Научная статья на тему 'Что такое молекулярная история'

Что такое молекулярная история Текст научной статьи по специальности «История. Исторические науки»

CC BY
388
97
Поделиться
Ключевые слова
ДНК-ГЕНЕАЛОГИЯ / АЛАНЫ / ОСЕТИНЫ / КАРАЧАЕВО-БАЛКАРЦЫ

Аннотация научной статьи по истории и историческим наукам, автор научной работы — Клёсов Анатолий Алексеевич

В статье речь идет о новой науке, которая только создается, основы которой были заложены в последние годы, и происходит прогрессивное накопление экспериментального материала. Имя этой науки ДНК-генеалогия. В области ДНК-генеалогии уже есть наработки, которые надо сопоставить с данными истории, археологии, лингвистики, антропологии. В данной статье приведен пример, относящийся к аланам и их предполагавшейся роли в происхождении осетин и карачаево-балкарцев. ДНК-генеалогия показала, что донские аланы, во всяком случае, из одного описанного некрополя, имеют европейское, а не центральноазиатское происхождение. Автор уверен в том, что между молекулярной историей и традиционными историческими науками будет союз, а не конфликт.

WHAT IS THE MOLECULAR HISTORY

The article aims at a new field of science, a foundation of which has been laid in the last several years, and a progressive accumulation of new experimental data is continuing exponentially. A name of this science is DNA genealogy. It has already obtained many new results which need to be compared with those in history, archeology, linguistics, anthropology. A particular example, which is considered in this paper, deals with the Alans and their assumed role in the origin and history of the Ossetians and Karachaevo Balkars. DNA genealogy showed that Don Alans, which for a long time were considered to be forbearers of said peoples, are too distant from them according to their DNA features (that is a pattern of mutations in Y chromosome), at least the Don Alans from one particular burial. It was shown that those Don Alans have a certain and rather recent European ancestry, and did not migrate from Central Asia. The author is certain that there will be a close union between molecular history and traditional historical sciences, which will become even stronger along with progress in DNA genealogy studies.

Текст научной работы на тему «Что такое молекулярная история»

№ 1 (2015)__________________ИСТОРИЧЕСКИЙ ФОРМАТ__________________стр. 53

УДК 929.5

ЧТО ТАКОЕ МОЛЕКУЛЯРНАЯ ИСТОРИЯ

А.А. Клёсов

Академия ДНК-генеалогии (Бостон, США) e-mail: aklyosov@comcast.net

Авторское резюме

В статье речь идет о новой науке, которая только создается, основы которой были заложены в последние годы, и происходит прогрессивное накопление экспериментального материала. Имя этой науки — ДНК-генеалогия. В области ДНК-генеалогии уже есть наработки, которые надо сопоставить с данными истории, археологии, лингвистики, антропологии. В данной статье приведен пример, относящийся к аланам и их предполагавшейся роли в происхождении осетин и карачаево-балкарцев. ДНК-генеалогия показала, что донские аланы, во всяком случае, из одного описанного некрополя, имеют европейское, а не центральноазиатское происхождение. Автор уверен в том, что между молекулярной историей и традиционными историческими науками будет союз, а не конфликт.

Ключевые слова: ДНК-генеалогия, аланы, осетины, карачаево-балкарцы

WHAT IS THE MOLECULAR HISTORY

A.A. Klyosov

The Academy of DNA Genealogy (Boston, USA)

e-mail: aklyosov@comcast.net

Abstract

The article aims at a new field of science, a foundation of which has been laid in the last several years, and a progressive accumulation of new experimental data is continuing exponentially. A name of this science is DNA genealogy. It has already obtained many new results which need to be compared with those in history, archeology, linguistics, anthropology. A particular example, which is considered in this paper, deals with the Alans and their assumed role in the origin and history of the Ossetians and Karachaevo Balkars. DNA genealogy showed that Don Alans, which for a long time were considered to be forbearers of said peoples, are too distant from them according to their DNA features (that is a pattern of mutations in Y chromosome), at least the Don Alans from one particular burial. It was shown that those Don Alans have a certain and rather recent European ancestry, and did not migrate from Central Asia. The author is certain that there

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 53

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 54

will be a close union between molecular history and traditional historical sciences, which will become even stronger along with progress in DNA genealogy studies.

Keywords: DNA genealogy, Alans, Ossetians, Karachaevo Balkars

В этой статье, вводной по данной тематике, речь пойдет о новой науке, которая только создается, основы которой были заложены в последние годы, причем стремительно (Klyosov 2008; Klyosov 2009a; 2009b; 2009c; Клёсов 2011; Rozhanskii, Klyosov 2011; 2012; Klyosov 2012; Klyosov, Rozhanskii 2012a; 2012b; Klyosov et al. 2012; Klyosov, Tomezzoli 2013; Клёсов 2013а; Клёсов 2013b; Klyosov, Mironova 2013; Elhaik et al. 2014; Klyosov 2014), и происходит прогрессивное накопление экспериментального материала. Новый материал поступает потоком, ежедневно в базы данных уходят десятки и сотни новых «экспериментальных точек», которые по принципу обратной связи корректируют методологию новой науки, что приводит к уточнению методов расчета.

Имя этой науки — ДНК-генеалогия. Ее экспериментальные данные — это картина мутаций в нерекомбинантных (то есть не комбинирующихся с другими в ходе передачи наследственной информации потомкам) участках мужской половой хромосомы (на самом деле — и в митохондриальной ДНК, но в этой статье речь пойдет о Y-хромосоме, более информативной для исторических исследований), причем картина мутаций как в Y-хромосомах отдельных людей, так и их групп, популяций. Методология новой науки — перевод динамической картины мутаций в хронологические показатели, во времена жизни общих предков популяций, а на самом деле — общих предков древних родов и племен. То есть фактически производится расчет времен, когда в древности жили эти рода и племена, и как эти времена меняются от территории к территории (Klyosov 2009a; 2009b; 2009c; Klyosov 2011; Rozhanskii, Klyosov 2011; Klyosov 2012).

Введем некоторые важные понятия и определения. Ниже они будут пояснены более детально, но важно их сразу обозначить. Во-первых, понятие «ДНК-генеалогия». Это - не генетика, в чем часто путаются даже професионалы в науке. Генетика человека - это наука, изучающая наследственность и изменчивость признаков, определяющих врожденные особенности человека, и передаваемых, как правило, через гены. Но ДНК только на 2% состоит из генов, а в Y-хромосоме генов вообще ничтожная доля. Однако дело даже не столько в этом.

Направления и области науки определяются не объектами исследования, а методологией исследования. Именно методология исследования отличает, например, химию от физики, хотя объекты часто одинаковы. Методология генетики совершенно другая, чем методология ДНК-генеалогии. У них разные задачи исследований. ДНК-генеалогия по сути историческая наука, она оперирует хронологией, датировками древних событий, и для этого ДНК-генеалогия использует свой расчетный аппарат, которого нет в методологии генетики. ДНК-генеалогия использует и развивает методы физико-химической кинетики в

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 54

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 55

применении к ДНК, переводит картину мутаций в хронологические, исторические показатели, как указывалось выше. Это вообще не входит в методологию генетики, у нее другой экспериментальный и аппаратурный базис.

Ошибка - полагать, что направление науки определяется объектом исследования. Изучать ДНК - это далеко не обязательно генетика. Например, химик, растворяя ДНК в кислоте и изучая, скажем, вязкость получаемого раствора, вовсе не занимается генетикой. Альберт Сент-Дьорди как-то сказал - «Дайте химику динамомашину, и он тут же растворит ее в соляной кислоте». Это вовсе не означает, что химик при этом будет заниматься электродинамикой.

Некоторые, не слишком знакомые с предметом, полагают, что ДНК-генеалогия - это популяционная генетика. Это - совершенно не так. Во-первых, популяционная генетика есть часть генетики, о чем говорит ее название, но со своими особенностями. Главная задача популяционной генетики - это выявление связи между генотипом и фенотипом, то, к чему ДНК-генеалогия не имеет отношения. Популяционная генетика зачастую тоже рассматривает гаплогруппы и гаплотипы Y-хромосомы, как и ДНК-генеалогия, но на этом сходство заканчивается. Аппарат популяционной генетики, применяемый для интерпретации получаемых данных, например, «метод главных компонент», характеризуется со стороны ДНК-генеалогии как совершенно примитивный и ведущий к заблуждениям, и не используется в ДНК-генеалогии. Он не отвечает задачам ДНК-генеалогии. Это же относится и к искаженным и примитивным методам обработки картин мутаций в ДНК в рамках популяционной генетики.

Если популяционный генетик увидит (или получит) набор из сотни гаплотипов, скажем, 37-маркерных, в котором, например, четыре гаплотипа одинаковых, и еще семь будут совпадать друг с другом случайными парами, он сообщит, что в наборе имеется «89 уникальных гаплотипов», и это и будет результатом его исследования, который пойдет в статью в научный журнал. Ни он, ни рецензенты не хотят признать, это эта «информация» не имеет ни малейшей ценности, и фактически никому в таком виде не нужна. Но таковы принципы и правила популяционной генетики. «Молекулярной историей» это назвать никак нельзя. А специалист в ДНК-генеалогии сразу скажет, что общий предок этих ста гаплотипов жил 925±105 лет назад, потому что натуральный логарифм отношения 100/4, поделенный на константу скорости мутации для 37-маркерных гаплотипов (0.09 мутаций на гаплотип на условное поколение в 25 лет) равен 36 37 условных

поколений (стрелка здесь - поправка на возвратные мутации), то есть общий предок этой сотни гаплотипов жил примерно 925 лет назад.

Сказать это с большей определенностью можно тогда, когда подсчитано число мутаций во всех ста гаплотипах, и оно будет равно 324, и тогда 324/100/0.09 = 36 37

условных поколений, то есть ровно тот же промежуток времени до общего предка. Погрешность расчетов определяется по известным правилам (Klyosov 2009a). Совпадение времен до общего предка для «логарифмического» и «линейного»

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 55

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 56

метода (в первом мутации не считаются, во втором считаются) свидетельствует, что закономерности образования мутаций в гаплотипах следуют кинетике первого порядка, что в свою очередь означает, что все сто гаплотипов действительно произошли от одного прямого общего предка. Популяционная генетика такими подходами не пользуется, они ей чужды по ряду причин, среди них -приверженность устаревшим подходам, отсутствие соответствующего образования, клановость, отсутствие хорошей научной школы. Короче, ДНК-генеалогия является другой дисциплиной, нежели популяционная генетика.

Во-вторых, понятие «молекулярная история». Суть его в том, что становится возможным следить за передвижениями древних народов не с помощью лопаты и кисточки археолога, не обмеряя черепа, не хитроумно расплетая созвучия и значения слов в живых и мертвых языках, не изучая древние фолианты в библиотеках и монастырях, а просто прослеживая за метками в Y-хромосомах в наших ДНК. Они, эти метки, не могут «ассимилироваться», или «поглотиться» другими языками, культурами, или народами, как это происходит тысячелетиями в рамках понятий истории, лингвистики, антропологии. Иначе говоря, методология новой исторической науки основывается на изучении молекул нуклеиновых кислот, а именно ДНК, дезоксирибонуклеиновой кислоты. То, что еще несколько лет назад казалось каким-то развлечением, оказалось, дает истории, антропологии, археологии, лингвистике возможность проверить концепцию, рассмотреть данные под принципиально другим углом, связать воедино, казалось бы, разрозненные части общей картины наших знаний об окружающем мире.

Разумеется, не следует понимать буквально слова выше, как то, что отныне не нужно читать фолианты, изучать языки, и не проводить археологических раскопок. Напротив, это все приобретает еще большую значимость и ценность, поскольку усиливает выводы традиционных подходов в совокупности с выводами ДНК-генеалогии, при условии взаимного их согласования. Или, напротив, заставляет пересматривать, казалось бы, устоявшиеся выводы, если они входят в явное противоречие с данными ДНК-генеалогии.

Чтобы не говорить общими словами, приведем конкретный пример. На этом и последующих примерах будем иллюстрировать основные понятия и положения ДНК-генеалогии, или новой «молекулярной истории». Уже много десятилетий не смолкает дискуссия об аланах, и о том, кто же их современные потомки. Основные претенденты на потомков аланов - осетины и карачаево-балкарцы. Дискуссия давно ходит по кругу, оппоненты не могут убедить друг друга, поскольку приводимые антропологические, одонтологические, лингвистические данные более чем спорны, терминология весьма условна, и, как часто принято, оппоненты предпочитают одни данные, и фактически игнорируют другие. Альтернативные варианты практически не рассматриваются, поскольку так или иначе это «уступка оппонентам», цитирование источников избирательное. В общем, картина знакома любому, кто профессионально работает в науке. При этом все стороны согласны, что

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 56

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 57

средневековые северокавказские аланы появились на исторической арене в 1-4 вв. н.э., что они были исходно степняками, и пришли в южнорусские степи из Центральной Азии (как варианты - скифы, сарматы и массагеты, то есть тохаро-усуне-кангюйские племена Приаралья). После начального периода донской Алании в первые века н.э. часть алан ушла на Кавказ и вместе с местными кавказскими племенами образовали Аланию между Кубанью и Тереком. В середине 8-го века северокавказские аланы переселились в бассейн Среднего Дона, возможно, под давлением (военным или политическим) хазар, образовав (или войдя в) салтово-маяцкую культуру. После разгрома их «татаро-монголами» (это - собирательный образ тюркского нашествия со стороны Центральной Азии) они опять ушли в горы Кавказа и там, видимо, ассимилировались местными племенами, которые и могли постепенно трансформироваться в современных карачаево-балкарцев и/или осетин. Это - почти консенсусные представления.

Поскольку карачаевцы говорят на тюркских языках (половецко-кипчакская подгруппа), а осетины - на индоевропейских (восточная подгруппа иранской группы индоиранской ветви), то вопрос о языке алан тоже остается дискуссионным, и общей дискуссии практически не помогает.

Рассмотрим, какую роль в этом вопросе может сыграть ДНК-генеалогия. В качестве исходного (или дополнительного) материала, который более традиционные науки предоставить не могли, рассмотрим родовой состав карачаево-балкарцев и осетин. Род в понятиях ДНК-генеалогии - это гаплогруппа, которая, в свою очередь, расходится на субклады, которые можно поставить в соответствие племенам, кланам, подгруппам и так далее, причем в основе каждого родового подразделения был общий предок, патриарх рода, племени, клана, и мутации в его ДНК (в Y-хромосоме, то есть в мужской половой хромосоме) несут все его прямые потомки по мужской линии. Речь здесь идет о необратимых мутациях в Y-хромосоме, называемых «снипами» (калька с англоязычного сокращения SNP, то есть Single Nucleotide Polymorphism). Y-хромосома - единственная из хромосом (в мужском организме), которая практически полностью копируется в ДНК потомков (именно поэтому выше был использован термин «нерекомбинантная»). Как результат, потомки несут в своих ДНК сотни тысяч и миллионы необратимых мутаций от всех прямых предков, включая общего предка с шимпанзе примерно 5.5 миллионов лет назад, включая - намного позже - патриарха своей гаплогруппы, то есть главного рода, и далее, переходя к нашему времени, вплоть до мутаций, унаследованных с Y-хромосомой своего биологического отца.

Всего насчитывают 20 принципиальных гаплогрупп, то есть основных родов человечества, от А до Т, хотя к ним в последние годы добавились еще две гаплогруппы (африканские A0 и A00), а также были идентифицированы промежуточные, сводные гаплогруппы, такие, как СТ, DE, GHIJK и другие (см. диаграмму ниже), так что минимальный состав генеалогического дерева мужской половины человечества включает уже 37 основных гаплогрупп, то есть главных

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 57

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 58

уровней Y-хромосомного генеалогической структуры. С основными подгруппами это составляет уже много сотен. Если же считать все уровни генеалогического дерева (уровень в этом случае - это субклад), то гаплогруппа R1a, основная гаплогруппа (род) этнических русских, уже насчитывает 43 субклада, гаплогруппа R1b - 177 субкладов, и это при том, что на диаграмме ниже они обе входят в сводную гаплогруппу R, которой примерно 30 тысяч лет со времени образования. Образовалась она при появлении необратимой мутации в виде спонтанного превращения одного нуклеотида в другой в ДНК (Y-хромосоме) патриарха, или его выжившего потомка, в свою очередь потомки которого дожили до настоящего времени в количестве нескольких миллиардов человек. Если точнее, то у него, патриарха гаплогруппы R, по сравнению с ДНК его отца (относящегося к гаплогруппе Р) произошло спонтанное превращение аденина в гуанин, и это произошло в участке Y-хромосомы под номером 15 миллионов 581 тысяч 983. Всего же в Y-хромосоме мужчин насчитывается примерно 58 миллионов нуклеотидов.

Ствол древнего генеалогического дерева человека

A00

L1284

A0-T L1085

A0 L991

A1 V168

A1a A1b M31 P108, V221

i Ub1 L419

BT M91 B M60 CT M168

DE M145 D M174 E M96 CF P143 C M130 F M89 GHIJK M1329 G M201 HlJK M578 H L901 IJK M523 IJ M429 @ M170

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 58

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 59

K

I M304 M9

LT L298

M61 M184 K(xLT) M526 M P256 NO M214

M231

M175

P M45 Q M242 R M207 M230

Теперь мы можем вернуться к карачаево-балкарцам, осетинам и аланам, и узнать, кто от кого произошел, и когда жили их патриархи, пусть не самые первые в их гаплогруппе, но те их древние потомки, от которых перечисленные группы произошли по прямой генеалогической линии.

Оказалось, что основные гаплогруппы-рода осетин следующие:

G2a 70%

J2a 14%

R1b 7%

Прочие 9% (единичные примеры гаплогрупп С, E1b, I2c, J1, L1b, Q1a, R1a, T1a). Здесь надо указать, что происхождение всех основных трех родов-гаплогрупп разное. G2a в принципе могли придти из Европы (как потом будет показано, это не так), потому что скелетные останки носителей этой гаплогруппы (G2a-P15) десятками находят в захоронениях Западной и Центральной Европы - Испании, Франции, Германии с датировками 7000-5000 лет назад. J2a пришли из Месопотамии, начиная с 7000 лет назад, когда начались активные (в первую очередь, урукские) миграции на север. R1b прибывали из Центральной Азии, первые волны миграции на Кавказ и далее на Ближний Восток были примерно 7000-6000 лет назад (основной субклад R1b-L23); затем, в относительно недавнее время, уже в нашей эре, были прибытия тюркоязычных племен из Центральной Азии, часть которых несли субклад R1b-M73. С ними увлекались и носители минорных (в настоящее время) гаплогрупп в Осетии, перечисленных выше, часть которых попадали на Кавказ и позже, вплоть до настоящего времени, разными путями.

Если посмотреть отдельно на данные по дигорцам и иронцам, то у первых 60% G2a, у вторых - 74% G2a (эти данные получены по «академическим» выборкам). Надо отметить, что приведенные данные воспроизводимы по разным выборкам, как

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 59

№ 1 (2015)___________________ИСТОРИЧЕСКИЙ ФОРМАТ____________________стр. 60

«академическим», так и «коммерческим», что, в частности, показывает величина 70% для гаплогруппы G2a у осетин из комерческой выборки международного Проекта FTDNA, без подразделения на дигорцев и иронцев. Ясно, что при увеличении количества тестируемых некоторые подвижки в долях гаплогрупп возможны, но они определенно не будут принципиальными.

Основные гаплогруппы карачаево-балкарцев:

R1a 32%

G2a 29%

J2a 13%

R1b 8%

I2 7%

Q 5%

Прочие 6% (единичные примеры гаплогрупп E1b, J1, T1a).

Мы уже видим, что родовой состав осетин и карачаево-балкарцев принципиально различается, и если аланы и были в предках тех и других, то были только частично и в разной степени, хотя у осетин их потомками могли бы быть до трех четвертей от всего мужского населения (ниже будет показано, что это не так). Здесь надо указать, что R1a у карачаево-балкарцев имеет дочернее арийское, то есть скифское происхождение, на что указывает их основной субклад R1a-Z93-L342.2-Z2123. Их братья, относящиеся к субкладу R1a-Z93-L342.2-L657 ушли в Индию в середине II тыс. до н.э.; их предки, относящиеся к субкладу R1a-Z93-L342.2-Z2124, ушли позже в историческую Бактрию (и пуштуны, имеющие этот субклад, Z2124, живут там сейчас, это их основной субклад, который имеют половина всех пуштунов Афганистана и Пакистана); наконец, кавказские носители субклада Z2123, дочернего от Z2124, и составляют треть карачаево-балкарцев, но у осетин их практически нет.

Если у алан была преимущественно гаплогруппа R1a, то их потомки - треть карачаево-балкарцев, на осетин же алан не остается, у осетин гаплогруппы R1a всего 0.85%, поскольку при массовом тестировании обнаружились только единицы носителей этой гаплогруппы. Если же у алан была гаплогруппа G2a, то они могли быть предками трети карачаевцев-балкарцев или до трех четвертей осетин. Здесь не случайно поставлено «или», потому что вопрос, увы, стоит так - или карачаевцы, или осетины. И вот почему - об этом говорит следующий вывод, полученный при изучении гаплотипов карачаево-балкарцев и осетин: общий предок гаплогруппы G2a1 у карачаево-балкарцев и осетин жил очень давно, примерно 4675 лет назад. Поэтому он не мог быть аланом, просто по определению. Об этом более подробно ниже.

Мы впервые в данной статье упомянули понятие «гаплотип». Гаплотип - это серия чисел (аллелей), отражающая совокупность повторов в локусах, или маркерах Y-хромосомы. В Y-хромосоме человека есть повторяющиеся участки нуклеотидов, например, четверка нуклеотидов AGAT, то есть аденин-гуанин-аденин-тимин

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 60

№ 1 (2015)_______________ИСТОРИЧЕСКИЙ ФОРМАТ________________стр. 61

GTGGTCTTCTACTTGTGTCAATAC/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ AGAT/

ATGTATGTCTTTTCTATGAGACATA C CTCATTTTTTGGACTTGAGTTC

и эти повторы обрамляются уже неупорядоченными последовательностями нуклеотидов в ДНК, как показано выше. В данном случае эта четверка повторяется 14 раз. Этот маркер, в котором повторяется AGAT, называется DYS393. Он по определенным стандартам записывается первым. Вторым записывается число повторов в маркере DYS390, и там повторяется уже другая четверка, TCTG, то есть тимин-цитозин-тимин-гуанин, которая переходит в четверку TCTA, то есть тимин-цитозин-тимин-аденин, и число повторов складывается:

TATATTTTACACATTTTTGGGCCCTGCATTTTGGTACCCCATAATATATTCTATCTA/

TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTA/TCTA/TCTA/TCTA/TCTA/

TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTG/TCTA/TCATCTATCTATCTTTCCT

TGTTTCTGAGTATACACATTGCAATGTTTTCATTTTACTGTCAC

В данном случае четверка повторяется 22 раза.

Перечисленные и многие другие варианты четверок нуклеотидов — это язык ДНК, который состоит из этих четырех слов, или четырех букв, при сокращенной записи (A, G, C, T). Эти нуклеотиды комбинируются парами, их так и называют — «пары оснований». Они фактически держат двойную спираль ДНК. Таким образом, гаплотип — это, по сути, цепочка чисел, показывающих число повторов в определенных маркерах. Маркеры можно выбирать любые из многих сотен или даже тысяч. Но есть определенные стандарты, которые регламентируют (впрочем, довольно условно) порядок маркеров при записи и число маркеров в гаплотипе. Вот так выглядит записанный по этим стандартам предковый (его в ДНК-генеалогии называют базовым) гаплотип карачаево-балкарцев субклада G2a1-L293 (это у них доминирующий субклад) в 67-маркерном формате:

14 22 15 10 15 16 11 12 11 12 10 29 - 17 9 9 11 11 25 16 21 29 13 13 14 14 - 10 10 20 21 15 15 15 18 36 38 11 10 - 11 8 15 16 8 11 10 8 12 10 12 21 22 14 10 12 12 15 8 13 21 22 16 13 11 13 10 11 11 13 (карачаево-балкарцы, G2a1)

Он значительно отличается от базового гаплотипа осетин в том же субкладе (изменения выделены в обоих гаплотипах), между ними - 14 мутаций:

14 23 15 9 15 17 11 12 11 11 10 28 - 17 9 9 12 11 25 16 21 28 13 13 14 14 - 11 11 19 21 15 15 16 18 37 38 12 9 - 11 8 15 16 8 11 10 8 12 10 12 21 22 14 10 12 12 15 8 13 21 22 15 13 11 13 10 11 11 13 (осетины, G2a1)

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 61

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 62

14 мутаций - это очень много. Это означает, что за время, прошедшее от общего предка карачаевцев и осетин, а общий предок непременно был, потому что субклад у них один и тот же, а субклад - это фактически племя, с патриархом, от которого племя пошло - за это время между двумя ДНК-линиями прошло несколько тысяч лет, больше ста поколений. А аланы жили в нашей эре, несколько десятков поколений назад. От алан эти ДНК-линии так далеко не разошлись бы.

У человека, неискушенного в ДНК-генеалогии, тут же возникает вопрос -откуда узнали, что эти два гаплотипа - именно предковые гаплотипы карачаево-балкарцев и осетин данной гаплогруппы? Ответ простой - на это есть уже отработанная система знаний. Мутации в гаплотипах потомков расходятся от предкового гаплотипа как круги по воде, число мутаций легко рассчитывается, и они подчиняются довольно простым количественным закономерностям. Для кругов на воде, расходящихся от места, куда был брошен камень, легко рассчитать, когда был брошен камень, если знать скорость распространения волны и место нахождения круговой волны в данный момент времени. Чем больше прошло времени - тем дальше круги ушли, тем больше они разошлись. Так и в гаплотипах - чем больше время, прошедшее от общего предка, тем больше мутаций накопилось в гаплотипах его потомков. Число этих мутаций связано со временем, прошедшим от общего предка, с числом гаплотипов в серии и с константой скорости мутации в гаплотипах, и выражается простой формулой: n/N = kt, где n - число мутаций в серии из N гаплотипов, k - константа скорости мутации (в числе мутаций на гаплотип за условное поколение, равное 25 лет), t - число условных поколений, с табличной поправкой на возвратные мутации (Klyosov 2009а). На сотнях и тысячах примеров показано, что эта формула работает при любом числе гаплотипов и мутаций в них, и при любом времени, прошедшем от общего предка рассматриваемых гаплотипов. Однако при очень больших временах, более 10-20 тысяч лет, и особенно более 100 тысяч лет, нужно использовать гаплотипы с «медленными» маркерами, то есть с малыми константами скоростей мутаций, и тем самым снижать число мутаций и число возвратных мутаций. По аналогии, вряд ли целесообразно изучать скорости радиоактивного распада элементов со временами полураспада в тысячелетия, используя секундомер. Или пытаться изучать круги на воде за километры от места, куда был брошен камень, для этого нужно значительно более мощное воздействие. Как всегда, нужен конкретный анализ в конкретной ситуации, единых подходов на все случае жизни не бывает. Варианты конкретного анализа в конкретных ситуациях и рассматривает ДНК-генеалогия. Некоторые ситуации и расчеты мы расмотрим.

Как мы видим, мутации в ДНК-генеалогии - это не только единичные необратимые мутации-снипы, описанные выше, которые определяют гаплогруппы и субклады, но и обратимые мутации, меняющие числа повторов, или аллели, в гаплотипах. В русскоязычной литературе их называют просто «мутации», с пониманием, что это не те мутации (в генах), которые обычно возникают под действием радиации. Переход числа повторов в маркере Y-хромосомы от 22 к 23

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 62

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 63

(или наоборот, см. выше) имеет совершенно иную природу, чем «поломка» гена. Такой переход является следствием спонтанной ошибки ДНК-копирующей «биологической машины», это «процесс первого порядка» с точки зрения физикохимической кинетики, он не зависит от внешних воздействий. У предка карачаево-балкарцев в данной гаплогруппе второе число указывает на 22 повтора четверки TCTG/TCTA, у предка осетин - 23 повтора в том же маркере. Это - характерные метки в их Y-хромосомах. С тех пор, со времен общего предка, большинство карачаево-балкарцев продолжает иметь в этом маркере 22, большинство осетин - 23. В итоге - 14 расхождений между их предковыми гаплотипами к нашему времени, и в будущем расхождения будут продолжаться.

Если взять, например, по сотне 67-маркерных гаплотипов современных карачаево-балкарцев и осетин субклада G2a-L293, то у первых на всю сотню приходится 1884 мутации, у вторых - всего 624 мутации от показанных базовых гаплотипов. Уже ясно, что вторая популяция, осетины, моложе, разошлись от патриарха на меньшее число мутаций. Расчеты показывают, что общий предок карачаево-балкарцев жил 1884/100/0.12 = 157 ^ 186 условных поколений (по 25 лет каждое) назад, то есть 4650±750 лет назад; здесь 0.12 - константа скорости мутации в 67-маркерных гаплотипах, как описано выше. Общий предок осетин жил 624/100/0.12 = 52 -> 55 условных поколений, то есть 1375±210 лет назад. Если бы осетины и карачаевцы произошли от одного общего предка, то есть их предков разделяли бы примерно (4650 - 1375) = 3275 лет, то это было бы эквивалентно x мутациям между их предковыми гаплотипами, где x/0.12 = 3275 лет, то есть 131 условных поколений без поправки на возвратные мутации, или 115 поколений (получаемых из таблицы, опубликованной в работе [Klyosov, 2009a]). Получаем x/0.12 = 115, и х = 13.8 мутаций, вычисленных теоретически. На самом деле, наблюдается 14 мутаций, то есть теория подтверждается практикой. Эти 14 мутаций мы и наблюдаем между предковыми (базовыми) гаплотипами карачаево-балкарцев и осетин.

Можно считать и по-другому. 14 мутаций между базовыми гаплотипами карачаево-балкарцев и осетин гаплогруппы G2a1 разводят их общих предков на 14/0.12 = 117 -> 133 условных поколения (по 25 лет каждое), то есть примерно на 3325 лет. Поскольку независимые расчеты по числу мутаций во всей совокупности гаплотипов показывают, что общий предок современных карачаево-балкарцев гаплогруппы G2a1 жил 4650±750 лет назад, а осетин той же гаплогруппы - 1375±210 лет назад, примерно в 7 веке нашей эры, плюс-минус пара веков, то это помещает общего предка карачаево-балкарцев и осетин в данном субкладе-гаплогруппе примерно на (4650+1375+3325)/2 = 4675 лет назад, что и был общий предок карачаево-балкарских гаплотипов в пределах погрешности расчетов. Отклонение в 25 лет - это 0.5%.

Итак, и карачаево-балкарцы, и осетины произошли от общего предка, который жил примерно 4650 лет назад. Это вряд ли аланы, их тогда еще не было. Но

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 63

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 64

это не может быть названо решением вопроса, от кого произошли карачаевцы и осетины, хотя решение в целом приближает. Можно вполне придумать схему, по которой от общего предка 4650 лет назад произошли карачаевцы и будущие аланы, и вторые породили осетин примерно 1375 лет назад, во вполне аланские времена. Тогда получалось бы, что карачаево-балкарцы повели свой род из далекой древности, не от алан, а осетины - недавно, примерно в VII веке н.э. (плюс-минус пара веков), от алан. Казалось бы, логично, но нехватает одного важного звена -гаплотипов самих алан, чтобы проверить эту гипотезу.

В принципе, если у (ископаемых) алан окажется гаплогруппа G2a, то это серьезно добавит вероятности (хотя добавит - это не значит, что решит прблему) происхождения большинства осетин именно от алан, поскольку основная линия осетин началась в аланские времена, примерно в VII веке нашей эры, плюс-минус пара веков. Для карачаево-балкарцев гаплогруппы G2a с их общим предком более четырех тысяч лет назад аланство в виде предков маловероятно, мягко говоря. Но если аланы окажутся R1a, то вероятность их быть предками для трети карачаевцев значительно возрастает. Для осетин тогда шансов для такого близкого родства с аланами не остается. Это - шаг к решению поставленной зачачи, но еще не её решение.

Для последующего шага привлечем два подхода: рассмотрим ископаемые европейские гаплотипы гаплогруппы G2a, и ископаемые гаплотипы донских алан. Первые были опубликованы четыре года назад (Lacan et al., 2011a, 2011b), вторые были любезно предоставлены В.В. Ильинским, научным директором ООО «Генотек» (Москва), и предварительное сообщение о работе недавно появилось в сборнике (Афанасьев и др. 2014).

Итак, в Европе, на юге Франции, нашли костные останки с гаплогруппой G2a-P15 (это - родительский субклад гаплогруппы G2a) и гаплотипом

14 23 15 10 13 15 11 12 11 18 - 18 16 20 11 14 10 21

(ископаемые G2a-P15, Франция, 5000 лет назад)

Это был наиболее частый гаплотип из двадцати, найденных в одном некрополе с датировкой 5000 лет назад (Lacan et al. 2011a). Если сопоставить соответствующие аллели ископаемого гаплотипа G2a с приведенными выше базовыми гаплотипами G2a1 карачаевцев и осетин (переведя их в 17-маркерный формат для корректного сравнения)

14 22 15 10 15 16 11 12 10 17 - 17 16 21 10 15 10 21 (карачаевцы, G2a1-L293)

14 23 15 9 15 17 11 11 10 17 - 17 16 21 11 15 9 21 (осетины, G2a1-L293)

то у них окажется 10-12 мутаций (отмечены) по сравнению с ископаемым гаплотипом.

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 64

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 65

Та же картина наблюдается и при сравнении и с ископаемым гаплотипом с северо-востока Испании, с датировкой 7000 лет назад (Lacan et al. 2011b). Из шести человек в захоронении пятеро оказались G2a. «Испанский» гаплотип гаплогруппы G2a также отличается на 10-12 мутаций от базовых гаплотипов карачаевцев и осетин.

13 23 15 10 14 14 11 12 11 17- 18 16 22 12 15 10 21

(ископаемые G2a-P15, Испания, 7000 лет назад).

Что дают в хронологическом отношении эти 10-12 мутаций в 17-маркерных гаплотипах? Они дают в среднем 11/0.034 = 324 -> 472 условных поколений расхождения между общими предками современных карачаево-балкарцев и осетин гаплогруппы G2a1-L293, с одной стороны, и ископаемыми французским и испанским гаплотипами - с другой, то есть в среднем на 11800±1500 лет. Это -огромные величины. На самом же деле носители данных ископаемых гаплотипов жили 5000 и 7000 лет назад. Это показывает, что осетинские и карачаево-балкарские гаплотипы происходят не непосредственно от показанных ископаемых гаплотипов группы G2a-P15 во Франции и Испании, а от какого-то другого общего предка, от которого осетинские и карачаево-балкарские гаплотипы разошлись примерно 4650 лет назад, и этот их общий предок, в свою очередь, давно, многие тысячелетия назад, разошелся с (ископаемыми) европейскими гаплотипами. Как бы там ни было, ясно, что ископаемые европейские гаплотипы - не прямые предки осетинских и карачаево-балкарских гаплотипов.

Переходим к ископаемым гаплотипам донских алан. В их захоронении в катакомбных некрополях Дмитриевский и Верхнесалтовский-IV совсем недавно были обнаружены гаплотипы, которые генетиками определены как принадлежащие мужской гаплогруппе G2 (Афанасьев и др. 2014). При более детальном рассмотрении результатов исследования оказалось, что гаплогруппа G2 не определялась, она предположена на основании рассмотрения фрагментов гаплотипов. Предположение при проверке оказалось разумным, только там скорее не G2, а G2a (см. ниже).

Определение проводилось в 12 костных образцах, в шести тестирование не получилось. В шести образцах, в которых тестирование дало положительные данные, в каждом пытались определить по 23 маркера, то есть попытка тестирования проводилась по 23х6 = 138 аллелям. Из них аллели были фактически определены в 45 случаях, то есть в трети аллелей. Это в целом нормально, поскольку в ископаемых образцах ДНК заметно деградируется, и всегда определяются только часть аллелей. Удача была в том, что эти 45 аллелей были неупорядоченно разбросаны по всем шести образцам, и это дало возможность реконструировать 17-маркерный гаплотип «внахлест». Он оказался следующим:

14 22 15 10 14 15 11 12 11 18 - 18 16 20 11 14 10 21

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 65

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 66

(ископаемые аланы, ~ 1250 лет назад).

«Внахлест» здесь означает, что ни в одном образце такой гаплотип не был определен, но его удалось реконструировать по перекрывающимся фрагментам всех шести образцов. Похоже, что у всех шести этот гаплотип был одинаковым, то есть все шестеро были довольно близкими родственниками.

Итак, на кого похож этот реконструированный гаплотип алан - на современных карачаево-балкарцев или на современных осетин? Или на предковый (то есть базовый) гаплотип тех или других? Поскольку базовый гаплотип осетин датируется временем 1375±210 лет назад, то есть в аланские времена, то можно ожидать практически полного его совпадения с ископаемым гаплотипом алан, если те аланы - предки современных осетин. Базовый гаплотип осетин гаплогруппы G2a1-L293 - следующий, в таком же 17-маркерном формате:

14 23 15 9 15 17 11 11 10 17 - 17 16 21 11 15 9 21 (осетины, G2a1-L293).

Увы, он совершенно не похож на ископаемый гаплотип донских алан, их разделяют 12 мутаций (выделены), что эквивалентно расхождению в 12/0.034 = 353 535 условных поколений, то есть в 13375 лет.

Сравним реконструированный гаплотип ископаемых алан с базовым гаплотипов карачаевцев:

14 22 15 10 15 16 11 12 10 17 - 17 16 21 10 15 10 21 (карачаевцы, G2a1-L293).

И он совершенно непохож на ископаемый гаплотип донских алан, их разделяют 8 мутаций, что эквивалентно 8/0.034 = 235 306 условных поколений, то

есть 7650 лет.

Здесь даже нет смысла обсуждать, кто из них, карачаевцы или осетины, ближе к ископаемому гаплотипу, они оба далеко, поскольку их должны разделять с аланами всего 1000-1500 лет. Значит, первый вывод таков: основное мужское население как карачаевцев, так и осетин (доминирующей гаплогруппы G2a1-L293) к донским аланам практического отношения не имеют. Те - не их предки. И здесь не имеет значения, G2 у ископаемых алан, или G2a, или что еще. Они совершенно отличаются от гаплотипов осетин и карачаево-балкарцев.

Посмотрим на минорный субклад G2a2b2a-P303 у осетин и карачаево-балкарцев. Их базовые гаплотипы

14 23 15 10 13 14 11 12 11 17 - 16 16 20 12 16 10 21 (осетины G2a-P303)

14 22 15 10 14 15 12 12 11 17 - 16 16 21 11 16 10 21 (осетины G2a-P303 другая ветвь)

14 23 15 10 13 14 11 12 11 17 - 16 16 20 11 16 10 21 (карачаево-балкарцы G2a-P303)

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 66

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 67

Опять ни один из них не может претендовать на родство с аланами (мутации выделены), для чего гаплотипы должны отличать всего одна-две мутации, потому что две мутации транслируются в 2/0.034 = 59 63 условных поколения, или 1575 лет

разницы, примерно V век н.э. для предка; одна мутация - 29 30 поколений, или

750 лет разницы, XIII век для предка. Однако во всех трех случаях мы имеем не 1-2, а 9, 7 и 8 мутаций, соответственно, что разводит ископаемых алан, с одной стороны, и современных осетин и карачаево-балкарцев гаплогруппы G2a-P303, с другой, примерно на 9000, 6500 и 7700 лет, соответственно. Не могли они происходить от алан.

Очередной из имеющихся в нашем распоряжении вариантов - сравним ископаемый гаплотип алан с ископаемыми гаплотипами гаплогруппы G2a-P15 Франции и Испании с датировками 5000 и 7000 лет назад, соответственно:

14 23 15 10 13 15 11 12 11 18 - 18 16 20 11 14 10 21 (Франция, 5000 лет назад)

13 23 15 10 14 14 11 12 11 17 - 18 16 22 12 15 10 21 (Испания, 7000 лет назад)

14 22 15 10 14 15 11 12 11 18 - 18 16 20 11 14 10 21 (ископаемые аланы, ~1250 л. н.)

Результат оказался неожиданным: в первом случае - всего две мутации разницы. Это даже меньше, чем ожидалось, исходя из археологических датировок. Но в любом случае ясно, что гаплотип ископаемых алан (~1250 лет назад) примерно такой же, как и ископаемый «французский» (5000 лет назад), и гаплогруппа одна -G2a. Во втором случае, «испанском», 8 мутаций разницы, то есть примерно 7650 лет между ними, на самом деле археологические датировки дают около 6000 лет разницы, то есть в первом случае некоторый недобор, во втором - перебор, но ясно, что при сравнении всего двух гаплотипов это все в пределах погрешности расчетов.

Итак, загадка многих десятилетий близка к решению. Ни осетины, ни карачаево-балкарцы гаплогруппы G2a1, основной у тех и других (треть у карачаево-балкарцев, вторая треть - гаплогруппа R1a), не являются потомками алан, во всяком случае, донских алан. Но ведь именно их, донских алан, историки направляют с Северного Кавказа на Дон, говоря, что на Кавказе они стали предками то ли осетин, то ли карачаево-балкарцев, то ли тех и других. Оказывается, что ни тех и ни других. У них обоих другое происхождение, во всяком случае, в гаплогруппе G2a. Гаплогруппы R1a у осетин практически нет. Значит, опять иное происхождение. Ни по одной основной гаплогруппе, то есть ни по G2a, ни по R1a, осетины и карачаево-балкарцы не пересекаются, во всяком случае, в аланские времена.

Продолжим наши поиски, и рассмотрим гаплотипы группы G в исторической Бактрии. На рис. 1 приведено так называемое дерево гаплотипов для 63 наших современников с территории исторической Бактрии (этнические отнесения по свидетельству самих тестируемых приведены на том же рисунке). Это дерево построено с помощью профессиональных программ PHYLIP (the PHYLogeny Inference Package) и MEGA (Molecular Evolutionary Genetics Analysis), которые

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 67

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 68

распределяют гаплотипы в виде иерархического дерева по принципу максимально вероятного происхождения гаплотипов друг из друга.

Дерево гаплотипов гаплогруппы G в Бактрии выявляет две основные ветви -правая, исключительно субклада G2b1-M377, относительно недавняя (из 27 гаплотипов), и левая, древняя (из 36 гаплотипов), состоящая из серии субкладов, из которых 8 гаплотипов субклада G2a-P15, 18 гаплотипов субклада G2a-P303, 4 гаплотипов субклада G1-M285, остальные гаплотипы единичные. Базовые гаплотипы ветвей, соответственно, следующие:

13 23 16 11 13 16 11 13 11 17 - 19 16 21 11 16 10 24 (правая ветвь)

13 22 15 10 15 16 12 12 11 17 - 18 16 21 11 15 10 21 (левая ветвь, группа G2a)

Дерево из 63 гаплотипов гаплогруппы G2 Бактрии в 17-маркерном формате (гаплотипы собраны в базах данных и предоставлены ИЛ. Рожанским). Возраст правой ветви (субклад G2b1-M377) 2400+360 лет. Общий возраст левой ветви 14400+3200 лет, ее группы гаплотипов субклада G2a-P15 10650+1600 лет.

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 68

№ 1 (2015)____________________ИСТОРИЧЕСКИЙ ФОРМАТ______________________стр. 69

В ветви справа на все 27 гаплотипов приходится 80 мутаций, что дает 80/27/0.034 = 87 -> 96 условных поколений, или 2400±360 лет до общего предка. В левой ветви на 8 гаплотипов субклада G2a-P15 приходится 82 мутации, что дает 82/8/0.034 = 301 426 условных поколений, или 10650±1600 лет. Но ветвь справа нас в

данном случае не интересует, у нее не тот субклад, который найден у карачаево-балкарцев, осетин и алан. Между гаплотипами ветви справа, с одной стороны, и кавказцев и донских аланов, с другой, 15-17 мутаций, то есть 19-23 тысячи лет. А вот ветвь слева похожа на то, что мы ищем. Сравним ее предковый гаплотип (субклада G2a) с предковыми гаплотипами карачаево-балкарцев и осетин, и отметим мутации:

14 22 15 10 15 16 11 12 10 17 - 17 16 21 10 15 10 21 (карачаевцы, G2a1-L293)

14 23 15 9 15 17 11 11 10 17 - 17 16 21 11 15 9 21 (осетины, G2a1-L293)

От бактрийских G2a карачаевцев отличает пять мутаций, что эквивалентно примерно расстоянию в 4300 лет. Как мы помним, общий предок карачаево-балкарцев жил 4650±750 лет назад, что совпадает в пределах погрешности расчетов. Общий предок осетин той же гаплогруппы жил всего 1375±210 лет назад, то есть он более отдален от бактрийского общего предка. Действительно, там дистанция в 9 мутаций, что эквивалентно расстоянию примерно в 9000 лет от бактрийского общего предка. Расчеты дают, что общий предок осетин с бактрийцами гаплогруппы G2a жил (9000+1375+10650)/2 = 10500 лет назад, что практически сопадает с расчетами выше (10650 лет назад). Наконец, гаплотип донских алан

14 22 15 10 14 15 11 12 11 18 - 18 16 20 11 14 10 21

(ископаемые аланы, ~1250 лет назад)

отличается от бактрийского базового гаплотипа той же гаплогруппы на 7 мутаций, что эквивалентно 7/0.034 = 206 258 условных поколений, или примерно

6450 лет. Это дает (6450+10650)/2 = 8550 лет от времени жизни ископаемых донских алан до бактрийских G2a, или (прибавив ~1250 лет до времени жизни ископаемых донских алан) около 10 тысяч лет от настоящего времени. Это тоже, в целом, находится в пределах погрешности расчетов.

Итак, мы получаем следующую картину древних миграций носителей гаплогруппы G2a, начиная с тех времен, когда примерно 10 тысяч лет назад носители этой гаплогруппы ушли в Европу, и их недавно обнаружили в древних некрополях Испании и Франции с датировками 7 и 5 тысяч лет назад, соответственно. Их гаплотипы, отнесенные исследователями к субкладу G2a-P15, приведены выше. В середине III тыс. до н.э., то есть примерно 4500 лет назад, в Европе произошли некие драматические изменения, в результате которых большинство гаплогрупп «старой Европы» исчезли, и их выжившие носители и их потомки переместились в периферийные регионы Европы (Британские острова, Скандинавия, Балканы), в

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 69

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 70

Малую Азию. В Европе осталась преимущественно гаплогруппа R1b, носители которой, эрбины, в те времена в виде культуры колоколовидных кубков активно заселяли Европу, начиная примерно с 4800 лет назад, то есть с начала III тыс. до н.э. По-видимому, в те времена группа потомков «французских» носителей этого субклада ушли на восток, и в итоге стали донскими аланами. Общий предок ископаемых донских алан жил примерно 2850 лет назад, то есть в начале I тыс. до н.э.

Как уже показано, гаплотип ископаемых донских алан всего на две мутации отличается от ископаемых «французских» гаплотипов с датировкой 5000 лет назад. К кавказским гаплотипам, в том числе к предкам современных осетин и карачаево-балкарцев, ископаемые донские аланы прямого отношения не имели, и если имели - то только через бактрийских носителей субклада G2a многие тысячелетия назад.

Тем временем, примерно 4500 лет назад, из древней Бактрии пошли две ДНК-линии субклада G2a, которые в итоге стали предковыми линиями современных карачаево-балкарцев и осетин. Они не происходят от ископаемых донских алан, и отделены от них на многие тысячелетия миграционного пути от древней Бактрии через Европу и обратно в донские степи. Неясно, побывали ли предки ископаемых донских аланов на Кавказе, и если к этому есть соображения, их имеет смысл внимательно рассмотреть, и, возможно, пересмотреть.

Недавно вышла статья про распределение гаплогрупп у современных пуштунов в Пакистане (Lee et all. 2014), в которой из 270 гаплотипов 38 (14% от всех) были гаплотипы гаплогруппы G. Дерево гаплотипов, построенное по этим данным, приведено на рис. 2. В использованном авторами 21-маркерном формате базовый гаплотип верхней ветви выглядит следующим образом:

13 23 16 11 13 16 12 11 13 11 17 - 20 24 16 21 28 12 16 10 17 24 (верхняя ветвь, рис.2)

что в переводе в более стандартный 17-маркерный гаплотип имет вид:

13 23 16 11 13 16 11 13 11 17 - 20 16 21 12 16 10 24 (пуштуны в Пакистане).

Этот пакистанский гаплотип пуштунов близок к базовому гаплотипу, который описывает правую ветвь бактрийских 17-маркерных гаплотипов группы G2b1-M377 возрастом 2400±360 лет:

13 23 16 11 13 16 11 13 11 17 - 19 16 21 11 16 10 24 (правая ветвь, рис. 1)

Между ними всего две мутации (отмечены), что разводит времена жизни общих предков этих ветвей в Пакистане и в Бактрии на 2/0.034 = 59 63 условных

поколений, то есть на 1575 лет. Надо принять во внимание, что на 33 гаплотипа верхней ветви на рис. 2 (в 21-маркерном формате) приходится 66 мутаций, что дает 66/33/0.0475 = 42 -> 44 условных поколений, то есть общий предок этих 33 гаплотипов

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 70

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 71

жил 1100±175 лет назад. Поэтому общий предок этих двух ветвей, справа на рис. 1 и сверху на рис.2, жил (2400+1100+1575)/2 = 2540 лет назад. Это и есть общий предок бактрийских гаплотипов группы G2b1-M377, который жил 2400±360 лет назад. Его потомки через тысячу с лишним лет прибыли из Бактрии в Пакистан и со временем образовали пакистанских пуштунов. Но в любом случае эти гаплотипы на многие тысячелетия удалены от гаплотипов карачаево-балкарцев и осетин, и удалены не только по времени, но и по основному субкладу (который у последних преимущественно G2a1-L293).

Дерево из 38 гаплотипов (в 21-маркерном формате) гаплогруппы G среди пакистанских пуштунов. Возраст верхней ветви 1100±175 лет, нижней ветви - 9150±1500 лет. Построено по данным, приведенным в работе (Lee et al., 2014)

Поэтому обратимся к явно древней нижней ветви на рис. 2. В ней всего пять гаплотипов, с базовым

13 22 15 10 14 16 12 12 12 11 17 - 17 23 16 22 29 11 15 10 17 21,

что в переводе в более стандартный 17-маркерный гаплотип имет вид:

13 22 15 10 14 16 12 12 11 17 - 17 16 22 11 15 10 21 (нижняя ветвь на рис. 2)

Поскольку на все пять гаплотипов имеется 64 мутации (от показанного верхнего базового 21-маркерного гаплотипа), то их общий предок жил 64/5/0.0475 = 269 366 условных поколений, или 9150±1500 лет назад. Сравним три базовых

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 71

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 72

гаплотипа - карачаево-балкарский, древний бактрийский, и древний пуштунский из Пакистана:

14 22 15 10 15 16 11 12 10 17 - 17 16 21 10 15 10 21 (карачаевцы, G2a1-L293)

13 22 15 10 15 16 12 12 11 17 - 18 16 21 11 15 10 21 (древняя, левая ветвь, рис. 1)

13 22 15 10 14 16 12 12 11 17 - 17 16 22 11 15 10 21 (древняя, нижняя ветвь, рис. 2)

Видно, что бактрийский (с возрастом 10650±1600 лет) и пакистанский (9150±1500 лет) различаются всего на три мутации, но это визуально, на самом деле там разница в 2.0 мутации, поскольку в столь малом наборе из пяти гаплотипов мутации дробные. Это дает разницу в 2/0.034 = 59 63 условных поколений, то есть

на 1575 лет), что помещает их общего предка примерно на (10650+9150+1575)/2 = 10700 лет назад. Это и есть бактрийский общий предок. Таким образом, картина времен и направлений мутаций носителей субклада G2a1, приведенная выше, не меняется при дополнительном расмотрении пакистанских (пуштунских) гаплотипов, она остается той же.

Поскольку выше мы описали подходы популяционной генетики в весьма критическом ключе, расмотрим, насколько справедлива эта критика в отношении статьи (Lee et al. 2014), поскольку статья совсем недавняя и отражает современные подходы популяционной генетики. Какие же главные выводы сделали авторы из опубликованного ими материала? Помогает то, что авторы приложили к статье список highlights, то есть главных выводов. Их - пять: (1) определили гаплотипы для 270 человек, (2) «дискриминационная способность» для 230 гаплотипов из всех 270 была равна 85.2%, (3) три маркера, DYS446, DYS447 and DYS449, были основными в отношении «увеличения дискриминации», (4) доминирующая гаплогруппа среди пакистанских пуштунов была R1a1a, (5) предками пакистанских пуштунов вряд ли были евреи.

Резюме к статье добавляет, что (1) каждый маркер показывает «разнообразие» от 0.2506 до 0.8538, (2) «дискриминационная способность» для 17-маркерных гаплотипов была равна 73.7%, и при увеличении их длины возросла до 85.2%, (3) для получения информации о происхождении пуштунов сравнили носителей гаплогрупп G и Q у пуштунов и евреев (ашкенази и сефардов), но еврейского происхождения пуштунов особенно не обнаружили («little support for a Jewish origin could be found»). Все эти «разнообразия маркеров» считаются без разделения соответствующих гаплотипов на гаплогруппы, и на круг по выбранным 199 гаплотипам «разнообразие» получилось равно 0.9903, а по 230 гаплотипам оно было равно 0.9968. Ни для чего больше эти цифры в статье не использовались, датировки не считались. Да и не могли считаться, потому что для них все гаплогруппы «сваливались в кучу». Никакого практического, и тем более теоретического смысла все эти арифметические упражнения не имели и иметь не могут. Смысл там исключительно описательный, что увидели, то и записали.

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 72

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 73

Автор настоящей статьи уделяет этим довольно бессмысленным подходам «популяционной генетики» так много внимания, потому что в очередной раз предостерегает историков не связываться с этой «наукой». Иначе заблуждения и искажения неизбежны. Совершенно очевидно, что никакого отношения к «молекулярной истории» подходы популяционной генетики не имеют.

Возвращаемся к «молекулярной истории». Как показано выше, гаплогруппа G2a у карачаево-балкарцев и осетин принесена из другого, не донского-аланского источника, а скорее из региона исторической Бактрии. Более того, гаплогруппа G2a у обеих народностей значительно расходится, и имеет общего предка, который жил примерно 4675 лет назад, опять же, скорее всего, в Бактрии. Но язык у карачаево-балкарцев и осетин разный, у первых тюркский, у вторых индоевропейский, с заметным влиянием местного субстрата. А далекий предок - один и тот же. Иначе говоря, языки здесь - не аргумент в дискуссии о происхождении осетин и карачаево-балкарцев. У кого-то из них язык изменился за последние тысячелетия, возможно, что и у обоих народов.

Поэтому для (почти) окончательного решения вопроса нужно будет провести тестирование на ДНК предполагаемых алан из других могильников, а также провести тестирование как минимум половцев из сответствующих захоронений, и сопоставить их гаплотипы с карачаевскими и осетинскими. Половцы со своей возможной гаплогруппой R1a (или другие степняки с той же гаплогруппой) выдвигаются на предпочтительных кандидатов на происхождение трети карачаево-балкарцев. Но половцы предпочтительнее, потому что, по историческим сведениям, то ли 40 тысяч (исторические сведения), то ли 5 тысяч (интерпретация) половцев ушли на Кавказ (Плетнева 1990). Про других степняков, не половцев, таких сведений нет.

Описанная выше картина миграций согласуется с расчетами ДНК-генеалогии - и с общими предками субклада G2a в Бактрии более 10 тысяч лет назад, и с расстоянием во времени между бактрийскими общими предками и ископаемыми аланами, примерно равным 8550 лет, и миграцией древних носителей G2a в Европу в те времена, и с датировкой «испанских» и «французских» носителей G2a 7000 и 5000 лет назад, и с возвращением потомков части «французских» носителей G2a на восток, в донские степи, с их общим предком в начале II тыс. до н.э., и с датировками ископаемых донских алан примерно в VIII веке н.э., и с приведенным выше гаплотипом алан. А также с тем, что карачаевцы и осетины имеют очень удаленные от ископаемых алан гаплотипы, отличающиеся на 8-12 мутаций, притом, что с древними бактрийцами той же гаплогруппы их разделяют меньшее число, а именно 5-9 мутаций. С этим же согласуется удаление базовых гаплотипов карачаево-балкарцев и таковых для осетин от их общего предка примерно на 4675 лет. Конечно, из этой ситуации можно выйти таким образом, что провозгласить древних бактрийцев гаплогруппы G2a 4500 лет назад «аланами», и заключить, что и

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 73

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 74

карачаево-балкарцы, и осетины произошли 4675 лет назад от «аланов», и на этом вопрос закрыть. Автор этой статьи оставляет такую возможность историкам.

Таким образом, становится понятным смысл нового термина - «молекулярная история», т.е. создание исторических реконструкций исходя из молекулярных характеристик ДНК потомков, а также ископаемых предков. Поскольку далекие предки, передвигаясь, несли в новые края языки, то, прослеживая миграции предков, происходившие сотни, тысячи и десятки тысяч лет назад, можно получать сведения о миграции языков во времена столь глубокой древности. Сопоставление этих реконструкций с данными лингвистики, полученными принципиально другими методами, может позволить получать более обоснованные сведения в области языкознания, проверять существующие концепции и приходить к новым, совершенно неожиданным концепциям и идеям. Так биохимия, физическая химия, химическая кинетика повернулись своими неожиданными и непредсказуемыми ранее гранями к наукам гуманитарным, историческим, лингвистическим.

В области ДНК-генеалогии уже есть наработки, которые надо сопоставить с данными истории, археологии, лингвистики, антропологии. В данной статье приведен всего один пример, относящийся к аланам и их предполагавшейся роли в происхождении осетин и карачаево-балкарцев, которое на самом деле наиболее вероятно находится в исторической Бактрии. ДНК-генеалогия ясно показала, что донские аланы, во всяком случае, из описанного некрополя, имеют четкое европейское, а не центрально-азиатское происхождение. В какой степени это меняет довольно устоявшуюся картину, и что предлагается взамен - решать историкам. Автор будет рад оказать в этом посильное содействие.

В следующих статьях данной серии предполагается рассмотреть вопросы происхождения индоариев, на основе гаплотипов гаплогруппы R1a, преобладающей среди высших индийских каст, и гаплотипов этнических русских той же гаплогруппы. Будут рассмотрены гаплотипы и гаплогруппы ископаемых скифов Алтая, афганских пуштунов, балтийских славян и финно-угров, особенно, в связи с «норманнской теорией» и декларированного засилья скандинавов на Руси, гаплотипы и гаплогруппы носителей культуры колоколовидных кубков в связи с заселением ими Европы в ТТТ-ТТ тыс. до н.э., а также предполагаемое происхождение кельтов и их индоевропейского языка, и многие другие вопросы молекулярной истории и их взаимоотношение с традиционными историческими науками. Автор уверен в том, что между ними будет союз, а не конфликт.

ЛИТЕРАТУРА

Афанасьев Г.Е., Добровольская М.В., Коробов Д.С., Решетова И.К. О культурной, антропологической и генетической специфике донских алан // Е.И. Крупнов и развитие археологии Северного Кавказа. М., 2014.

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 74

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 75

Клёсов A.A. Биологическая химия как основа ДНК-генеалогии и зарождение «молекулярной истории» // Биохимия. 2011. № 5.

Клёсов А.А. Происхождение славян. М., 2013a.

Клёсов А.А. Занимательная ДНК-генеалогия. М., 2013b.

Плетнева С.А. Половцы. М., 1990.

Elhaik E., Tatarinova T.V., Klyosov A.A., Graur D. The 'extremely ancient' chromosome that isn't: a forensic bioinformatic investigation of Albert Perry's X-degenerate portion of the Y chromosome" // Eur. J. Human Genetics. 2014. 22 January.

Klyosov A.A. Basic rules of DNA genealogy (Y-chromosome). Mutation rates and their calibration // Proceedings of the Russian Academy of DNA Genealogy. 2008. No. 1.

Klyosov A.A. DNA Genealogy, mutation rates, and some historical evidences written in Y-chromosome. I. Basic principles and the method // J. Genetic Genealogy. 2009a. 5.

Klyosov A.A. DNA Genealogy, mutation rates, and some historical evidences written in Y-chromosome. II. Walking the map // J. Genetic Genealogy. 2009b. 5.

Klyosov A.A. A comment on the paper: Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish Priesthood // Human Genetics. 2009c. 126.

Klyosov A.A. Ancient history of the Arbins, bearers of haplogroup R1b, from Central Asia to Europe, 16,000 to 1500 years before present // Advances in Anthropology. 2012. No. 2.

Klyosov A.A., Rozhanskii I.L. Haplogroup R1a as the Proto Indo-Europeans and the legendary Aryans as witnessed by the DNA of their current descendants // Advances in Anthropology. 2012a. No. 1.

Klyosov A.A., Rozhanskii I.L. Re-examining the "Out of Africa" theory and the origin of Europeoids (Caucasoids) in light of DNA genealogy // Advances in Anthropology. 2012b. No. 2.

Klyosov A.A., Rozhanskii I.L., Ryanbchenko L.E. Re-examining the Out-of- Africa theory and the origin of Europeoids (Caucasoids). Part 2. SNPs, haplogroups and haplotypes in the Y charomosome of Chimpanzee and Humans // Advances in Anthropology. 2012. No. 4.

Klyosov A.A., Mironova E.A. A DNA genealogy solution to the puzzle of ancient look-alike ceramics across the world // Advances in Anthropology. 2013. No. 3.

Klyosov A.A. Reconsideration of the "Out of Africa" concept as not having enough proof // Advances in Anthropology. 2014. No. 1.

Klyosov A.A., Tomezzoli G.T. DNA genealogy and linguistics. Ancient Europe // Advances in Anthropology. 2013. No. 2.

Lacan M., Keyser C., Ricaut F.-X. et al. Ancient DNA reveals male diffusion through the Neolithic Mediterranean route // Proc. Natl. Acad. Sci. US. 2011. 108.

Lacan M., Keyser C., Ricaut F.-X. et al. Ancient DNA suggests the leading role played by men in the Neolithic dissemination // Proc. Natl. Acad. Sci. US. 2011. 108.

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 75

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 76

Lee E.Y., Shin K.-J., Rakha A., Sim J. E., Park M. J., Kim N. Y., Yang W.I., Lee H. Y. Analysis of 22 Y chromosomal STR haplotypes and Y haplogroup distribution in Pathans of Pakistan // Forensic Sci. International: Genetics. 2014. 11.

Rozhanskii I.L., Klyosov A.A. Mutation rate constants in DNA genealogy (Y chromosome) // Advances in Anthropology. 2011. No. 2.

Rozhanskii I.L., Klyosov A.A. Haplogroup R1a, its subclades and branches in Europe during the last 9,000 years // Advances in Anthropology. 2012. No. 3.

References

Afanas'ev G.E., Dobrovol'skaja M.V., Korobov D.S., Reshetova I.K. O kul'turnoj, antropologicheskoj i geneticheskoj specifike donskih alan [About cultural, anthropological and genetic specifics Don Alan], E.I. Krupnov i razvitie arheologii Severnogo Kavkaza, M., 2014 [in Russian].

Kljosov A.A. Biologicheskaja himija kak osnova DNK-genealogii i zarozhdenie «molekuljarnoj istorii» [Biological chemistry as fundamentals of DNA genealogy and origin of "molecular history"], Biohimija, 2011, № 5 [in Russian].

Kljosov A.A. Proishozhdenie slavjan [Origin of Slavs], M., 2013a [in Russian].

Kljosov A.A. Zanimatel'naja DNK-genealogija [Entertaining DNA genealogy], M., 2013b [in Russian].

Pletneva S.A. Polovcy [Cumans], M., 1990 [in Russian].

Elhaik E., Tatarinova T.V., Klyosov A.A., Graur D. The 'extremely ancient' chromosome that isn't: a forensic bioinformatic investigation of Albert Perry's X-degenerate portion of the Y chromosome", Eur. J. Human Genetics, 2014, 22 January [in English].

Klyosov A.A. Basic rules of DNA genealogy (Y-chromosome). Mutation rates and their calibration, Proceedings of the Russian Academy of DNA Genealogy, 2008, No. 1 [in English].

Klyosov A.A. DNA Genealogy, mutation rates, and some historical evidences written in Y-chromosome. I. Basic principles and the method, J. Genetic Genealogy, 2009a. 5 [in English].

Klyosov A.A. DNA Genealogy, mutation rates, and some historical evidences written in Y-chromosome. II. Walking the map, J. Genetic Genealogy, 2009b, 5 [in English].

Klyosov A.A. A comment on the paper: Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish Priesthood, Human Genetics, 2009c, 126 [in English].

Klyosov A.A. Ancient history of the Arbins, bearers of haplogroup R1b, from Central Asia to Europe, 16,000 to 1500 years before present, Advances in Anthropology, 2012, No. 2 [in English].

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 76

№ 1 (2015)________________ИСТОРИЧЕСКИЙ ФОРМАТ_______________стр. 77

Klyosov A.A., Rozhanskii I.L. Haplogroup R1a as the Proto Indo-Europeans and the legendary Aryans as witnessed by the DNA of their current descendants, Advances in Anthropology, 2012a, No. 1 [in English].

Klyosov A.A., Rozhanskii I.L. Re-examining the "Out of Africa" theory and the origin of Europeoids (Caucasoids) in light of DNA genealogy, Advances in Anthropology, 2012b, No. 2 [in English].

Klyosov A.A., Rozhanskii I.L., Ryanbchenko L.E. Re-examining the Out-of- Africa theory and the origin of Europeoids (Caucasoids). Part 2. SNPs, haplogroups and haplotypes in the Y charomosome of Chimpanzee and Humans, Advances in Anthropology, 2012, No. 4 [in English].

Klyosov A.A., Mironova E.A. A DNA genealogy solution to the puzzle of ancient look-alike ceramics across the world, Advances in Anthropology, 2013, No. 3 [in English].

Klyosov A.A. Reconsideration of the "Out of Africa" concept as not having enough proof, Advances in Anthropology, 2014, No. 1 [in English].

Klyosov A.A., Tomezzoli G.T. DNA genealogy and linguistics. Ancient Europe, Advances in Anthropology, 2013, No. 2 [in English].

Lacan M., Keyser C., Ricaut F.-X. et al. Ancient DNA reveals male diffusion through the Neolithic Mediterranean route, Proc. Natl. Acad. Sci. US., 2011, 108 [in English].

Lacan M., Keyser C., Ricaut F.-X. et al. Ancient DNA suggests the leading role played by men in the Neolithic dissemination, Proc. Natl. Acad. Sci. US., 2011, 108 [in English].

Lee E.Y., Shin K.-J., Rakha A., Sim J. E., Park M. J., Kim N. Y., Yang W.I., Lee H. Y. Analysis of 22 Y chromosomal STR haplotypes and Y haplogroup distribution in Pathans of Pakistan, Forensic Sci. International: Genetics, 2014, 11 [in English].

Rozhanskii I.L., Klyosov A.A. Mutation rate constants in DNA genealogy (Y chromosome), Advances in Anthropology, 2011, No. 2 [in English].

Rozhanskii I.L., Klyosov A.A. Haplogroup R1a, its subclades and branches in Europe during the last 9,000 years, Advances in Anthropology, 2012, No. 3 [in English].

* X X

№ 1 (2015)___________________THE HISTORICAL FORMAT__________________page 77