M. Kyryk3, G. M. Onishchenko2, O. M. Tsupykov3,

P. P. Klymenko3, P. O. Areshkov1, O. V. Kuchuk3, L. L. Lukash1, G. S. Lobyntseva2

1Institute of Molecular Biology and Genetics of National Academy of Sciences of Ukraine, Kyiv

2Institute of Cell Therapy, Kyiv

3State Institute of Genetic and Regenerative Medicine of National Academy of Medical Science of Ukraine, Kyiv

E-mail: v_shabliy@ukr.net

Multipotent mesenchymal stromal cells of placental origin are used to treat critical limb ischemia, dilated cardiomyopathy, and hemato-poiesis recovery after transplantation of hematopoietic stem cells. Therefore development of the methods of placental tissue cryopreservation and isolation of placental-derived multipotent mesenchymal stromal cells and the study of their molecular-biological properties and capacity to multilineage differentiation and regenerative potential is an actual task. It was shown that multipotent mesenchymal stromal cells excreted from native and cryopreserved human placenta tissue had similar morphology, immunophenoty-pe and multilineage differentiation capacity. For the first time, it was established that placental multipotent mesenchymal stromal cells expressed mesenchymal and epithelial cells markers, contained of cytokeratin 7-positive cells that expressed vimentin and CD90. We isolated the cells that migrated from the placental tissue during culturing in cell culture medium with human serum that were similar in immunophe-notype to the multipotent mesenchymal stromal cells. These multipotent mesenchymal stromal cells, isolated from native and cryopreserved placental, were able to survive homing and integrating into damage cardiac tissue of mice in vivo.

Key words: placenta, multipotent mesenchymal stromal cells, cryopreservation, cardiomyopathy, myocardium.

i Надоели баннеры? Вы всегда можете отключить рекламу.