CC BY
33
Protistology 10 (4), 117-129 (2016)
Protistology
Disentangling the taxonomic structure of the Lepido-derma chailletii-carestianum species complex (Myxo-gastria, Amoebozoa): genetic and morphological aspects
Oleg N. Shchepin12, Yuri K. Novozhilov1 and Martin Schnittler2
1 Komarov Botanical Institute of the Russian Academy of Sciences, Laboratory of Systematics and Geography ofFungi, Prof. Popov Street 2, 197376 St. Petersburg, Russia
2 Institute ofBotany and Landscape Ecology, Ernst Moritz Arndt University, Soldmannstr. 15, D-17487 Greifswald, Germany
| Submitted September 9, 2016 | Accepted October 5, 2016 |
Summary
Phylogenetic relationships within the taxonomically difficult species complex Lepidoderma chailletii-carestianum (Myxogastria, Amoebozoa) were investigated by partial sequences of three independent genetic markers (18S rRNA, elongation factor 1 alpha, and cytochrome c oxidase subunit 1 genes). The resulting phylogenies were largely congruent in their topologies. Together with the analysis of morphological traits of fruiting bodies, the results supported the hypothesis that L. chailletii and L. carestianum are two separate valid species. Within the morphospecies L. chailletii, two clades were found that are quite divergent from L. chailletii sensu stricto, one of them clustering closely with L. alpestroides but morphologically differing from it. The second part of the cytochrome oxidase subunit 1 gene showed significant variation due to RNA editing; this mitochondrial genetic marker is likely useful for barcoding and phylogenetic reconstructions in dark-spored myxomycetes.
Key words: Amoebozoa, Myxogastria, myxomycetes, molecular phylogenetics, nivicolous myxomycetes, slime molds, cryptic speciation
Introduction
Myxomycetes (or Myxogastria), also called plasmodial slime molds, represent a monophyletic group of protists within Amoebozoa (Adl et al. 2005, 2012; Ruggiero et al., 2015) characterized by the alternation of amoeboflagellate and plasmodial vegetative stages and by the ability to form complex spore bearing structures called sporocarps (Schnitt-
ler et al., 2012). Since the sporocarps can be easily preserved in herbaria and show more morphological characters than available for most other groups of protists, the taxonomy of this group is based predominantly on the morphological species concept (Clark, 2000; Schnittler and Mitchell, 2000). However, the classical taxonomy based solely on morphological traits appears to produce a lot of para- and polyphyletic taxa, as revealed
doi:10.21685/1680-0826-2016-10-4-1 © 2016 The Author(s)
Protistology © 2016 Protozoological Society Affiliated with RAS
in recent studies utilizing molecular phylogenetic data (e.g., Physarum: Nandipati et al., 2012; Liceida and Trichiida: Fiore-Donno et al., 2013; Clastodermataceae: Kretzschmar et al., 2015; Perichaena: Walker et al. 2015; Tubifera: Leontyev et al., 2015). Another problem is an often presence of several genetically distinct lineages within morphologically circumscribed species. By the use of independent markers it could be shown in several cases that these lineages are likely to be reproduc-tively isolated, thus confirming experiments with some cultivable members of the Physarales (see Clark and Haskins, 2010). This cryptic diversity seems to be more the rule than the exception for myxomycetes, and these putative biospecies may or may not show subtle differences in fruit body morphology. Examples include two studies with 18S rRNA genes showing multiple ribotypes, sometimes with geographical restriction (Physarum pseudonotabile, Novozhilov et al., 2013a; Badhamia melanospora, Aguilar et al., 2013), and several studies using multiple markers (Lamproderma co-lumbinum and L. puncticulatum, Fiore-Donno et al., 2011; Trichia varia, Feng and Schnittler, 2015; Meriderma spp., Feng et al., 2016; Hemitrichia ser-pula, Dagamac et al., 2016 and Physarum albescens, Shchepin, unpublished). Most of the latter studies revealed at least some of the putative biospecies to differ by their spore ornaments, but in no case such characters were sufficient to allow an unambiguous separation of specimens.
Many taxonomically difficult (i.e., morphologically variable) morphospecies are still waiting for being studied using genetic markers, and among them is the species complex of two dark-spored nivicolous myxomycetes, Lepidoderma chailletii Rostaf. and L. carestianum (Rabenh.) Rostaf. Due to often indistinct morphological differences, the validity of L. chailletii was questioned by Lister (1911) who suggested considering it as a variety of L. carestianum. Kowalski (1971) synonymized the two taxa, but in recent monographs L. chailletii and L. carestianum are usually treated as separate valid taxa (Lado, 2005-2016; Poulain et al., 2011). However, several other taxa described independently are now put into synonymy: L. granuliferum (W. Phillips) R.E. Fr. with L. carestianum (Lado and Ronikier, 2008); L. didermoides Kowalski and L. aggregatum Kowalski with L. chailletii (Lado, 2005-2016). In addition, the recently described Lepidoderma alpestroides Mar. Mey. and Poulain is often difficult to separate morphologically from L. chailletii.
So far, the few partial 18S rRNA gene sequences of L. chailletii, L. carestianum and other Lepidoderma species obtained in some recent studies did not show any clear separation between these species, but raised even more questions (Novozhilov et al., 2013b; Kamono et al., 2013). Here we present first results on phylogenetic relationships within the Lepidoderma chailletii-carestianum species complex obtained using a combined molecular phylogenetic and morphological approach, with an emphasis on genetic diversity within L. chailletii morphospecies.
Material and methods
DNA extraction and sequencing
Specimens of sporocarps deposited in the myco-logical herbarium of the Komarov Botanical Institute, Laboratory of Systematics and Geography of Fungi (LE), were used for genetic analysis, totaling 37 specimens determined morphologically as L. chailletii and 5 specimens determined as L. carestianum (Table 1). Determinations were performed according to Poulain et al. (2011). Sporocarps were frozen at -20°C and crushed using a TissueLyser LT homogenizer (QIAGEN) equipped with a steel ball. DNA was extracted with the PureLink Plant Total DNA Purification Kit (Thermo Fisher Scientific) according to the manufacturer's protocol. The purified DNA was used for PCR amplification of partial sequences of three independent genetic markers: 18S rRNA gene (SSU, primers S1/SU19R or S3bF/S31R), translation elongation factor EF-1 alpha (EF1A, primers PB1F/PB1R) and cytochrome c oxidase subunit 1 (COI, also referred to as cox1, primers COIF1/COIR1) genes (Table 2). Sequencing was performed using Big Dye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) on an ABI 3130 sequencer (Applied Biosystems).
Phylogenetic analysis
Chromatograms ofnew sequences were manually checked for base calling errors in BioEdit 7.2.5 (Hall, 1999). In total, 42 SSU, 23 EF1A and 19 COI partial gene sequences were obtained and submitted to GenBank under the accession numbers listed in Table 1. This data set was complemented with SSU sequences from Lepidoderma spp. available in GenBank (Table 3), including L. alpestroides,
Table 1. Herbarium specimens studied and accession numbers of obtained nucleotide sequences
submitted to GenBank
Sample, LE SSU EF1A COI Location Lat (N), Lon (E)
Lepidoderma chailletii
284732 KY123401 German Alps N/A
284811 KY123402 German Alps N/A
285156 KY123403 KY123379 Northern Caucasus 43.43222, 41.69889
285244 KY123404 KY123359 Northern Caucasus 43.43083, 41.70528
285716 KY123405 KY123380 Northern Caucasus 43.43225, 41.69928
285948 KY123406 Leningrad region 60.40006, 30.40736
285955 KY123411 KY123400 Leningrad region 60.40006, 30.40736
285962 KY123412 Leningrad region 60.39869, 30.3985
289753 KY123416 KY123381 KY123360 Khibine mts 67.64489, 33.65708
289759 KY123434 KY123382 KY123361 Khibine mts 67.66667, 33.66667
289768 KY123433 German Alps N/A
289795 KY123417 KY123383 Khibine mts 67.67567, 33.57781
291611 KY123413 German Alps N/A
296490 KY123414 KY123384 German Alps 47.45804, 11.08732
296574 KY123415 German Alps 47.45310, 11.08098
296753 KY123418 KY123362 Northern Caucasus 43.43225, 41.69928
296754 KY123419 KY123385 KY123363 Northern Caucasus 43.43225, 41.69928
296818 KY123420 KY123386 KY123364 Khibine mts 67.64508, 33.63561
297153 KY123421 KY123387 KY123365 Khibine mts 67.69319, 33.58958
297213 KY123422 KY123388 KY123366 Khibine mts 67.67375, 33.67533
297277 KY123423 Valamo island 61.38394, 30.96303
297301 KY123424 Valamo island 61.40942, 31.02367
299175 KY123408 Valamo island 61.40942, 31.02367
299176 KY123410 KY123389 Valamo island 61.40942, 31.02367
299932 KY123409 Valamo island 61.38394, 30.96303
299957 KY123407 Valamo island 61.40942, 31.02367
305731 KY123425 KY123390 Chunatundra mt 67.65581, 32.61589
305839 KY123426 Chunatundra mt 67.65728, 32.61583
305854 KY123427 KY123394 KY123370 Chunatundra mt 67.66044, 32.60289
305861 KY123428 KY123395 KY123371 Chunatundra mt 67.66044, 32.60289
305864 KY123429 Chunatundra mt 67.66044, 32.60289
305867 KY123430 KY123372 Chunatundra mt 67.66044, 32.60289
305868 KY123431 KY123373 Chunatundra mt 67.66044, 32.60289
305945 KY123432 KY123399 KY123374 Khibine mts 67.66758, 33.66953
305946 KY123435 KY123396 KY123375 Khibine mts 67.68333, 33.66667
305947 KY123436 KY123398 KY123376 Khibine mts 67.68333, 33.66667
305952 KY123437 KY123397 KY123377 Khibine mts 67.68333, 33.66667
Lepidoderma carestianum
284700 KY123438 German Alps N/A
285143 KY123439 KY123378 Northern Caucasus 43.41667, 41.7
305765 KY123440 KY123391 KY123367 Chunatundra mt 67.65, 32.6
305798 KY123441 KY123392 KY123368 Chunatundra mt 67.65, 32.6
305805 KY123442 KY123393 KY123369 Chunatundra mt 67.65, 32.61361
L. crustaceum, L. granuliferum, L. peyerimhoffii and Diderma fallax. The latter was included because of its high genetic and morphological similarity with L. peyerimhoffii (Novozhilov et al., 2013b). Three sequences from the model species Physarum polycephalum (X13160.1, AF016243.1 and L14779.1) were chosen as outgroups for SSU, EF1A and COI sequence sets, correspondingly, since this species belongs to Physaraceae, the sister group to Didymiaceae, and it was the only dark-spored myxomycete with all three markers already sequenced at the beginning of this study. Sequences were aligned with MAFFT 7.294 (Katoh and Standley, 2013) using the E-INS-i strategy for SSU and the G-INS-i strategy for protein-coding genes. For the SSU alignment 28 poorly aligned and gappy positions were eliminated using GBlocks 0.91b (Castresana, 2000) with default parameters. Since mitochondrial gene transcripts in myxomycetes are subjected to insertional RNA editing (Traphagen et al., 2010), the codon structure of COI sequences was restored by aligning to the mature mRNA of P. polycephalum (L14769.1) and Didymium iridis (GU182127). The final alignments of 75 SSU, 24 EF1A and 20 COI sequences contained 333, 756 and 627 positions, correspondingly. A multigene alignment was created with sequences of all three markers of15 specimens, again with GBlocks filtering applied to SSU sequences, and totaled 1703 positions.
Maximum likelihood analyses (ML) were performed using IQ-Tree 1.4.3 (Nguyen et al., 2015) with 1000 ultrafast bootstrap replicates (Minh et al., 2013). The substitution models for the ML reconstruction were selected independently for each marker and for each codon position in protein-coding genes with a Model Test algorithm implemented in IQ-Tree under the Bayesian information criterion. Bayesian analyses (BI) were carried out with MrBayes 3.2.1 (Ronquist and Huelsenbeck, 2003) with 2 runs and 4 million generations, trees sampled every 100 generations. The EF1A and COI alignments were partitioned by codon positions with unlinked model parameters and ratepr option set to "variable". All trees were discarded as burn-in before the two runs reached a standard deviation of split frequencies less than 0.01.
Morphological analysis
Air-dried sporocarps of 24 L. chailletii and 5 L. carestianum specimens were studied with a Zeiss Axio Imager A1 light microscope with
differential interference contrast. For microscopy, sporocarps were preserved as permanent slides in polyvinyl lactophenol. The freeware program CombineZP (www.hadleyweb.pwp.blueyonder. co.uk) was used to create stacked images under a Stemi 2000 dissection microscope with AxioCam MRc5 camera. Microscopic measurements were made with AxioVision 4.8.0.0 software (Carl Zeiss Imaging Solutions GmbH). Spore diameter and ornamentation were determined for 20 spores per specimen, for each of the specimens examined.
Results
Phylogenetic analysis
The SSU phylogeny of Lepidoderma species revealed six distinct clades (A—F) by both ML and BI analyses (Fig. 1). Most of the sequences from L. chailletii and L. carestianum fall into two different clades (A and B, correspondingly), and the only available sequence of L. granuliferum appeared within L. carestianum clade B. Two L. carestianum sequences obtained from GenBank (AM231296.1 and HE614609.1) appear in clade A, indicating taxonomical misidentification; one sequence was already reassigned to L. chailletii (Kamono et al., 2013). Several L. chailletii sequences form two additional and quite divergent clades (C and D), with clade C closely related to a clade with all specimens of L. alpestroides (E). The clade F includes all L. peyerimhoffii and D. fallax sequences as well as one available sequence of L. crustaceum.
The EF1A and COI phylogenies (Figs 2, 3), as well as three-gene phylogeny constructed from the concatenated sequences (Fig. 4), available for only a subset of L. chailletii and L. carestianum specimens of clades A—C, showed the same separate A, B and C clades with high posterior probability and bootstrap support of major branches.
The alignment of COI sequences demonstrates the presence of 22 sites with insertional RNA editing in clades B and C, but only 21 in clade A. Of those, 21 are single-nucleotide insertion sites (20 for clade A); the remaining site is a two-nucleotide insertion. Compared to P. polycephalum (L14779.2), these three Lepidoderma clades possess 5 insertion sites that are absent in P. polycephalum and share all other sites with it (except for the one which is absent in clade A). The COI sequence of L. chailletii sample LE285244 is very divergent from all other L. chailletii
Table 2. Primers used in this study
Name Sequence Specificity, authors
S1 AACCTGGTTGATCCTGCC SSU of dark-spored myxomycetes, Fiore-Donno et al., 2008
SU19R GACTTGTCCTCTAATTGTTACTCG
S3b F TCTCTCTGAATCTGCGWAC SSU of dark-spored myxomycetes, Hoppe and Schnittler, 2015
S31 R AATCTCTCAGGCCCACTCTCCAGG SSU of dark-spored myxomycetes, Dahl et al., unpublished
PB1F ACCCGTGAGCACGCTCTCCT EF1A of dark-spored myxomycetes, Novozhilov et al., 2014
PB1R CGCACATGGGCTTGGAGGGG
COIF1 CTGCWTTAATTGGTGGBTTTGG COI of bright-spored myxomycetes, Feng and Schnittler, 2015
COIR1 ACGTCCATTCCKACWGTRTAC
and L. carestianum sequences and lacks 3 insertional editing sites that are found in all other sequences, but the specimen shows a SSU sequence typical for clade A.
Morphology
The following short descriptions focus on morphological variation within the clades found, with differences referring to the comprehensive description given for clade A.
Lepidoderma chailletii, clade A. Sessile sporo-carps, elongate or of irregular shape, sometimes short, slightly branching plasmodiocarps (Figs 5, 6), densely grouped, almost hemispherical in cross-section, slightly constricted at the bottom, usually 1—3 mm in length. Peridium dark brown to black, with white or pale cream lime scales. Lime scales usually glossy, varying in size and density from loosely scattered flakes to a contiguous crust. Hypothallus, ifpresent, thin, transparent and loosely
covered with lime scales. Columella well-developed in some specimens, pale yellow, but often absent. Capillitium dark-brown, moderately branching and anastomosing, consisting of long threads about 1 ^m diameter, almost smooth, with nodules up to 2 ^m in diameter. Spores dark-brown by transmitted light, globose, covered irregularly with large spines, mean diameter (11)-12-(14.5) ^m (Figs 7, 14 A); in a few spores up to 17.5 ^m.
Lepidoderma chailletii, clade C. Fructifications differ from those of clade A in shorter sporocarps and a smaller (sometimes absent) greyish-white columella. Lime scales never form a contiguous crust in the studied specimens (Figs 8, 9, 14 C).
L. alpestroides Mar. Mey. and Poulain, which is genetically closely related to this clade in SSU phylogeny, differs in several traits. Fructifications of L. alpestroides are elongate flattened plasmodiocarps with bright creamy-white lime crust on the peridium and spores are with mean diameter (12.5)—14—15— (17) ^m (Poulain et al., 2011).
Table 3. Accession numbers of nucleotide sequences downloaded from GenBank
Species GenBank accession #
Lepidoderma chailletii AM231296.1, HE614609.1, JQ898098.1, JQ900774.1, SSU0026, SSU0027, SSU0028, SSU0029, SSU0030, SSU0025, SSU0038, SSU0039
Lepidoderma carestianum JQ812618.1, SSU0035, SSU0036
Lepidoderma crustaceum HE614619.2
Lepidoderma peyerimhoffii JQ812627.1, JQ898099.1
Lepidoderma alpestroides JQ031998.1, SSU0021, SSU0022,SSU0023, SSU0024
Lepidoderma granuliferum SSU0034
Diderma fallax JQ812628.1, JQ812629.1, JQ898089.1, KR029657.1, KR029658.1, KR029659.1, KR029660.1, KR029661.1
Physarum polycephalum X13160.1, AF016243, L14769.1, L14779.1
Didymium iridis GU182127.1
Figs 1—3. Consensus phylogenetic trees for Lepidoderma species (ML + BI) rooted with Physarumpolycephalum. The number of geometric symbols indicates the number of specimens for a genotype. White diamonds are for sequences retrieved from GenBank; circles indicate specimens sequenced in this study: white — for SSU only, black — for two or three markers. Support is indicated for branches with Bayesian posterior probability > 0.7 and bootstrap support values > 50. 1 — SSU phylogeny, clades including sequences of L. chailletii and L. carestianum are shaded in grey; 2 — EF1A phylogeny; 3 — COI phylogeny. Abbreviations of species are: DIDfal — Didermafallax, LEPals — Lepidoderma alpestroides, LEPcar — L. carestianum, LEPcha — L. chailletii, LEPcru — L. crustaceum, LEPgra — L. granuliferum, LEPpey — L. peyerimhoffii.
Fig 4. Three-gene phylogeny of L. chailletii-carestianum species complex rooted with Physarum polycephalum. Support is indicated for branches with Bayesian posterior probability > 0.7 and bootstrap support values > 50. For abbreviations see Figs 1—3.
Lepidoderma chailletii, clade D. The slight differences of the single available specimen in comparison to those of clade A include the more flattened sprocarps and short plasmodiocarps that are not constricted at the bottom and matt bright white lime scales (Fig. 10). A columella is absent. Spore size and ornamentation and features of capillitium do not differ from those of clade A.
Lepidoderma carestianum, clade B. Prominent differences include the worm-like, flattened plas-modiocarps that are up to 10 mm long, sometimes branching. Peridium dark brown or black, densely or loosely covered with matt yellowish or whitish-grey lime scales. Capillitium dark-brown, consisting of intensively branching and anastomosing hollow tubes of irregular diameter varying approximately from two up to 10 ^m, densely covered with minute warts and bearing huge nodules, sometimes up to 20 ^m in width and 50 ^m in length. Spores dark-brown by transmitted light, globose, densely covered with small spines, mean diameter (14.5)—15.5—(16.5) ^m (Figs.11—13, 14 B), with a few spores reaching 25 ^m.
Discussion
The myxomycete genus Lepidoderma consists of several dark-spored species, their amount varying
from 9 to more than 20 according to different authors, not including forms and varieties (Lado, 2005—2016). Nearly all species are nivicolous, i.e. form their fructifications at the edge of melting snow banks in spring. Until now, there were no special studies of the phylogenetic structure of this genus, and the few partial 18S rRNA gene sequences of L. chailletii, L. carestianum and other Lepidoderma species obtained in some recent studies did not elucidate the relationships between them (Novozhilov et al., 2013b; Kamono et al., 2013).
The phylogenies obtained in this study include three independent genetic markers (extrachromosomal SSU, nuclear chromosomal EF1A and mitochondrial COI, see Feng and Schnittler, 2015 for location and inheritance modes). Together with the observed macro- and microscopic morphological traits, our data support the hypothesis that L. chailletii and L. carestianum represent two separate species. However, sequences of five specimens determined morphologically as L. chail-letii form another distinct clade (C) for all three markers, which is genetically closely related to L. alpestroides but morphologically clearly differs from it. Moreover, other three specimens of L. chailletii fall into one more separate clade D, which is quite divergent from the main L. chailletii clade A but, unfortunately, only SSU sequences are available for them. As such, if L. alpestroides is maintained as a species, L. chailletii in its present circumscription
Figs 5—13. Morphological characters of Lepidoderma specimens. 5—7 — Fruiting bodies, spores and capillitium of L. chailletii clade A (LE305839, LE305946, LE297153); 8—9 — fruiting bodies, spores and capillitium of L. chailletii clade B (LE305952, LE289759); 10 - fruiting bodies of L. chailletii clade C (LE296574); 11-13 - fruiting bodies and capillitium with nodules and spores of L. carestianum clade B (LE285229, LE305798). Scale bars: 5, 6, 8, 10, 11 - 1 mm; 7, 9, 13 - 10 ^m; 12 - 50 ^m.
will not form a monophyletic clade.
We thus consider the clade A which includes most of L. chailletii specimens as L. chailletii s. str. For the other two L. chailletii clades (C and D), we could not find any distinct morphological characters that could help to separate them from L. chailletiis. str., their variation in morphological traits lies within
that ofL. chailletii s. str.; therefore, they can be seen as "cryptic species" of L. chailletii. Further studies using scanning electron microscopy to visualize spore ornamentation patterns and sequencing the genetic markers of other Lepidoderma species are needed to clarify their taxonomical status. It is possible that one of these clades is L. aggregatum,
16-I 15'
1 14E
R5
=5 13-
T
B c
Fig. 14. Boxplot representing spore sizes within specimens of Lepidoderma chailletii clades A and C and L. carestianum (clade B). Calculations were performed for five herbarium specimens from each phylogenetic clade.
another nivicolous species which has not yet been sequenced and is synonymized with L. chailletii by some authors (Lado, 2005—2016). The sequence of L. granuliferum from GenBank appeared within L. carestianum clade, seemingly confirming its synonymy, but this taxon should as well be carefully investigated including multiple specimens.
All L. peyerimhoffii and D. fallax sequences obtained from GenBank cluster together into one clade. Given that and their morphological similarity noted previously (Novozhilov et al., 2013b), it is reasonable to reevaluate D. fallax and L. peyerimhoffii under the hypothesis that these taxa constitute a single polymorphic Lepidoderma species. Similar to the results of Nandipati et al. (2012) for the genera Badhamia and Physarum, this study underlines the need of a re-evaluation of generic delimitations, in this case for Diderma and Lepidoderma. The presence of one L. crustaceum sequence from GenBank in the clade formed by D. fallax and L. peyerimhoffii is most probably the result of incorrect taxonomical determination, since this species differs clearly in its morphology.
Most current phylogenetic studies of myxomycetes employ only one or two genetic markers that are usually partial SSU and EF1A sequences. However, the usage of more markers is becoming essential in modern phylogenetics to make phylogenies more reliable since the evolutionary trajectories may differ considerably between genes, even within
one genome (Folk et al., 2016; Scornavacca and Galtier, 2016). In this study, the first half of the cytochrome c oxidase subunit 1 gene (COI) was evaluated as phylogenetic marker for dark-spored myxomycetes with the primers COIF1 and COIR1 developed previously by Feng and Schnittler (2015) for bright-spored species. Employing this marker as well for myxomycetes would bring these protists closer to other groups of organisms: COI is the barcode for animals and the default marker adopted by the Consortium for the Barcode of Life (http://www.barcodeoflife.org/) for all groups of organisms (Purty and Chatterjee, 2016; Coissac et al., 2016). We found that primers COIF1/ COIR1 work well for both dark-spored and bright-spored species and they allowed to amplify fragments about 610 bp length in Lepidoderma, in which 162 positions were variable (two times more than in the studied EF1A fragment of 756 bp length), mostly at the third and the second positions of a codon. This marker has an additional informative feature: myxomycetes are unique in having insertional RNA editing of mitochondrial transcripts (Mahendran et al., 1991; Traphagen et al., 2010). The unedited mitochondrial genes have a broken (incomplete) codon structure and vary in length between species, although the length of the mature mRNA is conservative, lending evidence for a mechanism that inserts the additional bases during transcription. Aligning the gene sequence on the mature mRNA sequence can help to find these insertional editing sites that appear as gaps in the DNA sequence alignment. In the present study we have found that the clade including L. chailletii s. str. is additionally supported by the absence of one insertional editing site which is present in all other studied sequences from Lepidoderma spp. and in Physarum polycephalum. In contrast, five editing sites found in Lepidoderma spp. were absent in P. polycephalum. Thus, the second half of the COI gene can serve as an informative additional marker in further phylogenetic studies of both major clades of myxomycetes and, besides the commonly used SSU gene (Adl et al., 2014), may be suitable for barcoding myxomycetes.
Acknowledgments
This work was supported by grants from RFBR (Russian Foundation of Basic Research, 15-2902622) and DFG (German Research Council, RTG 2010). In addition, we acknowledge the use
of equipment of the Core Facility Center "Cell and Molecular Technologies in Plant Science" at the Komarov Botanical Institute RAS (St. Petersburg).
References
Adl S.M., Simpson A.G., Farmer M.A., Andersen R.A., Andersen O.R., Barta J.R., Bowser S.S., Brugerolle G., Fensome R.A., Fredericq S., James T.Y., Karpov S., Kugrens P., Krug J., Lane
C.E., Lewis L.A., Lodge J., Lynn D.H., Mann
D.G., McCourt R.M., Mendoza L., Moestrup 0., Mozley-Standridge S.E., Nerad T.A., Shearer C.A., Smirnov A.V., Spiegel F.W. and Taylor M.F. 2005. The new higher level classification of eukaryotes with emphasis on the taxonomy of protists. J. Eukaryot. Microbiol. 52, 399-451.
Adl S.M., Simpson A.G.B., Lane C.E., Lukes J., Bass D., Bowser S.S., Brown M.W., Burki F., Dunthorn M., Hampl V., Heiss A., Hoppenrath M., Lara E., Le Gall L., Lynn D.H., Mcmanus H., Mitchell E.A.D., Mozley-Stanridge S.E., Parfrey L.W., Pawlowski J., Rueckert S., Shadwick L., Schoch C.L., Smirnov A. and Spiegel F.W. 2012. The revised classification of eukaryotes. J. Eukaryot. Microbiol. 59, 429-514.
Adl S.M., Habura A. and Eglit Y. 2014. Amplification primers of SSU rDNA for soil protists. Soil Biol. Biochem. 69, 328-342.
Aguilar M., Fiore-Donno A.M., Lado C. and Cavalier-Smith T. 2013. Using environmental niche models to test the 'everything is everywhere' hypothesis for Badhamia. The ISME Journal. 8, 737-745.
Castresana J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Molecular Biology and Evolution. 17, 540-552.
Clark J. 2000. The species problem in the Myxomycetes. Stapfia. 73, 39-53.
Coissac E., Hollingsworth P.M., Lavergne S. and Taberlet P. 2016. From barcodes to genomes: extending the concept of DNA barcoding. Molecular Ecology. 25 (7), 1423-1428.
Clark J. and Haskins E.F. 2010. Reproductive systems in the myxomycetes: a review. Mycosphere. 1 (4), 337-353.
Feng Y. and Schnittler M. 2015. Sex or no sex? Independent marker genes and group I introns reveal the existence of three sexual but reproductively isolated biospecies in Trichia varia (Myxomycetes). Org. Div. Evol. 15, 631-650.
Fiore-Donno A.M., Clissmann F., Meyer M., Schnittler M. and Cavalier-Smith T. 2013. Two-gene phylogeny of bright-spored Myxomycetes (slime moulds, superorder Lucisporidia). PLoS ONE. 8, e62586.
Fiore-Donno A.M., Novozhilov Y.K., Meyer M. and Schnittler M. 2011. Genetic structure of two protist species (Myxogastria, Amoebozoa) suggests asexual reproduction in sexual amoebae. PLoS ONE. 6, e22872.
Folk R.A., Mandel J.R. and Freudenstein J.V. 2016. Ancestral gene flow and parallel organellar genome capture result in extreme phylogenomic discord in a lineage of angiosperms. Syst. Biol. pii: syw083.
Hall T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41, 95-98.
Kamono A., Meyer M., Cavalier-Smith T., Fukui M. and Fiore-Donno A.-M. 2013. Exploring slime mould diversity in high-altitude forests and grasslands by environmental RNA analysis. FEMS Microbiology Ecology. 84, 98-109.
Katoh K. and Standley D.M. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution. 30, 772-780.
Kowalski D.T. 1971. The genus Lepidoderma. Mycologia. 63, 490-516.
Lado C. 2005-2016. An online nomenclatural information system of Eumycetozoa. Electronic database accessible at http://www.eumycetozoa. com/. Last accessed 3 November 2016.
Lado C. and Ronikier A. 2008. Nivicolous myxomycetes from the Pyrenees: notes on taxonomy and species diversity. Part 1. Physarales and Trichiales. Nova Hedwigia. 87, 3-4, 337-360.
Leontyev D.V., Schnittler M. and Stephenson S.L. 2015. A critical revision of the Tubifera ferruginosa-complex. Mycologia. 107, 5, 959-985.
Lister G. 1911. A monograph of the Mycetozoa; a descriptive catalogue of the species in the Herbarium ofthe British Museum. 2d ed. British Museum, London.
Mahendran R., Spottswood M.R. and Miller D.L. 1991. RNA editing by cytidine insertion in mitochondria of Physarum polycephalum. Nature. 349, 434-438.
Nandipati S.C., Haugli K., Coucheron D.H., Haskins E.F. and Johansen S.D. 2012. Polyphyletic origin ofthe genus Physarum (Physarales, Myxomycetes) revealed by nuclear rDNA minichromosome
analysis and group I intron synapomorphy. BMC Evol. Biol. 31 (12), 166.
Novozhilov Y.K., Mitchell D.W., Okun M.V. and Shchepin O.N. 2014. New species of Diderma from Vietnam. Mycosphere. 5, 554—564.
Novozhilov Y.K., Okun M.V., Erastova D.A., Shchepin O.N., Zemlyanskaya I.V., García-Carvajal E. and Schnittler M. 2013a. Description, culture and phylogenetic position of a new xerotolerant species of Physarum. Mycologia. 105, 1535—1546.
Novozhilov Y.K., Schnittler M., Erastova D.A., Okun M.V., Schepin O.N. and Heinrich E. 2013b. Diversity ofnivicolous myxomycetes ofthe Teberda State Biosphere Reserve (Northwestern Caucasus, Russia). Fungal Diversity. 59, 1, 109-130.
Poulain M., Meyer M. and Bozonnet J. 2011. Les Myxomycetes. Federation Mycologique et Botanique Dauphine-Savoie, Sevrier, France.
Purty R.S. and Chatterjee S. 2016. DNA Barcoding: An effective technique in molecular taxonomy. Austin J. Biotechnol. Bioeng. 3, 1, 1059.
Ruggiero M.A., Gordon D.P., Orrell T.M., Bailly N., Bourgoin T., Brusca R.C., Cavalier-Smith T., Guiry M.D. and Kirk P.M. 2015. A higher level classification of all living organisms. PLoS ONE. 10,4,e0119248.
Schnittler M. and Mitchell D.W. 2000. Species diversity in Myxomycetes based on the morphological species concept - a critical examination. Stap-fia. 73, 55-61.
Schnittler M., Novozhilov Y.K., Romeralo M., Brown M. and Spiegel F.W. 2012. Fruit body-forming protists: Myxomycetes and Myxomycete-like organisms (Acrasia, Eumycetozoa). In: Frey W. (ed) Engler's Syllabus of Plant Families, Part 1/1. Blue-green Algae, Myxomycetes and Myxomycete-like organisms, phytoparasitic protists, heterotrophic Heterokontobionta and Fungi p.p., vol. 1/1. 13-th edition edn. Bornträger, Stuttgart.
Scornavacca C. and Galtier N. 2016. Incomplete lineage sorting in mammalian phylogenomics. Syst. Biol. pii: syw082.
Traphagen S.J., Dimarco M.J. and Silliker M.E. 2010. RNA editing of 10 Didymium iridis mitochondrial genes and comparison with the homologous genes in Physarum polycephalum. RNA. 16, 828-838.
Walker L.M., Leontyev D.V. and Stephenson S.L. 2015. Perichaena longipes, a new myxomycete from the Neotropics. Mycologia. 107, 5, 1012-1022.
Address for correspondence: Oleg Shchepin. Komarov Botanical Institute of the Russian Academy of Sciences, Laboratory of Systematics and Geography of Fungi, Prof. Popov Street 2, 197376 St. Petersburg, Russia; e-mail: [email protected]
