CC BY
77A new species of Physarum (Myxomycetes) from Christmas Island (Australia)
S. L. Stephenson1, Yu. K. Novozhilov2, I. S. Prikhodko2
'University of Arkansas, Fayetteville, USA 2Komarov Botanical Institute of the Russian Academy of Sciences, St. Petersburg, Russia Corresponding author. S. L. Stephenson, [email protected]
Abstract. A new species of Physarum (Myxomycetes), described herein as P. australiense, appeared on a sample of aerial litter in a moist chamber culture prepared as part of a survey of the myxomycetes of Christmas Island in the Indian Ocean. The morphology of representative sporocarps was examined by light and scanning electron microscopy, and micrographs of relevant morphological details of sporocarps and spores are provided. The species is characterized by distinct and unique morphological features, including brownish-red lime knobs or large squamae on the surface of the single layered peridium, a limeless brittle, black stalk, a large clavate columella that attains the center of the sporotheca, and a capillitium with large white angular or rod-like nodes. The combination of these characteristics makes P. australiense a well-defined morphospecies when compared to all other species of Physarum. In addition to the morphological description, partial sequences of three genetic markers of this new species (SSU, EF1a, and COI) were obtained and submitted to GenBank. Phy-logeny, based on the small ribosomal subunit gene (SSU), indicates an affinity of the new species with P. bogoriense and P. hongkongense.
Keywords: Amoebozoa, Myxogastria, fungi-like protists, molecular phylogeny, slime molds, taxonomy, Australia.
Новый вид Physarum (Myxomycetes) c острова Рождества (Австралия) С. Л. Стефенсон1, Ю. К. Новожилов2, И. С. Приходько2
'Университет Арканзаса, Файетвиль, США 2Ботанический институт им. В. Л. Комарова РАН, Санкт-Петербург, Россия Автор для переписки. С. Л. Стефенсон, [email protected]
Резюме. Новый вид Physarum (Myxomycetes), описанный как P. australiense, был обнаружен первым автором в культуре во влажной камере в образце, собранном на наземном листовом опаде во время полевых исследований миксомицетов острова Рождества, в Индийском океане. Морфология референсных образцов была исследована с помощью световой и сканирующей электронной микроскопии, представлены микрофотографии соответствующих морфологических структур спорокарпов и спор. Вид характеризуется выраженными уникальными морфологическими признаками спорокарпов, в том числе коричнево-красными наростами или крупными чешуйками на поверхности перидиума, черной необызвествленной ножкой, крупной булавовидной колонкой, достигающей центра споротеки, и крупными многоугольными или столбиковид-ными обызвествленными белыми узелками капиллиция. Комбинация этих характеристик делает P. australiense хорошо выраженным морфологическим видом, который отличается от всех известных видов миксомицетов рода Physarum. В дополнение к морфологическому описанию были получены и депонированы в базу NCBI GenBank частичные последовательности трех ге-
https://doi.org/10.31111/nsnr/2020.542397
397
нетических маркеров (SSU, EF1a, COI). Филогения, основанная на гене малой рибосомальной субъединицы (SSU), указывает на родство нового вида с P. bogoriense и P. hongkongense.
Ключевые слова: Amoebozoa, Myxogastria, грибообразные протисты, молекулярная филогения, слизевики, таксономия, Австралия.
Physarum (Physaraceae, Physarales) is the largest genus among plasmodial slime-molds. Based on the morphological species concept, more than 140 dark-spored species are currently known worldwide (Lado, 2005-2020). The genus is characterized by the presence of lime in the form of non-crystalline granules in the peridium and the differentiation of the capillitium into lime nodes and tubes (Martin, Alexopoulos, 1969).
Most species of Physarum are associated with decaying wood or ground litter, but some species are corticolous and inhabit the bark surface of living trees and lianas and a few are coprophilous.
Molecular approaches have proved to be effective in elucidating the systematic position of some myxomycete taxa at the level of genus and species (e. g., Winsett, Stephenson, 2008; Fiore-Donno et al., 2012; Novozhilov et al., 2013; Leontyev et al., 2019). However, at the present time sequences of DNA-barcodes such as the small ribosomal subunit (18S rRNA, SSU) have been obtained and submitted to GenBank from only a small part of described species diversity of myxomycetes (Schnittler et al., 2017; Shchepin et al., 2019).
The key macroscopic characters used to distinguish among the different species of Physarum are the type of sporocarp, the shape and color of the stipe, the presence or absence of a columella, and characteristics of the latter if it is present. Microscopic characters include the shape, size and color of lime nodes, the ornamentation on the surface of the spores, the number of layers of the peridium, the structure of the peridium and color, and the color of the spores. Within the genus, two morphological assemblages are well defined by the presence or absence of a columella. Members of the first assemblage can be separated into two subgroups, with the first characterized by a well-developed columella which can be cylindrical to clavate and the second by a small, usually conical or subglobose columella. However, only nine species have been referred to the first subgroup, and most species in the genus Physarum do not have a columella (Lado, 2005-2020).
Material and Methods
Field sampling. The specimen considered herein was recorded during a survey for myxomycetes carried out on Christmas Island (Australia) during a two-week period in June 2017. Specimens that had developed in the field under natural conditions were supplemented by specimens appearing on samples of various types of plant debris collected in the field and then used to prepare a series of moist chamber cultures (Stephenson, Stempen, 1994). The localities where the specimens and/or samples were collected were georeferenced with a portable GPS device (WGS 84 mapping data). The type specimen was deposited in the Herbarium of the Komarov Botanical Institute RAS (LE), with an isotype deposited in the herbarium of the University of Arkansas (UARK).
Microscopy. Air-dried sporocarps were studied with a Zeiss Axio Imager A1 light microscope with differential interface contrast (DIC), a Stemi 2000 dissecting microscope and a JSM-6390 LA scanning electron microscope in the Komarov Botanical Institute RAS (St. Petersburg). For microscopy, sporocarps were preserved as permanent slides in polyvinyl-lactophenol. The freeware program CombineZ was used to create stacked images under a Stemi 2000 dissecting microscope. Microscopic measurements were made with the program Axio Vision 4.8.0.0 (Carl Zeiss Imaging Solutions GmbH, free licence). Features (diameter and ornamentation) were determined for 10 spores per specimen for each of those examined in detail. Specimens for electron microscopy were mounted on copper stubs with double-sided sticky film and sputter-coated with gold. Color notations in parentheses are from the ISCC-NBS color-name charts illustrated with centroid colors (Anonymous, 2007).
DNA extraction and sequencing. Dried sporocarps were placed in a 2 ml safe-lock tubes with 3 mm diam. steel balls and frozen at -20°C. Afterwards, the samples were crushed in TissueLyser LT homogenizer (QIAGEN). DNA was extracted with a magnetic bead-based DNA extraction kit PhytoSorb (Sintol, Russia) according to the manufacturer's protocol. Amplicons of three genetic markers were obtained as already described (Bortnikov et al, 2018; Novozhilov et al, 2019): 18S rRNA gene (SSU) using primer pairs S1/SU19R or S2/SU19R, translation elongation factor 1-alpha gene (EF1a) with primers PB1F/PB1R and cytochrome c oxidase subunit 1 gene (COI) with primers COIF1/COIR1. Primer sequences and references are listed in Table 1. PCR products were purified using CleanMag DNA (Evrogen, Russia) purification kit, then sequenced with BrilliantDye Terminator v3.1 Cycle Sequencing Kit (NimaGen, The Netherlands). Sequencing products were purified using Nimagen D-Pure DyeTer-minator Cleanup kit and then separated on the ABI 3500 DNA sequencer (Applied Biosystems, USA). New sequences have been submitted to GenBank under accession numbers MT702632, MT704208-MT704260 and MT709333 (see Supplementary 11).
Table 1
Primers used in this study
Primer name Sequence (5' - 3') Reference
S1 AACCTGGTTGATCCTGCC Fiore-Donno et al., 2008
S2 TGGTTGATCCTGCCAGTAGTGT
SU19R GACTTGTCCTCTAATTGTTACTCG Fiore-Donno et al., 2011
COIF1 CTGCWTTAATTGGTGGBTTTGG Feng, Schnittler, 2015
COIR1 ACGTCCATTCCKACWGTRTAC
PB1F ACCCGTGAGCACGCTCTCCT Novozhilov et al., 2013
PB1R CGCACATGGGCTTGGAGGGG
Alignment and phylogenetic analyses. The newly obtained SSU sequences and the sequences from taxa of interest deposited in the NCBI GenBank were
1 Electronic supplements are available at the end of the article page on the journal website (https://doi.org/10.31111/nsnr/2020.542.397).
combined in multiple alignment in Unipro UGENE (Okonechnikov et al., 2012) and aligned using MAFFT online service (Katoh, Standley, 2013; Katoh et al, 2019) with the E-INS-I option and default gap penalties. The final alignment comprised 114 sequences and 830 aligned positions with 542 distinct patterns and 385 constant sites. Maximum likelihood analyses were performed using IQ-TREE 1.6.12 (Nguyen et al., 2015) launched on local machine. The TIM2e+I+G4 model was selected according to ModelFinder tool implemented in the program (Kalyaanamoorthy et al., 2017). One thousand ultrafast bootstrap replicates (Hoang et al., 2018) were performed to obtain confidence values for the branches. Bayesian analysis was performed on the same dataset using MrBayes 3.2.6 (Huelsenbeck, Ronquist, 2001) run at CIPRES portal (Miller et al., 2010), GTR model with y was applied. Phylogenetic analysis was run four times as four separate chains for 10 million generations (sampling every 1000). The quality of chains was estimated using Tracer 1.7.1 (Rambaut et al., 2018); based on the estimates by Tracer, the first 2.5 million generations were discarded for burn-in. The resulting phylogenetic tree can be seen in Supplementary 2.
Results and Discussion
Physarum australiense S. L. Stephenson, Novozh. et Prikhodko, sp. nov. (Plate I) MycoBank: MB 836165
GenBank MT704232 (SSU), MT702632 (COI), MT709333 (EF1a)
Sporocarps in small groups, stalked, 600-800 |im total height (Plate I: 1, 2). Sporotheca greyish mottled, globose, 250-400 |im in diam. (Plate I: 1, 2, 3). Stalk stout, slightly tapering upward, roughened, rugose, limeless, brittle, black, one-half or more of the total height of the sporocarp (Plate I: 2). Hypothallus black, venu-lose, forming small patches (Plate I: 1). Columella long, large, clavate, calcareous, attaining the center of the sporotheca, yellowish white in the upper part and dark brown or black in the bottom part (Plate I: 7). Peridium consisting of a single layer, membranous, greyish, encrusted with prominent lime knobs 20-30 |im in diam., brownish-red grayish reddish orange (gy.rO 39) or dark reddish orange (d.rO 38 ) in central portion and yellowish-white (yWhite 92) at the periphery (Plate I: 2, 3), filled with brownish-orange (brO 54) lime granules (Plate I: 6), observed by transmitted light microscope (LM) with differential interference contrast (DIC), sometimes persisting at the base of the sporotheca as a strong yellowish-brown (s.yBr 74) or brownish-orange (brO 54) calyculus (Plate I: 3), sometimes ornamented with black spots. Capillitium densely reticulate, composed of short hyaline tubes and large angular, and elongated sometimes rod-like "badhamioid" lime nodes (Plate I: 8, 9), these filled with pale yellow (p.Y 89) lime (Plate I: 8). Spores dark olive brown (d.OlBr) in mass (Plate I: 3), moderate yellowish brown (m.yBr 77) in LM (Plate I: 3), globose, (7.9)9.0-9.5(11.5) |im in diam. (mean: 9.38 |im, SD: 0.75, n = 30), densely prominently verrucose, with the surface ornamentation formed by groups of warts 0.2-0.3 |im in height (Plate I: 10). Plasmodium unknown.
Plate I. Physarum australiense S. L. Stephenson, Novozh. et Prikhodko sp. nov. (from holotype LE 327851). 1 — colony of sporocarp as viewed under a dissecting microscope (DM); 2 — closed sporocarp (DM); 3 — opened sporotheca (upper part of the photograph) and sporotheca with calyculus (bottom part of the photograph) seen under DM; 4 — sporocarp under SEM; 5 — lime knobs on the surface of peridium under SEM; 6 — lime knobs of the peridium as seen using a transmitted light microscope (LM) with differential interference contrast (DIC); 7 — opened sporocarp with the large clavate columella (DM); 8 — capillitium lime nodes and spores (LM, DIC); 9 — capillitium lime nodes under SEM; 1G - detail of spore ornamentation under SEM.
Scale bars: 1 — 500 |im; 2-4, 7 — 1GG |im; 5 — 2G |im; 6, 8, 9 — 1G |im; 1G — 1 |im.
Type. Australia, Christmas Island, disturbed area of vegetation just off North Baseline Road (10°30'46"S, 105°38'32"E), ca 230 m a. s. l., tropical evergreen tall forest, sample of aerial litter placed in a moist chamber culture in September 2017 and sporocarps removed in November 2017, Stephenson SLS 57502 (holotype LE 327851, isotype UARK).
Etymology. Refers to the geographical region where the type specimen was found.
Distribution. Physarum australiense is currently known only from one locality in Australia.
Differentiation. The most distinctive and unique features of Physarum australiense are the large, clavate, calcareous columella, which is white in the upper part and dark brown or black in the bottom part, the fact that this structure attains the center of the sporotheca, and the prominent brownish-red lime knobs on surface of the peridium. This combination of characters of the columella and peridium has not been reported previously for any species of Physarum with stalked sporocarps. The size and proportion of columella and lime nodes of capillitium of P. australiense are similar to those of P. crateriforme Petch (1909) and P. crateriforme var. columellatum D. W. Mitch. (McHugh et al., 2003) but these taxa have a white sporotheca with dense scattered lime deposits or gray with scanty lime deposits on a thin iridescent wall and do not have prominent brownish-red lime knobs on surface of peridium. Another species of Physarum with stalked sporocarps and a prominent columella is P. dictyospermum Lister et G. Lister (Lister, Lister, 1905), but the latter has the a conical or hemispherical black columella and reticulate spores and is distinguished from all other species of the genus by its unique spores. None of these species or any other member of the Physarum has the unique combination of a calcareous large clavoid columella and prominent brownish-red lime knobs on surface of the peridium.
In addition to the morphological description, partial sequences of three genetic markers of this new species (SSU, EF1a, COI) were obtained and submitted to GenBank. Phylogeny, based on the small ribosomal subunit gene (SSU) (see the list of specimens in Supplementary 1 and the phylogenetic tree in Supplementary 2), indicates affinity of the new species with Physarum bogoriense Racib. (Raciborski, 1898; Whitney, Keller, 1982), and P. hongkongense Chao H. Chung (Chung, Tzean, 1998). However, both species have sessile sporocarps that differ significantly from those of P. australiense. Only a single morphological character, the reddish-brown blotches (knobs) on surface of peridium, is shared by P. bogoriense var. matsumotoi Y. Yamam. (Yamamoto, 2000) and P. australiense. Additional studies of marker gene sequences of other species of the genus Physarum are needed to obtain a more reliable picture of the relationships of the new species and other already described species within the genus.
Acknowledgments
This work for I. S. Prikhodko and Y. K. Novozhilov was supported by Russian Foundation for Basic Research (project 18-04-01232 A), the state task of BIN RAS "Bio-
diversity, ecology, structural and functional features of fungi and fungus-like protists" (AAAA-A19-119020890079-6) and the project "Taxonomic and ecological diversity of mycobiota of tropical forests in Vietnam, E-1.5" of the state task "Tropical Ecology" of the Joint Russian-Vietnamese Tropical Research and Technological Centre. In addition, we acknowledge the use of the equipment of the Core Facility Center "Cell and Molecular Technologies in Plant Science" at the Komarov Botanical Institute RAS (St. Petersburg).
References
Anonymous. 2007. NBS/ISCC Color System. https://web.archive.org/web/20171219173446/ http://tx4.us/nbs/nbs-i.htm (Date of access: 11 VII 2020).
Bortnikov F. M., Shchepin O. N., Gmoshinskiy V. I., Prikhodko I. S., Novozhilov Y. K. 2018. Diderma velutinum, a new species of Diderma (Myxomycetes) with large columella and triple peridium from Russia. Botanica Pacifica: a journal of plant science and conservation 7(2): 47-51. https://doi.org/10.17581/bp.2018.07207 Chung C.-H., Tzean S.-S. 1998. Observations on Physarum hongkongense (Physarales, Myxomycetes) from Taiwan. Fungal Science 13(3-4): 109-112. https://doi.org/10.7099/FS.199812.0109 Hoang D. T., Chernomor O., von Haeseler A., Minh B. Q., Vinh L. S. 2018. UFBoot2: Improving the Ultrafast Bootstrap Approximation. Molecular Biology and Evolution 35(2): 518-522. https://doi.org/10.1093/molbev/msx281 Feng Y., Schnittler M. 2015. Sex or no sex? Group I introns and independent marker genes reveal the existence of three sexual but reproductively isolated biospecies in Trichia varia (Myxomycetes). Organisms Diversity and Evolution 15: 631-650. https://doi.org/10.1007/s13127-015-0230-x Fiore-Donno A.-M., Meyer M., Baldauf S. L., Pawlowski J. 2008. Evolution of dark-spored Myxomycetes (slime-molds): Molecules versus morphology. Molecular Phylogenetics and Evolution 46(3): 878-889. https://doi.org/10.1016Xj.ympev.2007.12.011
Fiore-Donno A. M., Novozhilov Y. K., Meyer M., Schnittler M. 2011. Genetic structure of two pro-tist species (Myxogastria, Amoebozoa) suggests asexual reproduction in sexual amoebae. PLoS One 6(8): e22872. https://doi.org/10.1371/journal.pone.0022872
Fiore-Donno A. M., Kamono A., Meyer M., Schnittler M., Fukui M., Cavalier-Smith T. 2012. 18S rDNA phylogeny of Lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa). PLoS One 7(4): e35359. https://doi.org/10.1371/journal.pone.0035359 Huelsenbeck J. P., Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinfor-matics 17(8): 754-755. https://doi.org/10.1093/bioinformatics/17.8.754
Kalyaanamoorthy S., Minh B. Q., Wong T. K. F., von Haeseler A., Jermiin L. S. 2017. ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods 14: 587-589. https://doi.org/10.1038/nmeth.4285 Katoh K., Standley D. M. 2013. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Molecular Biology and Evolution 30(4): 772-780. https://doi.org/10.1093/molbev/mst010 Katoh K., Rozewicki J., Yamada K. D. 2019. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20(4): 1160-1166. https://doi.org/10.1093/bib/bbx108
Lado C. 2005-2020. An on line nomenclatural information system of Eumycetozoa. http://www.
nomen.eumycetozoa.com (Date of access: 11 VII 2020). Leontyev D. V., Schnittler M., Stephenson S. L., Novozhilov Y. K., Shchepin O. N. 2019. Towards a phylogenetic classification of the Myxomycetes. Phytotaxa 399(3): 209-238. https://doi.org/10.11646/phytotaxa.399.3.5
Lister A., Lister G. 1905. Mycetozoa from New Zealand. The Journal of botany, British and Foreign 43: 111-114.
McHugh R., Stephenson S. L., Mitchell D. W., Brims M. H. 2003. New records of Australian Myxo-mycota. New Zealand Journal of Botany 41(3): 487-500. https://doi.org/10.1080/0028825X.2003.9512865
Martin G. W., Alexopoulos C. J. 1969. The Myxomycetes. Iowa City: 561 p.
Miller M. A., Pfeiffer W., Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Gateway Computing Environments Workshop (GCE): 1-8. https://doi.org/10.1109/GCE.2010.5676129
Nguyen L.-T., Schmidt H. A., von Haeseler A., Minh B. Q. 2015. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 32(1): 268-274. https://doi.org/10.1093/molbev/msu300
Novozhilov Y. K., Okun M. V., Erastova D. A., Shchepin O. N., Zemlyanskaya I. V., García-Carvajal E., Schnittler M. 2013. Description, culture and phylogenetic position of a new xerotolerant species of Physarum. Mycologia 105(6): 1535-1546. https://doi.org/10.3852/12-284
Novozhilov Y. K., Prikhodko I. S., Shchepin O. N. 2019. A new species of Diderma from Bidoup Nui Ba National Park (southern Vietnam). Protistology 13(3): 126-132. https://doi.org/10.21685/1680-0826-2019-13-3-2
Okonechnikov K., Golosova O., Fursov M. 2012. Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics 28(8): 1166-1167. https://doi.org/10.1093/bioinformatics/bts091
Petch T. 1909. New Ceylon Fungi. Annals Royal Botanical Gardens, Peradeniya 4: 299-371.
Raciborski M. 1898. Über die Javanischen Schleimpilze. Hedwigia 37: 50-55.
Rambaut A., Drummond A. J., Xie D., Baele G., Suchard M. A. 2018. Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Systematic Biology 67(5): 901-904. https://doi.org/10.1093/sysbio/syy032
Schnittler M., Shchepin O. N., Dagamac N. H. A., Borg Dahl M., Novozhilov Y. K. 2017. Barcoding myxomycetes with molecular markers: challenges and opportunities. Nova Hedwigia 104(1-3): 323-341. https://doi.org/101127/nova_hedwigia/2017/0397
Shchepin O. N., Schnittler M., Dagamac N. H. A., Leontyev D. V., Novozhilov Y. K. 2019. Unexplored diversity of the tiniest myxomycetes: evidences from environmental DNA. Plant Ecology and Evolution 152(3): 499-506. https://doi.org/10.5091/plecevo.2019.1621
Stephenson S. L., Stempen H. 1994. Myxomycetes: a Handbook of Slime Molds. Portland, Oregon: 183 p.
Whitney K. D., Keller H. W. 1982. A new species of Badhamia, with notes on Physarum bogoriense. Mycologia 74(4): 619-624. https://doi.org/10.1080/00275514.1982.12021558
Winsett K. E., Stephenson S. L. 2008. Using ITS sequences to assess intraspecific genetic relationships among geographically separated collections of the myxomycete Didymium squamulosum. Revista Mexicana de Micología 27: 59-65.
Yamamoto Y. 2000. Notes on Japanese myxomycetes (IV). Bulletin of the National Science Museum Tokyo, Series B 26(3): 107-122.
