CC BY
0Association of Antiseptic Resistance Gene (qacE\1) with Class 1 Integrons in Salmonella Isolated from Broiler Chickens
Naglaa M. Ali and Fatma M. Mohamed*
Poultry Diseases, Assiut Regional Laboratory, Animal Health Research Institute, Agricultural Research Center (ARC), Egypt. 'Corresponding author's Email: fmmi@yahoo.com; ORCID: 0000-0003-3393-4638
Received: 12 Feb. 2020 Accepted: 18 Mar. 2020
ABSTRACT
Salmonella enterica is considered a zoonotic pathogen that acquires antibiotic resistance in livestock. In the current study, a total of 18 Salmonella enterica isolates recovered from cloacal swabs of diseased and freshly dead broilers were serotyped and assessed for susceptibility to clinically important antibiotics. The multi-resistant isolates were examined for the presence of the antiseptic resistance genes including quaternary ammonium (qacEAl) and class 1 integron-integrase (intll) by PCR. The results of serotyping of 18 Salmonella isolates indicated that five isolates belonged to Salmonella Typhimurium, four isolates belonged to each of Salmonella Kentucky and Salmonella Enteritidis, three isolates belonged to Salmonella Molade and one isolate belonged to each of Salmonella Inganda and Salmonella Larochelle. Fifteen Salmonella isolates (83.3%) were multi-resistant to at least three antibiotics with a multidrug resistance index value of 0.473. All of the intll -positive strains carried qacEAl, confirming that the qacEAl gene is linked to the integrons. The study concluded that the presence of the qacEAl resistance gene and class 1 integrase in multi-drug resistant Salmonella strains might be contributed to co-resistance or cross-resistance mechanisms.
Key words: intll, Multidrug-resistant Salmonella, PCR, qacEAl
JWPR
2020, Scienceline Publication
J. World Poult. Res. 10(2S): 214-222, June 14, 2020
Journal Of W°rld s Research Paper, PII: S2322455X2000027-10
Poultry Research License: CC BY 4.0
DOI: https://dx.doi.org/10.36380/jwpr.2020.27
INTRODUCTION were susceptible to ceftriaxone and 11 isolates harbored
class 1 integron. It has been also stated that different Salmonella Typhimurium continues to be among the most serotypes of the genus Salmonella are resistant to various
common serovars isolated from poultry and a common antimicrobials and carry class 1 integron, which is
cause of human salmonellosis (Foley et al., 2011). involved in antimicrobial multi-resistance (Vazquez et al.,
Salmonellae are prevalent in the environment and are found in both domestic and wild animals as pathogens or commensals. These bacteria can infect humans mainly via contaminated food such as meat, dairy products, eggs, fruits, vegetables (Yan et al., 2010).
The growing resistance of pathogenic bacteria to antimicrobials has raised the concern that the widespread use of antimicrobials in animal production may promote the development of resistant bacteria or resistance genes that can be transferred to bacteria which cause disease in humans (Wegener et al., 1997). Microbial resistance is the loss of sensitivity of a microorganism to an antimicrobial that it was originally susceptible. This resistance can be acquired by mutations in chromosomal DNA or the acquisition of extra-chromosomal genetic materials through plasmids and transposons (Vázquez et al., 2002). Zhang et al. (2004) studied 33 isolates of Salmonella among healthy people in China and found that all isolates
2005). In addition, the strains harboring integrons exhibit the strongest resistance patterns (Muñoz et al., 2000).
González et al. (1998) published the first evidence of the presence of integrons in Gram-negative bacilli isolated from biological residues in Chilean hospitals and found the integrons are commonly associated with the family Enterobacteriaceae. Integrons function as a system that captures genes that confer selective advantages to the bacterium. Integrons allow the bacterium to rapidly adapt to ecological changes, due to their capacity to recognize a wide variety of recombination sequences, their exchange capacity and remote origin (González et al., 2004). Integrons are genetic elements in plasmids and transposons and frequently contain one or more genes encoding resistance to antimicrobials (Stokes and Hall, 1989). Four classes of integrons are known (1, 2, 3, and 4), with class 1 being predominant among the members of this family both in the normal and pathogenic microbiota of
To cite this papery Ali NM and Mohamed FM (2020). Association of Antiseptic Resistance Gene (qacEAl) with Class 1 Intégrons in Salmonella Isolated from Broiler Chickens. J. World Poult. Res., 10 (2S): 214-222. DOI: https://dx.doi.org/10.36380/jwpr.2020.27
animals (Goldstein et al., 2001). Intégrons contribute to the spread of antimicrobial resistance by gene transfer in a variety of enteric bacteria, including Salmonella (Maynard et al., 2003).
Disinfectants are, however, employed during production breaks as a routine part of the management of poultry farms. Disinfectants such as Quaternary Ammonium Compounds (QACs) that have been introduced into farm environments. A particular concern is that repeated usage of disinfectants may give rise to the selection and persistence of bacteria with reduced susceptibility not only to the antiseptics but possibly to antibiotics as well (Randall et al., 2004). QAC gene which is responsible for resistance to quaternary ammonium compounds and disinfectants located on the 3' regions of class 1 integron (Mazel, 2006). The mutant type QAC gene recorded high prevalence among Salmonella Typhi isolates (Hindi et al., 2014).
Chuanchuen et al. (2007) recorded that all of the intI1 -positive strains carry qacEAlin 3' conserved segment, confirming that the qacEAl gene is linked to the integrons. QAC resistance and dissemination are very important in the context of the global antibiotic resistance problem, also exposure to QACs results in the dissemination of integrons (Gillings, 2014). There is a link between antibiotic resistance in nature and clinical settings, which is favored by exposure to QACs (Forsberg et al., 2012).
The present study aimed to detect class 1integron (intI1) gene associated with antiseptic resistance gene (qacEA1) in Salmonella serotypes, and correlate the presence of these genes with multi-resistance to antimicrobials, as verified by the plate inhibition test.
MATERIALS AND METHODS
Ethical approval
The research protocol was reviewed and approved by the Institutional Animal Care and use Committee (VetCU02122019103).
Sampling
Cloacal swaps were collected aseptically from 100 chickens suffering from digestive, respiratory and/or locomotor disorders. The samples were then transported in 1.5 mL tubes containing 750^L of Brain Heart Infusion (BHI) broth refrigerated in the icebox to the Laboratory of Poultry Diseases Department, Faculty of Veterinary Medicine, Assiut University, Assiut, Egypt.
Isolation and biochemical identification of
Salmonella spp.
For isolation of Salmonella spp., the following method was used in brief: inoculated BHI broth tubes were incubated at 37oC for 18 hours then a loopful was transferred to Rappaport-Vassiliadis broth then incubated at 41oC aerobically for 24 hours. Samples were streaked onto Brilliant Green agar with Novobiocin (40 ^g/mL) and inoculated Salmonella-Shigella agar and incubated for 24 hours at 37oC aerobically. The isolated pure cultures of Salmonella spp. were biochemically identified using the following tests; oxidase, indole, methyl red, Voges Proskauer, citrate utilization, urea hydrolysis, triple sugar iron agar and lysine decarboxylase (Quinn et al., 2002).
Serological identification
Isolates with biochemical profile compatible with Salmonella spp. were identified serologically using antisera (DENKA SEIKEN Co., Japan) in agglutination tests on the basis of somatic O antigen and phase 1 and phase 2 flagella antigens according to the Kauffmann-White scheme (Grimont and Weill, 2007).
Antibiotic susceptibility
All Salmonella serotype isolates were studied via the disk diffusion method to evaluate their resistance to antibiotic disks. The criteria proposed by the National Committee for Clinical Laboratory Standards (CLSI, 2013) was used to determine susceptibility rates. The following 13 antibiotic discs (Oxoid) used in the current study were: erythromycin (15^g), amoxicillin (30 ^g), cephradine (30 ^g), colistin (10 ^g), ciprofloxacin (5 ^g), enrofloxacin (5 ^g), cefoxitin (30 ^g), gentamicin (10 ^g), penicillin (10 neomycin (10 ^g), streptomycin (10^g), florfenicol (15 ^g) and amikacin (15 ^g).
Multidrug resistance index
Resistance to more than three antibiotics was recorded as Multi-Drug Resistance (MDR). The MDR index of individual isolates was calculated by using the equation adopted by Chandran et al. (2008). In this equation, the number of antibiotics that the isolate was resistant to these was divided by the total number of antibiotics exposed. Isolates with MDR index values more than 0.2 or 20% were considered highly resistant.
Number of antibiotics resisted
MDR index =- x 100
Total number of antibiotics used
Experimental Design
Suspension of Salmonella isolates, in a saline solution, was prepared with a 24h agar culture using the McFarland scale, a concentration of bacteria was established, it means that the suspension contained 1800x106 Salmonella bacteria in 2 ml (Balicka et al., 2007). A volume of 2 ml of this suspension was administered to each of 30 six-day-old chicks. On the 15th day, birds were humanely killed and both ceca and cecal tonsils were aseptically collected and cultured for the presence of Salmonella spp.
PCR amplification and DNA sequencing
Ten Salmonella isolates were tested for the presence of qacEh.1 and integrase gene (intI1) using PCR as the following:
DNA extraction
DNA extraction from isolates was performed using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) with modifications from the manufacturer's recommendations. Briefly, 200 ^l of the sample suspension was incubated with 10 ^l of proteinase K and 200 ^l of lysis buffer at 56OC for 10 min. After incubation, 200 ^l of 100% ethanol was added to the lysate. The sample was then washed and centrifuged following the manufacturer's recommendations. Nucleic acid was eluted in 100 ^l of elution buffer that was provided in the kit.
Oligonucleotide primer
Used primers were supplied by Metabion (Germany) and listed in table 1.
PCR amplification
Primers were utilized in a 25- ^l reaction containing 12.5 ^l of DreamTaq Green PCR Master Mix (2X) (Thermo Scientific), 1 ^l of each primer of 20 pmol concentration, 4.5 ^l of water, and 6 ^l of DNA template. The reaction was performed in an applied biosystem 2720 thermal cycler.
Analysis of the PCR products
The products of PCR were separated by electrophoresis on 1% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 20 ^l of the PCR products were loaded in each gel slot. GeneRuler 100 base pair DNA ladder (Fermentas, Sigma) was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech,
Biometra) and the data was analyzed through computer software.
RESULTS
The obtained results in the current study showed that on examination of 100 cloacal broiler chicken samples aseptically collected from diseased and freshly dead chickens, 18 Salmonella isolates were recovered with an overall percentage of (18%). Salmonella isolates were motile, and they were positive with methyl red, citrate utilization, H2S, LDC, Arginine dihydrolase and xylose. However, they were negative with indole, Voges Proskauer, urease, Gelatin liquefaction, ONPG.
Serotyping of Salmonella isolates revealed that Salmonella Typhimurium was the most common serovar (5 isolates) followed by Salmonella Kentucky and Salmonella Enteritidis (4 isolates) and Salmonella Molade (3 isolates), while Salmonella Larochelle and Salmonella Inganda were represented by one isolate for each of them (Table 2). The experimental chickens were infected with a suspension containing 1800x106 bacteria in 2 ml. 85% of birds had intensive clinical symptoms, Ruffled feathers, diarrhea, weakness, and apathy. Postmortem examination revealed severe congestion in the intestines, swollen liver with necrosis and dehydration. Two cases died and Salmonella was re-isolated from the intestines and cecum.
The antibiotic resistance pattern of the 18 Salmonella isolates is shown in table 3. The obtained results showed that 100% of the isolates were susceptible to amikacin (100%) followed by Ciprofloxacin (88.89%) and gentamicin (72.3%), norfloxacin/florfenicol (66.7%) and streptomycin (61. 2%). High resistance rates were observed against penicillin (100%), followed by Amoxicillin (94.5%) and Erythromycin (83.3%). In addition, 15 Salmonella isolates (83.3%) were multi-resistant to at least three antibiotics with MDR index value of 0.473 of which 10 isolates were tested for intI1 and qacEA1 genes.
The class 1 integron was detected in 10 multidrug-resistant isolates giving characteristic bands at 280 base pairs (Figure 1). The qacEA1 was also detected among DNA products of 10 multidrug-resistant Salmonella isolates giving characteristic bands at 362 base pairs (Figure 2).
Figure 1. Agarose gel electrophoresis showing PCR amplification at 280 base pair fragment for class 1 integron (conserved segment) among DNA products of 10 multidrug-resistant Salmonella isolates collected from cloacal swaps from chickens, Egypt. L: 100 base pair DNA ladder, Neg: Negative Control, Pos: Positive control
Figure 2. Agarose gel electrophoresis showing PCR amplification at 362 base pair fragment for qacEAl gene among DNA products of 10 multidrug-resistant Salmonella isolates collected from cloacal swaps from chickens, Egypt. L: 100 base pair DNA ladder, Neg: Negative Control, Pos: Positive control
Table 1. Primers sequences, target genes, amplicon sizes, and PCR cycling conditions
Target gene Primers sequences (5'- 3') Amplified Primary denaturation Amplification (35 cycles) Final extension
segment (base pair) Secondary denaturation Annealing Extension Reference
qacEAl F:TAAGCCCTACACAAATTGGGA GAT AT R:GCCTCCGCAGCGACTTCCACG 362 94°C 5 min. 94°C 30 sec. 58°C 40 sec. 72°C 40 sec. 72°C 10 min. Chuanchuen et al. (2007)
intll F : CCTCCCGCACGATGATC R:TCCACGCATCGTCAGGC 280 94°C 5 min. 94°C 30 sec. 50°C 30 sec. 72°C 30 sec. 72°C 7 min. Kashif et al. (2013)
R: reverse, F: forward
Table 2. Results from Serotyping of Salmonella isolates collected from cloacal swaps from chickens, Egypt
Strain
Prevalence
Number
%
Salmonella Molade 3 16.6%
Salmonella Enteritidis 4 22.2%
Salmonella Kentucky 4 22.2%
Salmonella Inganda 1 5.5%
Salmonella Typhimurium 5 27.7%
Salmonella Larochelle 1 5.5%
Table 3. Antibiotic resistance pattern of Salmonella isolates collected from cloacal swaps from chickens, Egypt
Salmonella isolates ( total number:18)
Antibiotics discs Resistant Sensitive
% Number % Number
Amikacin (15^g) 0 0 100 18
Amoxicillin (25^g) 94.5% 17 5.5% 1
Colistin (30^g) 22.2% 4 77.8% 14
Cephradine (30^g) 55.5% 10 44.5% 8
Ciprofloxacin (5^g) 11.11% 2 88.89% 16
Cefoxitin (30^g) 66.6% 12 33.4% 6
Erythromycin (15^g) 83.3% 15 16.7% 3
Florfenicol (15^g) 33.3% 6 66.7% 12
Gentamicin (10^g) 27.7% 5 72.3% 13
Norfloxacin (10^g) 33.3 % 6 66.7% 12
Neomycin (30^g) 50% 9 50% 9
Penicillin (10u) 100% 18 0% 0
Streptomycin (10^g) 38.8% 7 61.2% 11
DISCUSSION
The obtained results in the current study showed that on examination of 100 chicken cloacal swabs samples aseptically collected from diseased and freshly dead chickens, 18 Salmonella isolates were obtained with a percentage of 18%. However, previous studies reported slightly lower values for Salmonella isolation. In this respect, the prevalence of Salmonella was 12.8% in broilers farms in Egypt (Orady et al., 2017), 12.6% in poultry farms in Kuwait (Al-Zenki et al., 2007) and 10% were isolated from internal organs (liver, spleen, and heart) of broilers (El-Azzouny, 2014). However, a much lower prevalence of Salmonella was reported in other localities in Egypt where an overall prevalence of 1.7% (Ahmed et al., 2009), 2% and 2.5% (Mohamed et al., 1999) was found in Sharkia, Gharbia, and Kafr-Elsheikh governorates, respectively. Also, other studies showed more variable prevalence rates of Salmonella isolates worldwide. Salmonella isolates were found in 3.1% of internal organs of chickens in North Vietnam (Hanh et al., 2006), but Molla et al. (2003) isolated Salmonella from
34.5% of chicken samples in Ethiopia. The above-mentioned discrepancy in prevalence rate of Salmonella spp. could be attributed to the disparity in sampling schemes, types of samples, protocols of Salmonella detection and geographic differences as well as hygienic practices.
In concordance with the previous study by Bywater et al. (2004), the isolation of Salmonella with a higher percentage from broiler chickens necessitate the application of biosecurity program inside farms beside using alternatives to antimicrobials such as bacteriophages and herbal extracts for cutting the horizontal transmission of Salmonella to broiler carcasses (Elkenany et al., 2019).
In agreement with previous studies, Salmonella Typhimurium was the most common serovar isolated from broilers in many countries (Verma and Gupta, 1995; Moussa et al., 2010; Rabie et al., 2012; Borges et al., 2015; Ammar et al., 2016; Orady et al., 2017). It accounted for 27. 7% of total Salmonella isolates in the current study. Other serotypes isolated in the present study were Salmonella Enteritidis and Salmonella Kentucky with a percentage of 22.2% and Salmonella Molade with a
percentage of 16.6%, while Salmonella Inganda and Salmonella Larochelle recorded the lowest percentage (5.5%). These results are consistent with the results of Orady et al., (2017) who mentioned Salmonella Enteritidis and Salmonella Typhimurium are the most common serovars recording 15.6%, while Salmonella Kentucky and Salmonella Molade accounted for 6.2% and 3.1%, respectively.
Regarding the sensitivity pattern of each of the 18 isolated Salmonella serovar, 15 Salmonella isolates had multi-resistance to at least three antibiotics with an MDR index value of 0.473, whereas 3/18 (16.7%) had MDR index value of 0.112 <0.2. These results differ from those reported by Orady et al. (2017) who mentioned that 62.5% of salmonella isolated from chickens showed MDR phenotypes to at least three classes of antimicrobials. Also, Singh et al., (2010) reported that all tested Salmonella spp. isolates from chickens were resistant to at least one antimicrobial compound. This increased MDR could be attributed to the wide range, irresponsible and misuse of antibiotics in poultry farms.
In the present study, all isolates were fully susceptible to amikacin (100%), which was the most effective antibacterial agent against Salmonella infection followed by ciprofloxacin (88.89%), Colistin (77.8%), gentamicin (72.3%) followed by streptomycin (61.2%). Comparable findings have been reported by Orady et al. (2017) and Lukasz and Popowska (2016).
It has been stated that there is an association between class 1 integrons and the development of antibiotic resistance (Guerra et al., 2003; Orady et al., 2017). In addition, class 1 integrons are the most frequently found integrons that contribute to MDR in gram-negative bacteria (Fluit and Schmitz, 2004; Hsu et al, 2006). In the current study, class 1 integron was screened among the obtained multidrug-resistant Salmonella isolates. PCR amplification revealed that Class 1 integrons were detected in 10 tested MDR Salmonella isolates (100 %). In agreement with Ammar et al. (2016), class 1 integrons contribute significantly to antibiotic resistance in Salmonella isolates. There is a discrepancy in the percentage of Salmonella isolates expressing the presence of class 1 integrons as revealed by previous studies. Comparable results to the current results have been obtained by Antunes et al. (2004) and Orady et al. (2017) who mentioned that class 1 integrons were detected in almost all isolates (99% and 95%, respectively). However, lower percentages have been demonstrated by Gautam et al. (2017) in India (69.9%) and Shahada et al. (2006) in China (24.5%). Contrarily, Okamoto et al. (2009) and
Hindi et al. (2014) recorded that class 1integron (intI1) gene was not observed in any of the 100 multidrug-resistant Salmonella spp. as it was not detected by PCR. The integron has also been found in other Enterobacteriaceae but it is not very frequent as in Salmonella (Guerra et al., 2004). The uncontrolled use of antibiotics would increase the number of multidrug-resistant isolates and integrons prevalence, which by time, could be a significant public health threat (Orady et al., 2017).
As demonstrated in the present study, all isolates expressing class 1 integrons were positive for the presence of the qacEA1gene, indicating the positive correlation between them. In the same context, class 1 integrons were associated with qacEA1 and sul1 and commonly detected in clinical isolates of Salmonella (Hsu et al.,
2006). In addition, Chuanchuen et al. (2007) mentioned that the intI1 gene was identified in 23 isolates (70%) with qacEA1 and all of the intI1 -positive strains carried qacEA1 in 3' conserved segments, confirming that the qacEA1 gene is linked to the integrons. Moreover, Gaze et al. (2005) reported a link between increased class 1 integron frequency as well as increased QAC resistance.
Recently, an unusual 3' conserved sequence regions with QAC linked to a sul3 domain was found in plasmid-borne class 1 integrons in different Salmonella serovars (Antunes et al., 2004). Also, the 5' CS region contains intI1, the typical 3' CS region usually consists of qacEA1; encoding resistance to quaternary ammonium compounds, sul1; encoding resistance to sulphonamide (Fluit and Schmitz, 2004). Integrons play a significant role in the acquisition and mobilization of QAC resistance genes (Cambray et al., 2010). Also, plasmid-associated QAC resistance genes are transferred between non-pathogenic and pathogenic bacteria exposed to QACs, a process that also leads to the co-selection of resistance to other contaminants (Katharios et al., 2012). So, Antibiotic and QAC resistance genes are both carried on class 1 integrons, which raises concerns that QAC exposure resistance may co-select for antibiotic resistance by selecting for class 1 integrons (Chuanchuen et al., 2007).
On the contrary, Salmonella Enterica strains positive for qacE1 but without intI1 were also identified. Carriage of the qacE1 gene may be on other elements or integrated into the chromosome (Chuanchuen et al.,
2007). Also, the class 1 integron gene (qacE1-SulI) was not detected in any Salmonella isolates (Diarrassouba et al., 2007).
CONCLUSION
The majority of Salmonella isolates were multi-drug resistant to at least three antibiotics. The presence of integrons among Salmonella isolates is considered to be an important contributor to the development of antibiotic resistance. The presence of class 1 integrons in all of the qacEAl -positive strains confirms a significant association between them and confers cross-resistance to different groups of antibacterial. Increasing resistance among Salmonella isolates harboring class 1 integron and qacEAlgene are linked to the excessive use of antimicrobials and disinfectants in broilers farm.
DECLARATION
Competing interests
The authors declare no conflict of interest.
Authors' contributions
Both authors contributed equally to this work.
REFERENCES
Ahmed AM, Shimabukuro H and Shimamoto T (2009). Isolation and molecular characterization of multidrug-resistant strains of Escherichia coli and Salmonella from retail chicken meat in Japan. Journal of Food Science, 74 (7): 405-410. DOI: 10.1111/j.1750-3841.2009.01291.x
Al-Zenki S, Al-Nasser A, Al-Safar A, Alomirah H, Al-Haddad A, Hendriksen RS and Aarestrup FM (2007). Prevalence and antibiotic resistance of Salmonella isolated from a poultry farm and processing plant environment in the state of Kuwait. Foodborne Pathogens and Disease, 4 (3): 367-373. DOI: 10.1089/fpd.2007.0017
Ammar AM, Attia AM, Abd El-Aziz NK, Abd El Hamid MI and El-Demerdash AS (2016). Class 1 integron and associated gene cassettes mediating multiple-drug resistance in some foodborne pathogens. International Food Research Journal, 23 (1): 332-339. Available at: https://www.researchgate.net/publication/291286908
Antunes P, Machado J, Sousa JC and Peixe L (2004). Dissemination amongst humans and food products of animal origin of a Salmonella Typhimurium clone expressing an integron-borne 0XA-30 B-lactamase. Journal of Antimicrobial Chemotherapy, 54: 429-434. DOI: 10.1093/jac/dkh333
Balicka -Ramis A, Wojtasz-Paj^k A, Pilarczyk B and Ramisz A (2007). The effect of chitosan on body weight and protection against Salmonella Gallinarum infection in broiler chickens. Archiv fur Tierzucht, 50 (3): 288-293. DOI: 10.5194/aab-50-288-2007
Borges P, Bergseng E, Eid T and Gobakken T (2015). Impact of maximum opening area constraints on profitability and biomass availability in forestry - a large, real world case. Silva Fennica, 49 (5): 1347. DOI: 10.14214/sf.1347.
Bywater R, Deluyker H, Deroover E, DeJong A, Marion H, McConville M, Rowan T, Shryock T, Shuster D, Thomas V, Valle M and Walters J (2004). A European survey of antimicrobial susceptibility among zoonotic and commensal bacteria isolated from food-producing animals. Journal of Antimicrobial Chemotherapy, 54 (4): 744-754. DOI: 10.1093/jac/dkh422
Cambray G, Guerout AM and Mazel D (2010). Integrons. Annual Reviews of Genetics, 44: 141-166. DOI: 10.1146/annurev-genet-102209-163504
Chandran A, Hatha AA, Varghese S and Sheeia KM (2008): Prevalence of multiple drug resistant Escherichia coli serotypes in a tropical estuary, India. Microbes and Environment, 23(2):153-158. DOI: 10.1264/jsme2.23.153
Chuanchuen R, Khemtong S and Padungtod P (2007). Occurrence of qacE/qacEA1 genes and their correlation with class 1 integrons in Salmonella enterica isolates from poultry and swine. Southeast Asian Journal of Tropical Medicine and Public Health, 38: 855— 862. Available at: https://www.ncbi.nlm.nih.gov/pubmed/18041302
CLSI (2013). Performance Standards for Antimicrobial Susceptibility testing; twenty-third informational supplement. CLSI document M100-S23. Wayne, PA: Clinical and Laboratory Standards Institute. Available at:
https://www.facm.ucl.ac.be/intranet/CLSI/CLSI-M100S23-susceptibility-testing-2013-no-protection.pdf
Diarrassouba F, Diarra MS, Bach S, Delaquis P, Pritchard J, Topp E, and Skura B J (2007). Antibiotic resistance and virulence genes in commensal Escherichia coli and Salmonella isolates from commercial broiler chicken farms. Journal of Food Protection, 70 (6): 1316-1327. DOI: 10.4315/0362-028x-70.6.1316
El-Azzouny MME (2014). Occurrence of virulence genes among multidrug resistant Salmonellae isolated from broilers. Ph. D. Thesis, Faculty of Veterinary Medicine, Bacteriology, Mycology, and Immunology Department. Zagazig University.
Elkenany R Elsayed M M, Zakaria AI, El-sayed SA and Rizk MA (2019). Antimicrobial resistance profiles and virulence genotyping of Salmonella enterica serovars recovered from broiler chickens and chicken carcasses in Egypt. BMC Veterinary Research, 15: 124. DOI: 10.1186/s12917-019-1867-z
Fluit AC and Schmitz FJ (2004). Resistance integrons and superintegrons. Clinical Microbiology and Infection, 10: 272-88. DOI: 10.1111/j.1198-743X.2004.00858.x
Foley SL, Nayak R Hanning IB, Johnson TJ, Han J and Ricke SC
(2011). Population dynamics of Salmonella enterica serotypes incommercial egg and poultry production. Applied Environmental Microbiology, 13: 4273-4279. DOI: 10.1128/AEM.00598-11
Forsberg KJ, Reyes A, Bin W, Selleck EM, Sommer MOA and Dantas G
(2012). The shared antibiotic resistome of soil bacteria and human pathogens. Science, 337: 1107-1111. DOI: 10.1126/science. 1220761
Gautam RK, Kakatkar AS, Karani MN, Shashidhar R and Bandekar JR (2017). Salmonella in Indian ready-to-cook poultry: antibiotic resistance and molecular characterization. Microbiology Research, 8(1): 15-19. DOI: 10.4081/mr.2017.6882
Gaze WH, Abdouslam N, Hawkey PM and Wellington EM (2005). Incidence of class 1 integrons in a quaternary ammonium compound-polluted environment.
Antimicrobial Agents and Chemotherapy, 49 (5): 180 2-1807. DOI:10.1128/AAC.49.5.1802-1807.2005
Gillings MR (2014). Integrons: past, present, and future. Microbiology and Molecular Biology Reviews, 78: 257-277. DOI: 10.1128/MMBR.00056-13
Goldstein C, Lee MD, Sanchez S, Hudson C, Phillips B, Register B, Grady M, Liebert C, Summers AO, White DG and Maurer JJ (2001). Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrobial Agents and Chemotherapy, 45(3): 723-726. DOI: 10.1128/AAC.45.3.723 -726.2001
González GR, Mella SM, Zemelman RZ, Bello HT and Domínguez MY (2004). Integrones y cassettes genéticos de resistencia: estructura y rol frente a los antibacterianos. Revista Médica de Chile, 132(5): 619- 626. DOI: 10.4067/s0034-98872004000500013
González GR, Sossa K, Mella SM, Zemelman RZ, Bello HT and Domínguez MY (1998). Presence of integrons in isolates of different biotypes of Acinetobacter baumannii from Chilean hospitals. FEMS Microbiology Letter, 161: 125-128. DOI: 10.1111/j.1574-6968.1998.tb12937.x
Guerra B, Junker E and Helmuth R (2004). Incidence of the recently described sulfonamide resistance gene sul3 among German Salmonella enterica strains isolated from livestock and food. Antimicrobial Agents and Chemotherapy, 48: 2712-2715. DOI: 10.1128/AAC.48.7.2712-2715.2004
Guerra B, Junker E, Schroeter A, Malorny B, Lehmann S and Helmuth R (2003). Phenotypic and genotypic characterization of antimicrobial resistance in German Escherichia coli isolates from cattle, swine and poultry. The Journal of Antimicrobial Chemotherapy, 52:489492. DOI: 10.1093/jac/dkg362
Hanh TT, Thanh NT, Thoa HQ, Thi LT, Thuan LM and Ly NTH (2006). Prevalence of Salmonella spp. in poultry in Vietnam. Annals of the New York Academy of Sciences, 1081: 266-268. DOI: 10.1196/annals.1373.034
Hindi AK, Addos SA and Ahmed EE (2014). Molecular study on multidrug resistant of Salmonella enterica isolated from patient with enteric fever in Najaf - Province/Iraq. International Research Journal of Medical Sciences, 2 (7): 12-16. Available at: www.isca.in
Hsu SC, Chiu TH, Pang JC, Hsuan-Yuan CH, Chang GN and Tsen HY (2006). Characterisation of antimicrobial resistance patterns and class 1 integrons among Escherichia coli and Salmonella enterica serovar Choleraesuis strains isolated from humans and swine in Taiwan. International Journal of Antimicrobial Agents, 27: 383391. DOI: 10.1016/j.ij antimicag.2005.11.020
Kashif J, Buriro R, Memon J, Yaqoob M, Soomro J, Dongxue D, Jinhu H and Liping W (2013). Detection of class 1 and 2 integrons, ß-lactamase genes and molecular characterization of sulfonamide resistance in Escherichia coli Isolates recovered from poultry in China. Pakistan Veterinary Journal, 33 (3): 321-324. Available at: https://www.researchgate.net/publication/331167659
Katharios-Lanwermeyer S, Rakic-Martinez M, Elhanafi D, Ratani S, Tiedje JM and Kathariou S (2012). Coselection of cadmium and benzalkonium chloride resistance in conjugative transfers from nonpathogenic Listeria spp. to other Listeriae. Applied and Environmental Microbiology, 78: 7549-7556. DOI: 10.1128/AEM.02245-12
Grimont PAD and Weill FX (2007). Antigenic Formulae of the Salmonella serovars. WHO Collaborating Centre for Reference and Research on Salmonella, Institut Pasteur, 28 rue du Dr. Roux, 75724 Paris Cedex 15, France. Available at: https://www.researchgate.net/publication/283428414
Lukasz M and Popowska M (2016). Antimicrobial resistance of Salmonella spp. isolated from food. Roczniki Pañstwowego Zakladu Higieny, 67 (4): 343-358. Available at: https://www.ncbi.nlm.nih.gov/pubmed/27922740
Maynard C, Fairbrother JM, Bekal S Sanschagrin F, Levesque RC, Brousseau R, Masson L, Larivie're S and Harel J (2003). Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrobial Agents and Chemotherapy, 47:3214-3221. DOI: 10.1128/aac.47.10.3214-3221.2003
Mazel D (2006). Integrons: agents of bacterial evolution. Nature Reviews Microbiology, 4 (8):608-20. DOI: 10.1038/nrmicro1462
Mohamed LN, Samaha HA, Draz AA and Haggag YN (1999). Salmonellae among birds and human beings. Alexandria Journal of Veterinary Sciences, 15(1): 147-154.
Molla B, Mesfin A and Alemayehu D (2003). Multiple antimicrobial-resistant Salmonella serotypes isolated from chicken carcass and giblets in DebreZeit and Addis Ababa, Ethiopia. Ethiopian Journal of Health Development, 17(2): 131-149. DOI: 10.4314/ejhd.v17i2.9854
Moussa IM, Gassem MA, Al-Doss AA, Sadik WAM and Mawgood AAL (2010). Using molecular techniques for rapid detection of Salmonella serovars in frozen chicken and chicken products collected from Riyadh, Saudi Arabia. African Journal of Biotechnology, 9: 612-619. DOI: 10.5897/AJB09.1761
Muñoz J, González G, Bello H, Domínguez M, Mella S and Zemelman R (2000). Prevalencia de integrones en cepas intrahospitalarias de Pseudomonas aeruginosa y Acinetobacter spp. y su relación con la resistencia a antimicrobianos aminoglicosidos. Anales Microbioles, 3:72.
Okamoto AS, Andreatti Filho RL,Rocha TS, Menconi A and Marietto-Gonjalves GA (2009). Detection and transfer of antimicrobial resistance gene integron in Salmonella Enteritidis derived from avian material. Brazilian Journal of Poultry Science, 11 (3): 195 -201. Available at:
http://www.scielo.br/pdf/rbca/v11n3/v11n3a09.pdf
Orady R M, Helmy SM, Ammar AMA, Hassan WM, Abo Remela EM and EL-Demerdash AS (2017). Molecular characterization of class 1 integrons and antibiotic resistance genes in Salmonella enterica isolated from chicken. Global Veterinaria, 18 (5): 322-331. DOI: 10.5829/idosi.gv.2017.322.331
Quinn JP, Carter ME, Markey BK and Carter GR (2002). Clinical Veterinary Microbiology. 3rd ed. Baillere, Tindall, London. Available at:
https://books.google.com.sa/books?id=FUJYAQAAQBAJ&pg=PA 538&lpg=PA538&dq=Clinical+Veterinary+Microbiology.+3rd+ed. +Baillere,+Tindall,+London
Rabie NS, Khalifa NO, EI-Radwan M and Afify JSA (2012). Epidemiological and molecular studies of Salmonella isolates from chicken, chicken meat and human in Toukh, Egypt. Global Veterinaria, 8: 128-132. Available at:
https://www.researchgate.net/publication/280975886
Randall LP, Cooles SW, Osborn MK, Piddock LJ and Woodward MJ (2004). Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. The Journal of Antimicrobial Chemotherapy, 53 (2): 208-216. DOI: 10.1093/jac/dkh070
Shahada F, Chuma T, Tobata T and Okamoto K (2006). Molecular epidemiology of antimicrobial resistance among Salmonella enterica serovar Infantis from poultry in Kagoshima, Japan. International Journal of Antimicrobial Agents, 28 (4): 302-307. DOI: 10.1016/j.ijantimicag.2006.07.003
Singh S, Yadav AS, Singh SM and Bharti P (2010). Prevalence of Salmonella in chicken eggs collected from poultry farms and marketing channels and their antimicrobial resistance. Food Research International, 43: 2027-2030. Available at: https://doi.org/10.1016/j.foodres.2010.06.001
Stokes HW and Hall RM (1989). A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons. Molecular Microbiology, 3:1669-1683. DOI: 10.1111/j.1365-2958.1989.tb00153.x
Vázquez NJ, López VY, Suárez GF, Eslava C and Verdugo RA (2002). Caracterización y clonación de los genes que expresan una enterotoxina LT en Salmonella gallinarum. Anales del 27o Congreso Centroamericano y del Caribe de Avicultura; La Habana. Available at:
http://www.scielo.br/scielo.php?script=sci_nlinks&ref=000155&pi d=S1516-635X200900030000900033&lng=en
Vázquez-Navarrete J, Córdoba BC, López VY and Mancera MA (2005). Identificacion Del gene da la integrasa Tipo I y perfil da resistencia antimicrobiana em Salmonella Enteritidis. Cuajimalpa [cited 2005 nov 24]. Available at: www.vet-uy.com/articulos/artic_micro/001/ micro001 .htm
Verma JC and Gupta BR (1995). Occurrence of Salmonella serotypes in animals in India. Indian Journal of Comparative Microbiology
Immunology and Infectious Diseases, 16(3-4): 104-108. Available at: https://www.researchgate.net/publication/260186075
Wegener HC, Bager F and Aarestrup FM (1997). Vigilancia da resistencia aos antimicrobianos no homem, nos produtos alimentares e no gado na Dinamarca. Euro Surveillance, 3(2):17-19. Available at:
https://www.eurosurveillance.org/content/10.2807/esm.02.03.00180 -pt
Yan H, Li L, Alam MJ, Shinoda S, Miyoshi S-I and Shi L (2010). Prevalence and antimicrobial resistance of Salmonella in retail
foods in northern China. International Journal of Food Microbiology, 143: 230-234. DOI:
10.1016/j.ijfoodmicro.2010.07.034
Zhang H, Shi L, Li L, Guo S, Zhang X and Yamasaki S (2004). Identification and characterization of class 1 integron resistance gene cassettes among Salmonella strains isolated from healthy humans in China. Microbiology and Immunology, 48 (9):639-45. DOI: 10.1111/j .1348-0421.2004.tb03473 .x
TBeBH Ali NM and Mohamed FM (2020). Association of Antiseptic Resistance Gene (qacEAl) with Class 1 Integrons in Salmonella Isolated from Broiler Chickens. J. World Poult. Res., 10 (2S): 214-222. DOI: https://dx.doi.org/10.36380/jwpr.2020.27
