A new species of Diderma from Bidoup Nui Ba National Park (southern Vietnam) Текст научной статьи по специальности «Биологические науки»

Protistology 13 (3), 126-132 (2019)

Protistology

A new species of Diderma from Bidoup Nui Ba National Park (southern Vietnam)

Yuri K. Novozhilov, Ilya S. Prikhodko and Oleg N. Shchepin

Komarov Botanical Institute of the Russian Academy of Sciences, Laboratory of Systematics and Geography of Fungi, 197376 St. Petersburg, Russia

| Submitted June 6, 2019 | Accepted July 22, 2019 | Summary

A new species of Diderma, described herein as D. dalatense, was found in ground leaf litter in mixed montane tropical forests (Bidoup Nui Ba National Park) of southern Vietnam. This species was discovered during intensive studies on the distribution and ecology of fungi and myxomycetes in tropical forests of Vietnam in the context of a long-term project Ecolan 1.2. The morphology of representative specimens was examined by light and scanning electron microscopy, and micrographs of relevant details are provided. D. dalatense has unique combination of morphological characters of the sporocarps among species of Diderma including very small (0.2—0.4 mm in diam.) dark-yellow, globose to subglobose sessile sporocarps, large conical or subglobose yellow columella, smooth peridium with three layers resembling that of Leocarpus and irregularly warted spores. In addition to the morphological description, partial sequences of three genetic markers of this new species (SSU, EF1A, COI) were obtained and submitted to GenBank. The stability of the taxonomic characters of the species was confirmed by several collections obtained in different localities of the National Park.

Key words: 18S rRNA, Amoebozoa, COI, EF1A, Myxogastria, myxomycetes, Paleotropics, slime molds

Introduction

Surveys of myxomycetes carried out in montane tropical forests of southern Vietnam in Bidoup Nui Ba National Park (BDB) by the first author in December 2014 in the context of a long-term project Ecolan 1.2 yielded a series of collections of the genus Diderma that could not be identified to a known species in the field. A colony of sporocarps with the

same morphology was collected again in December 2017 in the same area. A thorough examination of these collections in the laboratory indicated that they did not fit any described species of Diderma. In this paper we describe a new species Diderma dalatense based on morphological traits of sporo-carps and spores and provide partial sequences of 18S rRNA, COI and EF1A genes of this new species.

doi:10.21685/1680-0826-2019-13-3-2 © 2019 The Author(s)

Protistology © 2019 Protozoological Society Affiliated with RAS

Material and methods

Field sampling

This paper is based on field collections from BDB centered in the Bidoup Mountain massive (12°08' N, 108°40' E) in the southern Annamite Mountains, on the Dalat Plateau (Lam Dong Province). The topography of BDB is dominated by a range of high mountains, including Bidoup Mt. (2,287 m a.s.l.) and Gia Rich Mt. (1,922 m a.s.l.). The rainy season extends from May to October, and the dry season encompasses the period from December to April. The predominant vegetation of BDB is a montane evergreen forest, with small patches of coniferous forest and middle mountain mixed broadleaved deciduous polydominant forest including members of Fagaceae and Magnoliaceae along with Pinus kesiya, P. dalatensis, and P. krempfii (Kuznetsov et al., 2006; Tran, 2011). Voucher specimens are deposited in the myxomycete collection of the mycological herbarium in the Komarov Botanical Institute, Laboratory of Systematics and Geography of Fungi (LE).

Air-dried sporocarps were studied with a Zeiss motorized stereo microscope (DM) Discovery V20. All microscopic measurements and observations were made under a light microscope with differential interference contrast (LM) Zeiss Axio Imager A1 using the program Axio Vision 4.8.0.0 (Carl Zeiss Imaging Solutions). Size measurements for each specimen are given as the mean values of 25 spores (including spore ornamentation) with standard deviation (SD). Color notations in parentheses are from the ISCC-NBS color-name charts illustrated with centroid colors (Anonymous, 2012). Scanning electron micrographs were obtained with a JSM-6390 LA scanning electron microscope (SEM) at 10—15 kV using cryo-dried specimens mounted on copper stubs using double-sided sticky film and sputter-coated with gold.

DNA extraction and sequencing

Several dried sporocarps of a holotype of Diderma dalatense (LE 317550) were placed in a 2 ml safe-lock tube with a steel ball 3 mm diam. and frozen at —20 °C. After that the sample was crushed in TissueLyser LT homogenizer (QIAGEN). DNA was extracted with Proba-GS nucleic acid isolation kit (DNA-Technology, Russia) according to the manufacturer's protocol. Partial sequences of three

Table 1. Primers used in this study.

Primer name Sequence (5'-3') Authors

S2 TGGTTGATCCTGCCAGTAGTGT Fiore-Donno et al., 2008

SU19R TCGAGTAACAATTAGAGGACA Fiore-Donno et al., 2012

PB1F ACCCGTGAGCACGCTCTCCT Novozhilov et al., 2014

PB1R CGCACATGGGCTTGGAGGGG Novozhilov et al., 2014

COMF GCTCCTG ATATGGCWTTTC Liu et al., 2015

COMRs CATGRAAWGCATATCWARACC Modified from: Liu et al., 2015

genetic markers were obtained as described elsewhere (Shchepin et al., 2016): 18S rRNA gene (SSU, primers S2/SU19R), translation elongation factor 1-alpha gene (EF1A, primers PB1F/PB1R) and cytochrome c oxidase subunit 1 gene (COI, primers COMF/COMRs). Primer sequences and references are listed in Table 1.

Sequence chromatograms were examined in Unipro UGENE (Okonechnikov et al., 2012) and aligned to combine the forward and reverse reads. The resulting sequences were checked across GenBank Nucleotide collection using NCBI BLAST (https://blast.ncbi.nlm.nih.gov/ Blast. cgi? PRO GRAM=blastn) and deposited in GenBank. To demonstrate the level of genetic divergence of the new species, the obtained partial SSU and EF1a sequences were compared to the top of the BLAST output. Percentage of the genetic similarity of the sequences was calculated using usearch_global command in VSEARCH 2.13.4 (Rognes et al., 2016).

Results and Discussion

Diderma dalatense Novozh. Prikhodko et Shchepin, sp. nov. (Fig. 1)

MycoBank 831244

GenBank MK968250 (SSU), MN052806 (COI), MN052807 (EF1A)

Holotype LE 317550

Etymology. The specific epithet refers to the geographical region where all the collections of the new species were made and is derived from the name of the Dalat Plateau in Vietnam.

Macromorphology. Sporocarps grouped in small colonies (Fig. 1, A, B), sessile, about 0.2—0.4 mm diam. Sporotheca globose to subglobose (Fig. 1, B), brownish orange (54). Hypothallus membranous, inconspicuous, transparent. Peridium smooth, resembling that of Leocarpus, 20—30 ^m in

thickness, with three layers. The inner and the outer layers membranous, smooth and thin; the middle layer limy and fragile (Fig. 1, C, D). Dehiscence of the peridium irregular (Fig. 1, B).

Micromorphology. Columella present, large, conical, pale orange yellow (73) tapering at the center of the sporotheca (Fig. 1, D, E). Capillitium dense and reticulate, consisting of hyaline tubes (Fig. 1, F, G) covered by squamae seen under SEM (Fig. 1, F). Spores in mass brownish black (65), grayish reddish brown in LM (46), verruculose, irregularly warted (Fig. 1, G, H), (7.8-8.0)-(8.5-8.9) ^m in diam. (mean: 8.37 ^m, SD: 0.35, n = 30). Plasmodium unknown.

Habitat. Ground leaf litter of deciduous broad-leaved trees in a mixed broadleaved mountain tropical forest. The upper litter layer dries out fast, but the leathery leaves of trees of Fagaceae and Magnoliaceae decay slowly and may accumulate into thick layers, where a specific set of litter-inhabiting species was found including D. dalatense.

Known distribution. Known only from a few sites in BDB in Lam Dong Province of southern Vietnam.

Material examined. Vietnam, Lam Dong Province, BDB, Giang Ly Ranger Station, middle mountain broadleaved deciduous polydominant forest, in depression with numerous coarse wood debris, 12°11'12.0" N 108°40'32.0"E, 1442 m. a.s.l., in upper layer of the ground leaf litter of Quercus sp. and Litocarpus sp., 12th Dec 2017, Yu. Novozhilov (LE 317550, Holotype). Middle mountain broad-leaved deciduous polydominant forest with Faga-ceae, 12°11'07.8" N 108°40'32.2"E, 1523 m. a.s.l., in upper layer of the ground leaf litter of Quercus sp., 13th Dec 2014, Yu. Novozhilov (LE 317449).

The features of the species, including the microscopic traits, were constant among the studied specimens.

Notes. D. dalatense belongs to the subgenus Leangium (Link) Rost., based on Diderma flori-forme (Bull.) Pers. which includes species with cartilaginous, tough, shining peridium (Martin and Alexopoulos, 1969). The new species differs in a number of important characters from other species of Diderma that have sessile globose and subglobose sporangia with the yellowish, reddish brown or

ochraceous three-layered (triple) peridium and developed columella: Diderma velutinum Bortnikov (Bortnikov et al., 2018) and Diderma albocolumella A.C.C. Bezerra et L.H. Cavalc. (Bezerra and Cava-lcanti, 2010).

The former can be distinguished from D. dalatense for its larger sporocarps (0.5—0.9 mm diam. vs. 0.2—0.4 mm diam. in D. dalatense), pale yellow (89) or grayish greenish yellow (105) color of peridium, large, spherical or subspherical columella and large densely warted spores (mean: 12.15 ^m, SD: 0.51, vs mean: 8.37 ^m, SD: 0.35 in D. dalatense). In addition, partial SSU sequence of D. dalatense is only 79% similar to the published sequences of D. velutinum. D. albocolumella described from Brazil (Bezerra and Cavalcanti, 2010) is similar to the new species, because it has a triple peridium, a large spherical columella and warted spores. However, it has flattened hemispherical to discoid sporangia, white columella and larger spores (10.5—13.0).

Our results demonstrate the difficulties in reconciling molecules (DNA markers) with morphology (classical taxonomic descriptions) of this myxomycete morphospecies. D. dalatense has all morphological characters of Diderma including typical triple peridium with middle layer consisting of amorphous granular lime as well as limeless, filamentous branching and anastomosing capillitium. The color and texture of the outer layer of the peridium are similar to those of Leocarpus fragilis (Dicks.) Rostaf. However, the capillitium of D. dalatense consists only of hyaline tubules without calcareous nodes, which are characteristic of capillitium of L. fragilis. In our three-gene ML phylogeny (available at TreeBase with accession number S24769) the new species formed a long branch with an unresolved position within Physa-rales. Moreover, D. dalatense has a low level of genetic similarity to the other species of Diderma (Tables 2 and 3). This indicates a contradiction between the morphology of the new species and the molecular data. Further investigations are needed to verify whether the traditional separation of the genera within the order Physarales is justified well enough (Nandipati et al., 2012; Shchepin et al., 2016; Leontyev et al., 2019).

Fig. 1. Diderma dalatense holotype LE 317550. A — Scattered small sporocarps on leaf litter; B — sporocarps; C — triple peridium under SEM, the outer (ul), middle (ml), and inner (il) layers of the peridium; D — a sporocarp section with a large cone-shaped columella (cl); E — the columella under SEM; F — the surface of the capillitial threads (cp) under SEM; G — spores and threads of capillitium under LM; H — spore under SEM. Scale bars: A, B — 0.2 mm; C, G — 10 ^m; D — 0.1 mm; E — 50 ^m; F — 2 ^m; H — 1 ^m.

Table 2. Similarity of partial 18S rRNA gene sequences of Diderma dalatense to other Physarales

calculated with VSEARCH.

Species Similarity % GenBank Accession #

Diderma fallax 82.9 - 79.7 JQ898089, KU198040, KR029660 and 10 more

Lepidoderma crustaceum 82.9 HE614619

Lepidoderma carestianum 82.5 - 80 HE614618, KY123438, JQ812618, AM231296

Lepidoderma peyerimhoffii 82.4 - 82.3 JQ812627, JQ898099

Diachea subsessilis 80.7 - 80.5 JQ031964, JQ900780

Didymium melanospermum 80.4 - 78.5 MG647913, KU577267

Diachea leucopodia 80.4 - 78.1 KP323370, KF743861, KM977849

Didymium dubium 80.4 KP323375

Diderma meyerae 80.3 - 79.5 KU198052, KR029671

Diderma niveum 80.2 KR029694

Lepidoderma alpestroides 80.2 JQ031998

Physaraceae sp. 80.1 MG429808

Mucilago crustacea 79.9 - 77.6 MH348905, HE614620, DQ903679

Physarum pusillum 79.8 - 79.4 MK336175, MK336174

Didymium sp. 79.8 - 76.4 MG647892, MG662518

Lepidoderma chailletii 79.8 - 76.4 JQ900774, KY123412, JQ898098 and 18 more

Didymium leptotrichum 79.5 MG662514

Didymium trachysporum 79.4 - 78.2 MG662513, MG647912

Leocarpus fragilis 79.1 - 77.9 MF352461, MG647916, MF352460

Didymium difforme 78.8 MG662515

Didymium flexuosum 78.8 MG429800

Didymium quitense 78.5 MG662516

Badhamia melanospora 78.2 - 76.3 MF352448, KC759039, KC759108 and 13 more

Didymium saturnus 77.9 MG677145

Didymium comatum 77.2 MG662512

Physarum cinereum 76.3 MF352471

Craterium minutum 76 MF352456, MF352455

Craterium leucocephalum 75 MF352454

Acknowledgments

The laboratory work was supported by grant from RFBR (Russian Foundation for Basic Research, 18—04—01232). Expeditions and field work of the first author were supported by the program Ecolan 1.2 of the Russian-Vietnamese Tropical Research and Technological Centre, the program "Biodiversity, ecology, structural and functional features of fungi and fungus-like protists" (AAAA-A19-119020890079-6) and the program AAAA-A19-119080990059-1 "Taxonomic diversity, ecology and physiological and biochemical features of fungi and fungus-like protists of Vietnam" of the Komarov Botanical Institute RAS. In addition, we acknowledge the use of equipment of the Core Facility Center "Cell and Molecular Technologies in Plant Science" at the Komarov Botanical Institute RAS (St. Petersburg).

References

Anonymous 2012. NBS/ISCC Colour System. Original and Improved 267 Colour Centroids. Washington, Inter-Society Colour Council. National Bureau of Standards. http://people.csail.mit. edu/jaffer/Color/Dictionaries (accessed May 2019).

Bezerra A.C.C. and Cavalcanti L.D.H. 2010. Diderma albocolumella (Myxomycetes), a new species in the Brazilian Atlantic Forest. Rodriguésia. 61, 1, 105-108.

Bortnikov F.M., Shchepin O.N., Gmoshinskiy V.I., Prikhodko I.S. and Novozhilov Y.K. 2018. Diderma velutinum, a new species of Diderma (Myxomycetes) with large columella and triple peridium from Russia. Botanica Pacifica. 7, 47-51.

Fiore-Donno A.M., Meyer M., Baldauf S.L. and Pawlowski J. 2008. Evolution of dark-spored Myxomycetes (slime molds): molecules versus

Table 3. Similarity of partial translation elongation factor 1-alpha (EF1A) gene sequences of Diderma dalatense

to other Physarales calculated with VSEARCH.

Species Similarity % GenBank Accession #

Physarales sp. 91.2 - 90.6 MG430298, MG430297, MG430296, MG430295

Physarum album 90.9 EF513196

Physarum leucopus 90.7 - 90 MF352528, MF352529

Physarum melleum 90.7 - 90 MF352535, MF352534, MF352533

Craterium leucocephalum 90.7 MF352500

Physarum leucophaeum 90.7 - 89 KC473814,FJ546685

Diderma pseudotestaceum 90.2 KJ676602, KJ676604

Physarum contextum 90 MF352523

Physarum notabile 90 KC473820

Physarum polycephalum 90 AF016243

Physarum pusillum 90 KC473819

Badhamia nitens 89.8 MF352498

Badhamia panicea 89.7 FJ546661

Craterium minutum 89.5 MF352502

Physarum bivalve 89.4 MF352515

Lepidoderma carestianum 89.3 - 89 KY123391, KY123392, KY123393

Diderma velutinum 89.2 MH717085, MH717084

Diderma cattiense 89.1 - 88.9 KJ676603, KJ676601

Lepidoderma chailletii 88.9 - 88.6 KY123380, KY123382, KY123399 and 13 more

Lepidoderma tigrinum 88.7 EF513195

Fuligo septica 88.2 AY643817

Comatricha nigricapillitia 87.7 AY643818

Diderma europaeum 87.7 EF513191

morphology. Mol. Phylogenet. Evol. 46, 878-889.

Fiore-Donno A.M., Kamono A., Meyer M., Schnittler M., Fukui M., Cavalier-Smith T. 2012. 18S rDNA phylogeny of Lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa). PLoS One. 7, 4, e35359.

Kuznetsov A.N., Kuznetsova S.P. and Luong P. 2006. Vegetation of the Hon Ba Bidoup Mountain Range, Khanh Hoa Province, South Vietnam. In: Materials of Zoological and Botanical Studies in Bidoup and Hon Ba Mountains, Dalat Plateau, southern Vietnam. Ser. Bioraznoobrazie V'etnama (Eds: Korzun L.P., Rozhnov V.V. and Kalyakin M.V.). KMK Scientific Press, Moscow-Hanoi, pp. 9-115 (in Russian with English summary).

Leontyev D.V., Schnittler M., Stephenson S.L., Novozhilov Yu.K. and Shchepin O.N. 2019. Towards a phylogenetic classification of the Myxomycetes. Phytotaxa. 399, 209-238.

Liu Q.S., Yan S.Z. and Chen S.L. 2015. Further resolving the phylogeny of Myxogastria (slime molds) based on COI and SSU rRNA genes. Russ. J. Genet. 51, 46-53.

Martin G.W and Alexopoulos C.J. 1969. The Myxomycetes. Iowa City: Univ. of Iowa Press.

Nandipati S.C., Haugli K., Coucheron D.H., Haskins E.F. and Johansen S.D. 2012. Polyphyletic origin of the genus Physarum (Physarales, Myxomycetes) revealed by nuclear rDNA mini-chromosome analysis and group I intron synapomorphy. BMC Evol. Biol. 12, 166.

Novozhilov Y.K., Mitchell D.W., Okun M.V. and Shchepin O.N. 2014. New species of Diderma from Vietnam. Mycosphere. 5, 554—564.

Okonechnikov K., Golosova O. and Fursov M. 2012. Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics. 28, 1166—1167.

Rognes T., Flouri T., Nichols B., Quince C. and Mahé F. 2016. VSEARCH: a versatile open source tool for metagenomics. PeerJ. 4, e2584.

Shchepin O.N., Novozhilov Y.K. and Schnittler M. 2016. Disentangling the taxonomic structure of the Lepidoderma chailletii-carestianum species complex (Myxogastria, Amoebozoa): genetic and morphological aspects. Protistology. 10, 117—129.

Tran T.T.T. 2011. Spatial distribution and historical dynamics of threatened conifers of the Dalat Plateau, Vietnam. MSc thesis, University of Missouri.

Address for correspondence: Yuri K. Novozhilov. Komarov Botanical Institute of the Russian Academy of Sciences, Laboratory ofSystematics and Geography of Fungi, Prof. Popov Street 2, 197376 St. Petersburg, Russia; e-mail: YNovozhilov@binran.ru..