Научная статья на тему 'Высокопродуктивная линия-продуцент фактора свертывания крови IX человека на основе клеток Cho'

Высокопродуктивная линия-продуцент фактора свертывания крови IX человека на основе клеток Cho Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
603
54
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Acta Naturae (русскоязычная версия)
WOS
Scopus
ВАК
RSCI
PubMed
Ключевые слова
ГЕМОФИЛИЯ B / СИСТЕМЫ ГЕТЕРОЛОГИЧНОЙ ЭКСПРЕССИИ РЕКОМБИНАНТНЫХ БЕЛКОВ / ФАКТОР СВЕРТЫВАНИЯ КРОВИ IX

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Ковнир С.В., Орлова Н.А., Шахпаронов М.И., Скрябин К.Г., Габибов А.Г.

Больные гемофилией B наследственным нарушением свертывания крови нуждаются в регулярном применении препаратов фактора свертывания крови IX. Рекомбинантный фактор IX человека, продуцируемый в культивируемых клетках линии СНО, практически эквивалентен природному фактору IX плазмы крови и широко используется в современной клинической практике. Получение биосимилярного рекомбинантного фактора IX человека предполагает создание клональной клеточной линии с максимально возможной удельной продуктивностью и высоким уровнем удельной прокоагуляционной активности секретируемого фактора IX. Ранее на основе нетранслируемых участков гена фактора элонгации трансляции 1альфа китайского хомячка нами было разработано семейство плазмидных векторов p1.1 и p1.2, позволяющее проводить амплификацию целевого гена в геноме клеток-продуцентов под действием метотрексата, а также котрансфекцию вспомогательных генов, сцепленных с различными селекционными маркерами. Природная область открытой рамки считывания гена фактора IX человека в векторе p1.1 была трансфицирована в клетки линии CHO DG44. В результате трех последовательных шагов амплификации и последующего клонирования получена линия клеток, продуцирующая фактор IX с удельной продуктивностью 10.7 ± 0.4 пг/клетка/день. Прокоагуляционная активность секретируемого фактора IX была практически полностью восстановлена путем котрансфекции клеток плазмидами семейства р1.2, несущими гены растворимого варианта протеазы PACE/furin и витамин К-оксидоредуктазы китайского хомячка. Клональная линия-продуцент 3B12-86 позволяла накапливать фактор IX в бессывороточной культуральной среде до концентрации 6 МЕ/мл при простом периодическом культивировании, при этом копийность интегрированного гена фактора IX составила всего 20 копий/геном, а интегрированных генов PACE/furin и VKORC1 три и две копии/геном соответственно. Фактор IX человека, секретируемый линией 3B12-86, был очищен при помощи трех стадий хроматографии до удельной активности 230 МЕ/мг с выходом более 30%. Полученная клональная линия-продуцент фактора IX и метод очистки продукта позволяют вести экономически обоснованное промышленное производство биосимилярного рекомбинантного фактора IX для терапии гемофилии B.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Ковнир С.В., Орлова Н.А., Шахпаронов М.И., Скрябин К.Г., Габибов А.Г.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Текст научной работы на тему «Высокопродуктивная линия-продуцент фактора свертывания крови IX человека на основе клеток Cho»

УДК 577.2

Высокопродуктивная линия-продуцент фактора свертывания крови IX человека на основе клеток CHO

С. В. Ковнир1, Н. А. Орлова1, М. И. Шахпаронов2, К. Г. Скрябин1, А. Г. Габибов2, И. И. Воробьев12*

1Институт биоинженерии, ФИЦ Биотехнологии РАН, 117312, Москва, просп. 60-летия Октября, 7, корп. 1

2Институт биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова

РАН, 117997, Москва, ул. Миклухо-Маклая, 16/10

*E-mail: ptichman@gmail.com

Поступила в редакцию 03.03.2017

Принята к печати 05.02.2018

РЕФЕРАТ Больные гемофилией B - наследственным нарушением свертывания крови - нуждаются в регулярном применении препаратов фактора свертывания крови IX. Рекомбинантный фактор IX человека, продуцируемый в культивируемых клетках линии СНО, практически эквивалентен природному фактору IX плазмы крови и широко используется в современной клинической практике. Получение биосимилярного рекомбинантного фактора IX человека предполагает создание клональной клеточной линии с максимально возможной удельной продуктивностью и высоким уровнем удельной прокоагуляционной активности секретируемого фактора IX. Ранее на основе нетранслируемых участков гена фактора элонгации трансляции 1альфа китайского хомячка нами было разработано семейство плазмидных векторов pl.1 и p1.2, позволяющее проводить амплификацию целевого гена в геноме клеток-продуцентов под действием ме-тотрексата, а также котрансфекцию вспомогательных генов, сцепленных с различными селекционными маркерами. Природная область открытой рамки считывания гена фактора IX человека в векторе pl.1 была трансфицирована в клетки линии CHO DG44. В результате трех последовательных шагов амплификации и последующего клонирования получена линия клеток, продуцирующая фактор IX с удельной продуктивностью 10.7 ± 0.4 пг/клетка/день. Прокоагуляционная активность секретируемого фактора IX была практически полностью восстановлена путем котрансфекции клеток плазмидами семейства р1.2, несущими гены растворимого варианта протеазы PACE/furin и витамин К-оксидоредуктазы китайского хомячка. Клональная линия-продуцент 3B12-86 позволяла накапливать фактор IX в бессывороточной культураль-ной среде до концентрации 6 МЕ/мл при простом периодическом культивировании, при этом копийность интегрированного гена фактора IX составила всего 20 копий/геном, а интегрированных генов PACE/furin и VKORC1 - три и две копии/геном соответственно. Фактор IX человека, секретируемый линией 3B12-86, был очищен при помощи трех стадий хроматографии до удельной активности 230 МЕ/мг с выходом более 30%. Полученная клональная линия-продуцент фактора IX и метод очистки продукта позволяют вести экономически обоснованное промышленное производство биосимилярного рекомбинантного фактора IX для терапии гемофилии B.

КЛЮЧЕВЫЕ СЛОВА гемофилия B, системы гетерологичной экспрессии рекомбинантных белков, фактор свертывания крови IX.

СПИСОК СОКРАЩЕНИЙ CHO - Chinese hamster ovary - клетки яичника китайского хомячка Cricetulus griseus; DHFR - дигидрофолатредуктаза [КФ 1.5.1.3]; EMCV - вирус энцефаломиокардита; FIX - фактор свертывания крови IX; среда HAT - среда, содержащая гипоксантин, аминоптерин и тимидин; IRES -внутренний сайт связывания рибосом; MTX - метотрексат; PBS - фосфатно-солевой буферный раствор; VKORC1 - субъединица 1 комплекса 2,3-эпоксидредуктазы витамина К [КФ 1.17.4.4]; АЧТВ - активированное частичное тромбопластиновое время; БСА - бычий сывороточный альбумин; МЕ - международная единица активности фактора IX (соответствует содержанию фактора IX в 1 мл пулированной донорской плазмы); ОРС - открытая рамка считывания; ПЦР-РВ - ПЦР в реальном времени.

ВВЕДЕНИЕ

Фактор IX (FIX) - это профермент сериновой про-теазы каскада свертывания крови, которая в присутствии Са2+ и мембранных фосфолипидов гидролизу-ет связь аргинин-изолейцин в молекуле фактора X с образованием активированного фактора Х ^Ха). Нековалентный комплекс факторов 1Ха, VIIIa и X, связанных с фосфолипидной мембраной - «теназа» -является основным элементом петли положительной обратной связи каскада свертывания крови.

Ген FIX расположен на Х-хромосоме. Врожденное отсутствие или низкий уровень функционально активного фактора IX приводят к развитию гемофилии В, X-связанному рецессивному генетическому заболеванию, встречающемуся приблизительно у одного из 30 тысяч мужчин. В частности, гемофилия королевских семей Европы - Royal family disease, обусловлена точечной мутацией гена FIX, приводящей к нарушению сплайсинга его мРНК и появлению неактивного укороченного белка FIX [1].

Первоначально терапия гемофилии В ограничивалась периодическими переливаниями плазмы крови, впоследствии замененными на концентраты протромбинового комплекса - смеси витамин К-зависимых факторов свертывания крови IX, II, VII и X. Основным ограничением такой терапии был риск развития тромбоза. При фракционировании плазмы крови методом Кона получены лекарственные препараты FIX с большей степенью чистоты, содержавшие, однако, примеси активированного FIX (FIXa) и других факторов свертывания, таким образом, риск тромботических эпизодов сохранялся. Дополнительная иммуноаффинная очистка FIX позволила полностью удалять эти примеси, но, как и в случае других продуктов переработки плазмы крови, не устраняла угрозу вирусного или при-онного заражения. Препараты природного FIX, полученные путем очистки на иммобилизованных моноклональных антителах мыши, также могут вызывать аллергические реакции на иммуноглобулин мыши и потенциально способствовать появлению нейтрализующих FIX антител, т.е. ингибиторной формы гемофилии B [2].

Клонирование кДНК FIX [3] и первые успешные попытки получения рекомбинантного FIX в гетеро-логичных системах [4, 5] были проведены в 19801985 гг. В 1986 г. на основе линии CHO получили продуцент FIX с достаточно высокой удельной продуктивностью [6]. Лекарственный препарат реком-бинантного FIX - нонаког альфа (торговое название Бенефикс) - одобрен к применению в США и странах ЕС в 1997 г. В процессе получения лекарственного препарата исключено использование веществ животного происхождения и компонентов донорской

плазмы. Нонаког альфа получают в клетках CHO, культивируемых в питательной среде, не содержащей сыворотки или других продуктов животного происхождения. Выделение и очистку FIX проводят в четыре хроматографические стадии, не используя иммуноаффинную хроматографию, потенциально присутствующие вирусы удаляют при помощи нано-фильтрации на фильтре с порогом отсечения 70 кДа. В готовой лекарственной форме нонакога альфа не используется альбумин человека [7].

Циркулирующий зрелый FIX имеет молекулярную массу около 57 кДа и среднюю концентрацию в плазме крови около 90 нМ. FIX состоит из четырех структурных доменов - Gla-домена, двух ЭФР-подобных доменов (ЭФР - эпидермальный фактор роста) и C-концевого домена сериновой про-теазы. N-Концевой лидерный пептид FIX отделяется при транслокации полипептида в эндоплазматиче-ский ретикулум; пропептид, непосредственно предшествующий Gla-домену, отделяется при секреции зрелого белка. Активационный пептид, расположенный между вторым ЭФР-подобным доменом и доменом сериновой протеазы, отделяется при активации FIX. Активация FIX в каскаде свертывания крови осуществляется активированным фактором XI (внутренний путь) или активированным фактором VII (внешний путь).

Содержащий 12 у-карбоксилированных остатков Glu Gla-домен расположен на N-конце молекулы зрелого FIX. Он обеспечивает связывание FIX и FIXa с поверхностью эндотелиальных клеток [8]. Первый ЭФР-подобный домен FIX содержит высокоаффинный сайт связывания иона кальция, а также обуславливает взаимодействие FIX с фактором VIIIa и с тканевым фактором (фактором III). Второй ЭФР-подобный домен FIX принимает участие в образовании комплекса FIXa-FVIIIa-FX. Он соединяется с доменом сериновой протеазы при помощи ак-тивационного пептида и единственной дисульфидной связи.

Активационный пептид FIX содержит большую часть сайтов посттрансляционных модификаций, влияющих на свойства FIX, в том числе N-связанные олигосахариды [9]. Вследствие этого единственным существенным отличием рекомбинантного FIXa, полученного в клетках CHO, от природного FIXa, является уровень ß-гидроксилирования остатка Asp64, составляющий в природном FIX 0.24 моль/моль, а в рекомбинантном - 0.4 моль/моль [8]. Блокирование этой посттрансляционной модификации при помощи ингибиторов 2-кетоглутарат-ди-оксигеназы не приводило к существенному изменению прокоагуляционной активности FIX. С-Концевой домен сериновой протеазы составляет около полови-

ны общей массы FIX, содержащийся в нем активный сайт скрыт активационным пептидом и экспонируется после его отделения.

Из всех посттрансляционных модификаций только у-карбоксилирование в домене Gla непосредственно определяет прокоагуляционную активность FIX. Тем не менее рекомбинантный FIX, полученный в клетках CHO, имеет одно существенное отличие от природного FIX в качестве лекарственного средства - уровень восстановления прокоагуляционной активности FIX in vivo у пациентов при инфузии препаратов рекомбинантного FIX в среднем в 1.29 раза ниже, чем в случае природного концентрата FIX человека [10]. Причины, вызывающие меньшее восстановление прокоагуляционной активности у ре-комбинантного FIX, остаются неясными, поскольку сравнительные клинические исследования фарма-кокинетики препаратов FIX показывают несколько больший период полувыведения рекомбинантного FIX: 36 ч у рекомбинантного FIX против 32.7 ч у природного FIX [11]. Возможной причиной пониженного восстановления активности рекомбинантного FIX in vivo может быть отсутствие сульфатирования Tyr158 и/или фосфорилирования Ser155 в составе активационного пептида, однако доказательства в пользу этой гипотезы получены только на животных моделях гемофилии B [12].

Во многих случаях продуктивность систем гетеро-логичной экспрессии гена FIX человека определялась не уровнем биосинтеза собственно FIX, а способностью клетки-хозяина осуществлять его корректную посттрансляционную модификацию. В частности, значительная доля секретируемого FIX, продуцируемого в клетках CHO, неактивна при практически любом уровне удельной продуктивности, так как содержит непроцессированный пропептид, полностью блокирующий функционирование Gla-домена. Восстановление нормального процессинга пропеп-тида FIX возможно при коэкспрессии субтилизин/ кексин-подобной конвертазы PACE/furin или гомологичной ей конвертазы PC5. Наилучший уровень удаления пропептида у секретированного FIX может быть достигнут при коэкспрессии укороченного варианта PACE/furin человека, также секретируемо-го в культуральную среду. Таким образом, удаление пропептида может происходить не только в аппарате Гольджи, но и во внеклеточном пространстве [7].

Активность FIX также определяется уровнем у-карбоксилирования остатков Glu в Gla-домене. В полностью активном FIX первые 10 остатков Glu из 12 должны быть конвертированы в остатки Gla. В молекуле природного FIX все 12 остатков Glu в Gla-домене полностью у-карбоксилированы, а в препаратах рекомбинантного FIX уровень мо-

дификации двух последних остатков снижен, что не влияет на свойства FIX. Следует отметить, что стандартный метод очистки рекомбинантного FIX при помощи анионообменной хроматографии с элюцией раствором CaCl2 при низкой ионной силе позволяет эффективно удалять молекулы FIX с нефункциональным Gla-доменом, поэтому недостаточный уровень у-карбоксилирования FIX влияет скорее на выход готового продукта, чем на удельную прокоагуляционную активность очищенного FIX. Общее число остатков Gla в очищенном рекомби-нантном FIX из клеток CHO достигает 11.5 на одну молекулу белка, а удельная прокоагуляционная активность составляет не менее 200 МЕ/мг, что не отличается от удельной активности природного белка.

Реакцию у-карбоксилирования остатков Glu в молекулах витамин К-зависимых белков осуществляет витамин К-зависимая у-глутаминкарбоксилаза (GGCX [КФ 4.1.1.90]) [13], реакция происходит в просвете эндоплазматического ретикулума и предшествует транслокации пробелков в аппарат Гольджи. Источником присоединяемой карбоксильной группы служит растворенный углекислый газ, а донором электронов и кофактором GGCX - восстановленная дигидрохиноновая форма витамина K (KH2), превращающаяся при прохождении реакции в 2,3-эпоксид хинона (K>O). Реакция у-карбоксилирования требует постоянного поддержания существенной концентрации KH2 в просвете эндоплазматического ретикулума. Восстановление K>O до KH2 в клетках позвоночных катализируется ферментным комплексом VKOR, или VKORC (vitamin K oxidoreductase complex), основным компонентом которого является интегральный белок - субъединица 1 комплекса 2,3-эпоксид-редуктазы витамина К (VKORC1 [КФ 1.1.4.1]) [14].

При попытках сверхэкспрессии в клетках CHO гена фактора свертывания крови VII человека (FVII), витамин К-зависимого белка, Gla-домен которого функционален только при полном у-карбоксилировании всех 12 остатков Glu, установлено, что доля функционально активных молекул FVII очень низка и сверхэкспрессия GGCX не приводит к повышению удельной активности FVII. Одновременно с этим сверхэкспрессия гена FVII в клетках линий HepG2 (клетки гепатоцеллюлярной карциномы человека) и BHK (клетки почки сирийского хомяка) позволяет получать преимущественно функционально активный белок. Причиной различий в способности клеток разных линий обеспечивать прохождение реакции у-карбоксилирования является различный уровень активности комплекса VKOR. Сверхэкспрессия гена VKORC1 человека в клетках линии CHO позволяет получить функционально ак-

тивный продукт и существенно повысить скорость секреции фактора VII [15].

Сходные данные получены для FIX, секретируемо-го клетками линии BHK [16]. В системах экспрессии фактора IX в клетках CHO, лимитированных уровнем процессинга пропептида целевого белка, уровень Y-карбоксилирования, обеспечиваемый эндогенным ферментом VKORC1, был достаточен для получения фактора IX с полной функциональной активностью [7]. Тем не менее при существенном увеличении уровня экспрессии гена FIX степень у-карбоксилирования остатков Glu в Gla-домене может существенно снизиться, на что указывают сильные различия в уровне секреции FIX клетками линии HepG2 (трансформированные гепатоциты) и линиями клеток, полученных из других тканей [17]. Клетки HepG2 обладают высокой активностью VKORC1 и соответственно секрети-руют FIX более эффективно.

Обычным способом увеличения витамин К-окси-доредуктазной активности в культивируемых клетках считается их трансфекция плазмидой, кодирующей известный ген VKORC1 человека. Однако относительная каталитическая эффективность этого метода в клетках других видов млекопитающих не очевидна. Ортологи VKORC1 разных видов млекопитающих не полностью гомологичны друг другу, и их каталитическая эффективность in vitro различается примерно в 4 раза [18]. В настоящий момент белковый состав комплекса VKOR не установлен. Наиболее вероятным источником электронов для работы VKORC1 считают тиоредоксин-по-добные белки эндоплазматического люмена, в том числе TMX [19]. Мембранная топология VKORC1 установлена только по аналогии с бактериальным белком из Synechococcus sp. Пространственная цепь переноса электронов к цистеинам активного центра VKORC1 пока не описана, в отличие от его гомолога VKORC1L1 [20].

Мы предположили, что низкая активность комплекса VKOR в клетках линии CHO может быть вызвана не низкой каталитической эффективностью собственного VKORC1 китайского хомячка, а лишь недостаточным уровнем его экспрессии. Таким образом, требуемый максимальный уровень секреции FIX человека в клетках CHO может быть обеспечен путем коэкспрессии целевого гена, растворимого варианта PACE/furin человека и VKORC1 китайского хомячка. При этом необходимый уровень экспрессии вспомогательных генов может быть определен путем отбора клональных линий клеток-продуцентов по доле коагуляционно активных молекул FIX с удаленным пропептидом. Получение и характеристика таких линий-продуцентов FIX являются целью настоящей работы.

ЭКСПЕРИМЕНТАЛЬНАЯ ЧАСТЬ

Создание генетических конструкций для экспрессии генов

Создание экспрессионных векторов p1.1, p1.2-Zeo и p1.2-Hyg описано в работе [21]. Фрагменты ДНК, кодирующие целевые открытые рамки считывания (ОРС) генов FIX человека, VKORC1 человека или китайского хомячка, или фурин человека, слитые с консенсусной последовательностью Козак (GCCGCCATGG) [22], получали методом ПЦР с использованием соответствующих адапторных прай-мерных олигонуклеотидов. Продукты ПЦР выделяли из 1% агарозного геля, используя набор реактивов Wizard SV Gel and PCR Clean-Up System (Promega, США), и лигировали с Т-вектором PAL-TA («Евроген», Москва) при помощи ДНК-лигазы фага T4 (Fermentas, Литва). ПЦР проводили с использованием олигонуклеотидов и смесей для ПЦР Encyclo PCR kit, Tersus polymerase mix, ScreenMix-HS («Евроген») на приборе PTC-100 Thermal Cycler (MJ Research, США). Молекулярное клонирование проводили в штамме Escherichia coli TOPIO (Invitrogen, США). Плазмидную ДНК выделяли при помощи набора GeneJET Plasmid Miniprep Kit (Fermentas, Литва).

В качестве источника ОРС FIX использовали коммерчески доступный клон кДНК FIX человека pCMV6-XL4/NM_000133.2 (sc126517, Origene, США) и адапторные праймеры AD-9-AbsF и AD-9-NheR, приведенные в табл. 1. Область ОРС VKORC1 человека амплифицировали с плазмиды pCMV6-XL4/ NM_024006.4 (sc112318, Origene) с праймерами AD-hVKO-AbsIF и AD-hVKO-NheIR.

С целью получения ОРС VKORC1 китайского хомячка из 2 млн клеток CHO DG44 реагентом TRI Reagent (MRC) выделяли суммарную РНК. кДНК синтезировали при помощи набора MINT («Евроген»), используя 2 мкг РНК-матрицы. Амплификацию кДНК проводили с помощью набора Encyclo PCR Kit, для ПЦР области ОРС использовали прайме-ры vkofl, vkof2, vkorl. Продукт ПЦР клонировали в вектор pAL-TA с получением плазмиды pAL-CHOVKORC1. Нуклеотидная последовательность вставки была депонирована 03.04.2012 в GenBank под номером JQ400047.1. Аминокислотная последовательность ОРС фермента VKORC1 клеток CHO DG44 депонирована в GenBank (03-APR-2012) под номером AFG26681.1. При помощи адапторных праймеров AD-CVKO-AbsIF и AD-CVKO-NheIR и плазмиды pAL-CHOVKORC1 в качестве матрицы получили ПЦР-продукт, содержащий ОРС VKORC1 китайского хомячка с добавленными сайтами рестрикции для субклонирования в экспрессионный вектор.

Таблица 1. Праймеры для клонирования и секвениро-вания экспрессионных плазмид

ОРС РАСЕДигт человека получали путем ПЦР с использованием праймеров AD-FUR-AbsF и AD-FUR-XbaR и плазмиды SC118550 (Origene) в качестве матрицы. ПЦР-продукт, содержащий ОРС растворимого делеционного варианта протеазы PACE/furin человека с делецией двух аминокислот (VQ), клонировали в вектор pAL-TA с образованием плазмиды pAL-Fur, после чего приводили ОРС в соответствие с эталонной последовательностью

NM_002569, вводя шесть недостающих нуклеотидов методом инвертированной ПЦР c использованием праймеров IP-fVQ-F и IP-fVQ-R. Мутагенез проводили согласно [23] со следующими модификациями: праймеры фосфорилировали полинуклеотидкина-зой фага Т4 («Сибэнзим») в буфере для ДНК-лигазы фага Т4 (Fermentas) в течение 30 мин при 37°С. ПЦР проводили с помощью набора Encyclo PCR kit по следующей схеме: 1 цикл - 4 мин, 94°C, 2 мин, 50°C, 2 мин, 72°C; затем 11 циклов - 1 мин, 94°C, 1 мин, 55°C, 2 мин, 72°C; разводили вдвое однократным буфером для эндонуклеазы DpnI, добавляли 10 ед. акт. этой эндонуклеазы и инкубировали при 37°C в течение 30 мин, затем инкубировали при 72°C с 2.5 ед. акт. по-лимеразы Pfu еще 30 мин, продукт ПЦР очищали и лигировали. Для поиска измененных участков ДНК методом ПЦР с колоний использовали специфический олигонуклеотид SQ-fVQ-R.

Полученные плазмиды pAL-F9, pAL-hVKORC1-AN, pAL-CHOVKORC1-AN, pAL-FurVQ секвени-ровали в области вставки, правильные ОРС встраивали в экспрессионные векторы p1.1, p1.2-Zeo или p1.2-Hyg по AbsI-NheI-сайтам. ДНК для транс-фекции выделяли с помощью препаративного набора EndoFree Plasmid MaxiKit (Qiagen, США) или ДНК GeneJet™ Midi (Fermentas). Перед трансфекци-ей секвенировали основные функциональные элементы векторов и повторно области целевых ОРС. Плазмиды линеаризовали эндонуклеазами PvuI (p1.1 и p1.2-Zeo) или BspHI (p1.2-Hygro), осаждали этанолом, растворяли в фосфатно-солевом буфере (PBS) и стерилизовали фильтрацией через 0.22-мкМ фильтры (Millipore, США).

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Культивирование клеток CHO DG44 (Invitrogen) и трансфекцию плазмидой p1.1-F9 проводили как описано в [21]. Через 48 ч после трансфекции клетки помещали в селекционную среду CD CHO (Invitrogen) с 200 нМ метотрексата (MTX) и 8 мМ глутамина и культивировали до восстановления жизнеспособности клеток выше 85% (около 20 дней), пассируя 1 раз в 3-4 дня. Полученную популяцию клеток клонировали методом предельных разведений (1 клетка на лунку) в среде EX-CELL® CHO Cloning Medium (Sigma-Aldrich) с добавлением 8 мМ глутамина и без МТХ. Продуктивные клоны определяли методом ИФА, отобранные клоны последовательно переносили в 24-луночные планшеты, затем в 6-луночные планшеты с культуральной средой ProCHO 5 (Lonza, Швейцария) с 8 мМ глутамина и переводили в суспензионный режим культивирования. Среди клональных культур, не потерявших жизнеспособность в условиях суспензионного культивирования, с помощью ИФА отбирали наиболее

Праймер Нуклеотидная последовательность 5' ^ 3'

FIX

AD-9-AbsF ttcctcgaggccgccaccatgcagcgcgtgaac atg

AD-9-NheR atgctagctttcattaagtgagctttg

9SQf cggtatgtcaactggattaag

9-AS ctgctggttcacaggactt

VKORC1

vkof1 gtcgacatgggcaccacctgag

vkof2 gacatgggca ccacctggag gagccc

vkor1 ctcagggccttttggccttgtgttc

AD-CVKO-AbsIF ttcctcgaggccgccaccatgggcaccacctgg

AD-CVKO-NheIR atgctagctcagggcctttt ggcct

AD-hVKO-AbsIF ttcctcgaggccgccaccatgggcagcacctgg ggga

AD-hVKO-NheIR atgctagctcagtgcctcttagccttg

Фурин

AD-FUR-AbsF ttcctcgaggccgccaccatggagctgaggccctg

AD-FUR-NheR aatctagactatcactcaggcaggtgtgagggc

IP-fVQ-F gctgcagagggagcctcaagtacagtggctgga acagcaggtg

IP-fVQ-R cacctgctgttccagccactgtacttgaggctccc tctgcagc

SQ-FUR639-F caacggtgtctgtggtgtagg

SQ-FUR1228-F gcccacctcaatgccaacg

SQ-FUR1563-R cagggtggagcgggtg

SQ-fVQ-R gttccagccactgtacttg

Праймеры к векторам

T7prom taatacgactcactataggg

SP6 gatttaggtgacactatag

3CH1-Rev acaaacagttctgagaccg

SQ-5CH6-F gccgctgcttcctgtgac

IRESArev aggtttccgggccctcacattg

продуктивные. Для дальнейшей амплификации использовали клон p1.1-F9-T2/S.

Амплификацию проводили в колбах Эрленмейера с 30 мл среды ProCHO с 8 мМ глутамина с добавлением 1, 2, 4 мкМ MTX до восстановления жизнеспособности клеток выше 85% в течение 15-20 дней. Полученную в присутствии 4 мкМ MTX культуру клеток с наибольшей удельной продуктивностью использовали во втором клонировании методом предельных разведений. Отобрали клон 3B12, который реадаптировали для суспензионного культивирования в среде ProCHO 5 и использовали для последовательной котрансфекции линеаризованных плазмид p1.2-Hyg-Fur и p1.2-Zeo-VKORC. Селекцию стабильно трансфицированных популяций проводили при помощи антибиотиков гигромицина Б и зеоцина соответственно. Поликлональную популяцию 3B12-FurVC использовали для окончательного клонирования методом предельных разведений как описано выше. Полученные клоны были последовательно разделены на группы по уровню экспрессии растворимого PACE/furin и уровню прокоагуляционно активного FIX. Отобранные клоны повторно адаптировали к среде ProCHO 5 с 8 мМ глутамина и 1 мкМ витамина K3 (менадионсульфат, Sigma-Aldrich) и суспензионному культивированию в колбах Эрленмейера.

ПЦР в реальном времени

ПЦР-РВ проводили с использованием амплификато-ра iCycler iQ (Bio-Rad, США) и готовой реакционной смеси qPCRmix-HS SYBR («Евроген»), содержащей интеркалирующий краситель SYBR Green I. Каждую реакцию повторяли 3 раза в объеме 25 мкл, в 3-5 повторах. Геномную ДНК выделяли при помощи набора Wizard SV Genomic DNA Purification System (Promega). Суммарную РНК выделяли при помощи набора RNeasy Mini Kit (Qiagen, США). Для получения необходимых количеств кДНК использовали по 1 мкг суммарной РНК и набор реактивов Mint («Евроген»).

Праймеры для ПЦР-РВ подбирали при помощи программы Beacon Designer v7.51, проверяли на специфичность при помощи NCBI BLAST (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi). Использовали праймеры, негомологичные последовательностям китайского хомячка (к области FIX и IRES-DHFR). Данные ПЦР-РВ обрабатывали, используя программу iCycler Iq4, включая расчет эффективности реакций. Число копий вставки экс-прессионной кассеты в геноме рассчитывали по калибровочной кривой, построенной для серийных разведений плазмиды p.1.1-F9. Результаты ПЦР сравнивали с результатами для контрольного ам-пликона из состава гена PPIB, представленного в ге-

Таблица 2. Специфические праймеры для ПЦР в реальном времени

Праймер Нуклеотидная последовательность 5' ^ 3'

RT-F9-F ttagatgtaacatgtaacattaagaatggcag

RT-F9-R cattaaatgattgggtgctttgag

RT-ID-F gccacaagatctgccaccatg

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

RT-ID-R gtaggtctccgttcttgccaatc

RT-HYG-F ttcggctccaacaatgtc

RT-HYG-R gtctgctgctccatacaag

RT-Zeo-F agttgaccagtgccgttcc

RT-Zeo-R ggcgaagtcgtcctccac

RT-FURC-F agcgggacctgaatgtgaag

RT-FURC-R ggtggttcttctcgatgcca

RT-PPIB-F gcaggcaaagacaccaatg

RT-PPIB-R ctccaccttcctcactacatc

RT-bACT-F gctcttttccagccttcctt

RT-bACT-R gagccagagcagtgatctcc

RT^VKOspN-F aacgggtttgccgtcagaac

RT^VKOspN-R cggtaatcctcgtctcgg

RT^VKOspC-F gggcttgatgttgcttaatttc

RT^VKOspC-R gcaggtgttaggggtaatatg

номе клеток CHO только 1 раз, по поисковой выдаче алгоритма BLAST из базы данных NCBI Nucleotide Collection.

Уровень экспрессии мРНК рассчитывали с использованием относительного метода AACq для праймеров с известной эффективностью ПЦР. Относительное увеличение уровня (разы) экспрессии гена, нормированного по контрольному гену, определяли по формуле из [24].

Праймеры для оценки копийности экспрессион-ной кассеты в геноме и уровня мРНК приведены в табл. 2.

Саузерн-блот гибридизация

Биотиновую метку вводили в ДНК при помощи набора Biotin DecaLabel DNA Labeling Kit (Fermentas). В качестве матрицы для получения зондов использовали плазмиду pAL-ID, содержащую общие с экс-прессионными плазмидами p1.1 области начала репликации гена бета-лактамазы, EMCV IRES, ОРС DHFR [21], либо продукт амплификации плазмиды p1.1-F9 с праймеров AD-9-AbsF и AD-9-NheR, соответствующий ОРС FIX. Геномную ДНК для блотин-

га расщепляли эндонуклеазой ApaI в течение 16 ч и разделяли в 0.8% агарозном геле. Подготовку геля и перенос на мембрану Amersham Hybond-N+ (GE Healthcare, США) проводили по протоколу производителя мембраны в буфере с высокой ионной силой 20 х SSC (3 М NaCl, 0.3 М цитрат натрия) в течение 16 ч. ДНК фиксировали нагреванием мембраны до 80оС в течение 2 ч. Прегибридизацию и гибридизацию проводили по [25] в растворе 7% додецилсуль-фата натрия, 0.5 M фосфата натрия, pH 7.2, 1% бычьего сывороточного альбумина (БСА) в течение 16 ч при 65оС. Мембрану промывали по протоколу производителя, детекцию проводили при помощи набора Biotin Chromogenic Detection Kit (Fermentas).

Измерение концентрации FK методом ИФА

Концентрацию FIX определяли по [26] с использованием в качестве иммобилизованного антитела по-ликлональные антитела кролика к FIX (LifeSpan BioSciences, США) по 50 нг/лунку. В качестве специфичного антитела использовали моноклональные антитела мыши HIX-1 (F2645, Sigma-Aldrich). Образцы вносили в лунки без разведения или разводили в PBS с 1% БСА. Долю молекул FIX с неотделенным про-пептидом определяли при помощи ИФА, используя в качестве иммобилизованных антител аффин-но очищенные антитела кролика к синтетическому пептиду, соответствующему пропептиду FIX человека, согласно [27]. Остальные шаги ИФА проводили как указано выше.

Прокоагуляционную активность FIX определяли методом активированного частичного тромбо-пластинового времени (АЧТВ) при помощи «фактор IX-тест» производства НПО «Ренам» (Москва). В качестве стандарта активности использовали рекомбинантный FIX в составе лекарственного средства Benefix (Wyeth, США). Измерения проводили при помощи оптического коагулометра ThromboScreen 400c (Pacific Hemostasis, США).

Измерение активности фурина

Активность фурина определяли при помощи пептидного субстрата с отделяемой группой 7-амино-4-метилкумарина Pyr-Arg-Thr-Lys-Arg-AMC (344935, Merck Millipore, США) по [27].

Измерение активности VKORC1

Активность VKORC1 измеряли с использованием DTT в качестве донора электронов по методике [28]. Субстрат ферментативной реакции - 2,3-эпоксид витамина K1 (K > O) - синтезировали и очищали из хи-ноновой формы витамина K1 (Sigma Aldrich, США) [29].

Выделение и очистка FIX

FIX выделяли и очищали по следующей методике: культуральную среду наносили на колонку с сорбентом Capto MMC, уравновешенную раствором 20 мМ цитрата натрия, pH 7.0, 100 мМ NaCl, 0.02% Твин-80, промывали раствором 20 мМ цитрата натрия, pH 7.0, 0.1 М NaCl. FIX элюировали раствором 20 мМ цитрата натрия, pH 6.5, 200 мМ NaCl, 0.5 М аргинина, 0.02% Твин-80. Элюат разбавляли в 4 раза водой и наносили на колонку с сорбентом Capto Q, уравновешенную раствором 50 мМ Tris-HCl pH 8.0; 100 мМ NaCl; промывали раствором 50 мМ Tris-HCl pH 8.0; 200 мМ NaCl и проводили ступенчатую элюцию растворами 50 мМ Tris-HCl pH 8.0; 10 мМ CaCl2, 100-500 мМ NaCl. Фракции элюата, содержащие FIX с полной прокоа-гуляционной активностью, разбавляли водой в 2 раза и наносили на колонку с сорбентом Capto Heparin, уравновешенную раствором 50 мМ Tris-HCl pH 7.5; 100 мМ NaCl, промывали колонку раствором 50 мМ Tris-HCl pH 7.5; 200 мМ NaCl. FIX элюировали раствором 50 мМ Tris-HCl pH 7.5; 500 мМ NaCl. Раствор очищенного FIX концентрировали ультрафильтрацией при помощи кассеты VivaFlow200 10 ^a PES (Sartorius Stedim, Германия) и переводили в раствор хранения, содержащий 8 мМ L-гистидина, 0.8% сахарозы, 208 мМ глицина, pH 7.2 и 0.004% Твин-80. Раствор очищенного FIX разделяли на аликвоты, замораживали и хранили при температуре ниже -70oC.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Получение линии клеток CHO, экспрессирующих ген фактора IX человека

Область открытой рамки считывания FIX с добавленной синтетической консенсусной последовательностью Козак и блоком стоп-кодонов клонировали в ранее разработанный нами экспрессионный вектор p1.1 на основе некодирующих областей гена фактора элонгации трансляции 1альфа китайского хомячка с образованием экспрессионной плазмиды p1.1-F9 (рис. 1).

Протяженные геномные области и ген фактора элонгации трансляции 1альфа китайского хомячка обеспечивали высокий уровень экспрессии целевых генов и постоянство этого уровня в течение нескольких месяцев последовательных пересевов [21]. Область ОРС гена FIX в плазмиде p1.1-F9 была соединена с селекционным маркером - дигидрофо-латредуктазой мыши (DHFR) при помощи аттеню-ированного внутреннего сайта связывания рибосом вируса энцефаломиокардита (EMCV IRES), что обеспечивало экспрессию единой бицистронной мРНК. Такая структура обеспечивает максимально возможное сцепление целевого гена и селекционного марке-

EEFiA

pl.l-F9

13299 п.н.

Рис. 1. Схемы экспрессионных плазмид p1.1-F9, p1.2-Zeo-VKORC, p1.2-Hyg-Fur. pCHO EEF1A - функциональный промотор гена фактора элонгации 1альфа китайского хомячка, 5'-нетранслируемая область этого гена и не-транскрибируемая область, фланкирующая этот ген; IRES - внутренний сайт связывания рибосом вируса энце-фаломиокардита (EMCV); DHFR - открытая рамка считывания дигидрофолатредуктазы мыши для селективного отбора и амплификации в эукариотических клетках; tCHO EEF1A - функциональный терминатор и сигнал по-лиаденилирования гена фактора элонгации 1альфа китайского хомячка, З'-нетранслируемая область этого гена и нетранскрибируемая область, фланкирующая этот ген; FIX - ОРС фактора IX свертывания крови человека; VKORC - ОРС VKORC1 китайского хомячка; SV40 prom - область промотора вируса SV40; SV40t pA - терминатор и сигнал полиаденилирования вируса SV40; Zeo - ОРС гена Sh ble (Sfrepfoallofeichus hindustanus bleomycin), обеспечивающего устойчивость к зеоцину; Furin - ОРС протеазы PACE/furin человека; Hygro - ОРС гигроми-цин-фосфотрансферазы. Стрелками указаны направления действия промоторов и транскрипции генов

ра, что необходимо для амплификации генетических кассет, интегрированных в геном клеток-продуцентов.

Плазмиду p1.1-F9 линеаризовали с разрушением гена бета-лактамазы и использовали для транс-фекции клеток линии CHO DG44, дефектных по обоим аллелям гена dhfr. Через 48 ч после транс-фекции клетки подвергали первичной селекции в присутствии трех различных концентраций ме-тотрексата - 50, 100, 200 нМ. Во всех трех случаях получены стабильно трансфицированные популяции клеток с уровнями секреции FIX 0.69 ± 0.04, 1.05 ± 0.05 и 1.83 ± 0.24 мкг/мл по данным ИФА соответственно при времени удвоения культур 27-29 ч. Максимальный титр FIX зафиксирован в культуре, полученной в присутствии 200 нМ MTX, поэтому был проведен иммуноблотинг внутриклеточного и секретируемого этой культурой FIX (рис. 2A). Иммунореактивные полосы FIX с некорректной молекулярной массой не были обнаружены, что косвенно свидетельствовало об отсутствии повреждений генетических кассет, интегрированных в геном клеток. Полученную поликлональную культуру использовали для клонирования клеток методом предельных разведений. Клональные линии-продуценты FIX с максимальным титром продукта повторно адаптировали к условиям культивирования в суспензии среде без добавок нуклеотидов и ингибиторов DHFR. Уровень секреции FIX тремя лучшими клональными линиями составил 11.9 ± 0.4,

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

12.3 ± 0.4, 9.9 ± 0.3 мкг/мл после 3 дней культивирования. Для дальнейшей работы выбрали клональную линию p1.1-F9-T2/S с удельной продуктивностью (Qp) 2.99 ± 0.06 пг/клетка/день и временем удвоения 22.5 ч.

Продуктивность клональной линии увеличивали путем амплификации целевого гена под действием возрастающих концентраций метотрекса-та. После повышения концентрации MTX до 4 мкМ получили олигоклональную линию клеток с Qp 5.97 ± 0.18 пг/клетка/день, которую использовали для второго клонирования методом предельных разведений. Среди 12 наиболее продуктивных клонов клеток, повторно адаптированных к суспензионному культивированию, отобрали клон p1.1-F9-T2/4k-3B12 (далее в тексте и на рисунках -3B12) с Qp 10.7 ± 0.4 пг/клетка/день и временем удвоения культуры 20.2 ч (рис. 2Б).

Получение линии клеток, секретирующих биологически активный FIX

FIX, секретируемый клональной клеточной линией 3B12, был практически полностью неактивным. Прокоагуляционная активность FIX в культуральной среде составляла 0.22 МЕ/мл при общей концентрации 59 мкг/мл (определение методом ИФА), что соответствовало удельной активности, составляющей 1.8% от активности природного фактора IX человека. Отсутствие биологической активности FIX могло быть вызвано двумя известными причинами - недо-

А

£ Cl О

1701309572-

■FIX контроль-

S

£ . 5 S

m v» ■

Neotoma lepida

Cricetulus griseus

554334-

Rattus rattus alexandrinus Mus musculus

" 14

J3 512 ■5

i 10

©

£ 4

x

2

§

0

^■ИФА 97% 1.4%

■■» Koar. I 2.7% I

3.0% Т 1.2%

99% А

96% 96% 97% т / 1 -

ш J. /

А i . f

Л X Q)

2.5 „5

n ж

I-

7 (U

I

Ш i-5 i S

1

m o

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

0.5 I

UL

a

о а

o Ñ ai

? #

1_ÍL

JL

Rattus norvegicus

Arvicola amphibius Microtus ochrogaster

Nannospalax galili Heterocephalus glaber

Canis lupus familiaris Felis catus

- Насекомоядные

- Приматы Парнокопытные

■ Хищники

■ Грызуны

Cricetulus griseus Rattus norvegicus-

Mus musculus-------1

felis catus--------

Воз tauirus---------1

Horno sapiens-------¡

Macaca mulatta-[93

C. griseus----1

R. norvegicuü-f M. musculus™1—

F, catus------1

B. taurus-----1

H. sapiens—---

M. mulatta——

Д| A'J зШ J-'i'c

i !ql цщцшкщ ¿¡нате

Idr: ЫМ«1> fcl afrfci d? ff

I же ШгШ-М

И fclfcWH riM afeMrifrW;

GFGLVEH]

GFGLVEH]

GFGLVEH

GFGLVEH

GFGLVEH

GFGLVEH

GFGLVEH

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

lvsfa'

lvsvaoJl lvsvacÄj lvslaA lvsl&G» lvslag&j WCLSLxjj

YLAWILFFVLY

YLAWILFFVL'

YLAWILFFVL

YIAHILFFVLY

YLAWILFFVL

YLAWILFFVLY

YLAWILFFVL

■vcfts I 7ЁПГ ü

S ЙЯ2Щ:Й5£ ü I

Htwun ¡тпт и HUSSSSí ЙСТТ Я

¡¡x -mwi ¡яп ;sm

H 246

Рис. 2. Целостность секретированного и внутриклеточного FIX линии клеток p1.1-F9-T2/S, уровни секреции FIX и изменение прокоагуляционной активности в линиях-продуцентах, филогения VKORC1 китайского хомячка. A - иммуноблотинг секретируемого и внутриклеточного FIX. Электрофорез в ДСН-ПААГ в восстанавливающих условиях, детекция поликлональными антителами к фактору IX, молекулярная масса полос маркера указана в кДа. Обозначения: K+ - стандарт рекомбинантного FIX, контроль- - нетрансфицированные клетки CHO DG44. Положение полноразмерного FIX обозначено стрелкой. Б - уровень секреции FIX и степень отделения пропептида в популяциях клеток и клональных линиях. Удельная продуктивность линий клеток, измеренная методом ИФА, обозначена столбиками, левая шкала. Удельная продуктивность в терминах прокоагуляционной активности приведена как ломаная линия, правая шкала. Доля молекул FIX с отделенным пропептидом (%), определенная по ИФА, приведена над соответствующими столбиками. Удельная продуктивность для обоих методов приведена как среднее и стандартное отклонение, n = 2. Стрелками обозначен порядок получения соответствующих линий и популяций клеток. В - таксономическое дерево VKORC1 млекопитающих, визуализировано при помощи программы Tree-Viewer (NCBI, США). Масштабный отрезок показывает эволюционное расстояние, соответствующее числу замен на одну аминокислоту. Г - множественное выравнивание последовательностей вариантов VKORC1 нескольких видов млекопитающих. Консервативные аминокислотные остатки обозначены черным фоном

В

Г

Таблица 3. Уровень активности VKORC1 в стабильно трансфицированных клетках

Плазмида Удельная активность VKORC1, % конверсии субстрата на 1 мг/мл общего белка в лизате за 1 ч Относительный уровень увеличения активности VKORC1, разы

Интактные клетки CHO DG44 0.38 -

p1.2-Zeo-VKORC1 9.21 24.2

p1.2-Zeo-hVKORC1 3.03 8.0

Примечание: удельную активность рассчитывали для диапазонов линейной зависимости уровня конверсии субстрата от концентрации общего белка в лизатах.

статочным у-карбоксилированием его Gla-домена [7] и сохранением пропептида у секретированных молекул FIX, что связано с невозможностью осуществления сколько-нибудь эффективного процессинга пропептида FIX эндогенными протеазами семейства PACE/furin клеток-хозяев [7].

Правильный процессинг пропептида фактора IX человека может быть обеспечен коэкспрессией гена сигнальной протеазы PACE/furin человека. Для ко-экспрессии растворимого укороченного варианта PACE/furin человека мы использовали вектор p1.2-HYG, аналогичный вектору p1.1, но содержащий расположенный вне контекста гена EEF1A ген гигроми-цин-фосфотрансферазы под контролем промотора SV40, обеспечивающий устойчивость к антибиотику гигромицину Б (рис. 1).

Для сверхэкспрессии эндогенного VKORC1 мы клонировали область открытой рамки считывания гена vkorc1 из кДНК клеток CHO DG44 при помощи праймеров, гомологичных началу и концу ОРС гена vkorc1 мыши. Секвенирование клонированного продукта ПЦР выявило приблизительно одинаковый уровень гомологии между vkorc1 китайского хомячка и vkorc1 мыши и человека (рис. 2В). VKORC1 китайского хомячка, в отличие от его ортологов у других млекопитающих, содержит мотив RRR [30] на границе первого трансмембранного домена и обладает значительно меньшей гомологией с vkorc1 человека (рис. 2Г).

Охарактеризованная область ОРС гена vkorc1 китайского хомячка депонирована в GenBank (AFG26681.1), а также клонирована в вектор p1.2-Zeo с образованием плазмиды p1.2-Zeo-VKORC1 (рис. 1). На основе того же вектора экспрессии создана также контрольная конструкция p1.2-Zeo-hVKORC1, содержащая область ОРС vkorc1 человека.

На основе клеток CHO DG44 получены стабильно трансфицированные поликлональные популяции, экспрессирующие оба ортолога гена vkorc1. В лизате клеток была измерена витамин

К-оксидоредуктазная активность, а также определено число копий интегрированных экспрессионных кассет. Сверхэкспрессия обоих ортологов vkorc1 привела к сильному увеличению оксидоредуктаз-ной активности в лизате клеток (табл. 3), при этом VKORC1 китайского хомячка обеспечивал втрое большую удельную ферментативную активность, чем VKORC1 человека при практически одинаковом числе копий интегрированных кассет - 5.8 ± 0.3 и 5.5 ± 0.5 копии/геном для генов vkorc1 китайского хомячка и человека соответственно. Уровень транскрипции обоих ортологов также не имел существенных отличий - у мРНК VKORC1 китайского хомячка составил 0.12 ± 0.03% от уровня мРНК Р-актина; у мРНК VKORC1 человека - 0.09 ± 0.01; P = 0.16. Одновременно с этим обнаружено, что максимальная скорость конверсии субстрата VK > O микросомаль-ной фракцией белков, полученных из клеток, транс-фицированных геном VKORC1 человека, составляет около 5% в 1 ч, а в случае VKORC1 китайского хомячка - не менее 9% в 1 ч (данные не приведены). Поскольку сверхэкспрессия аутологичного гена vkorc1 в клетках CHO позволяет добиться максимальной витамин К-оксидоредуктазной активности, то этот вариант vkorc1 использовали для котранс-фекции линии клеток-продуцентов FIX.

Клетки клональной линии 3B12 последовательно трансфицировали линеаризованными плазмидами p1.2-Zeo-VKORC и p1.2-Hygro-Fur. В полученной популяции стабильно трансфицированных клеток, содержащих три генетические кассеты - для экспрессии фактора IX и двух вспомогательноых ферментов, удельная прокоагуляционная активность FIX в культуральной среде составила 27% от стандарта, при этом по данным ИФА доля молекул секретиро-ванного FIX с неотделенным пропептидом составляла только 3.1% (рис. 2Б). Таким образом, активность растворимого PACE/furin человека в полученной популяции клеток была достаточной для практически полного отделения пропептида, однако уровень

л

J*

f-J

гм CM CM

H h" H

en en

LU LU LU

тН тН rH

t-i tA r-ï

Cl CL CL

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

OSTC

St3Gal

B4Gal

Рис. 3. Копийность целевого гена и вспомогательных генов ферментов фурин и VKORC1 в геноме линий-продуцентов, изменение уровня экспрессии генов домашнего хозяйства в линии клеток 3B12-86 методом количественной ПЦР. Л - копийность гена FIX и области селекционного маркера (1RES). Обозначения: 1RES - ампликон из области 1RES и гена DHFR; FIX - ампликон из области ОРС фактора IX. Б - копийность вспомогательных генов фурина и VKORC1. Обозначения - FURIN - ампликон из области ОРС furin, VKORC - ампликон из области ОРС VKORC1. В - изменения в уровне экспрессии генов CHO, связанных с процессами трансляции и посттрансляционных модификаций синтезируемых белков в сравнении с нетрансфицированными клетками CHO DG44. Нормирование результатов по уровню мРНК бета-актина. Обозначения: EIF1 - эукариотический фактор инициации трансляции 1a, EIF3 - эукариотический фактор инициации трансляции 3, PPIB - пептидилпролилизоме-раза B, BIP - иммуноглобулинсвязывающий белок (Grp78); OSTC - олигосахаридтрансфераза; St3Gal - бета-галактозид-альфа-2,3-сиалилтрансфераза 3; B4Gal - бета-1,4-галактозилтрансфераза 1. На всех панелях планки погрешностей соответствуют стандартным отклонениям, n = 3-4, приведены данные одного репрезентативного измерения из трех

Б

В

Y-карбоксилирования в большей части клеток был недостаточным для правильного формирования Gla-домена FIX. Можно предположить, что не во всех стабильно трансфицированных клетках экспрессия вспомогательных ферментов была одинаково эффективной, но, в отличие от VKORd, растворимый PACE/furin, выделяемый в культуральную среду частью клеток, обеспечивал отделение пропетида у всех секретированных молекул FIX.

Для выделения клеток, в которых максимально эффективно работают оба вспомогательных фер-

мента, т.е. образуется биологически активный FIX, провели клонирование полученной популяции методом предельных разведений, используя в качестве критериев отбора перспективных клонов прокоагу-ляционную активность секретируемого FIX и уровень пептидазной активности PACE/furin в куль-туральной среде. Из 199 первичных клонов клеток отобрали 80 с максимальной концентрацией FIX, из которых отобрали 24 клона с максимальной активностью PACE/furin, а из них 12 клонов с максимальной прокоагуляционной активностью FIX

Л

гДНК - ПЦР

СНО DG44

ЗВ12

ЗВ12-86

Б

кДНК-ПЦР

гДНК - Саузерн-блотинг

20000| 10000| 7000 5000 4000 3000

2000

500 400 300 200 75

1383

агарозный гель

8000600050004000- ■

3000250020001500-

1000-1

зонд IDbla зонд FIX

(О со

ч-

О а

to со

■ч

о

Q

кДНК-зонд FIX

агарозный гель мембрана

(О CO (£>

!-- CU со

3 л (N1 ^ СЧ <N

g i m сз m S

S Q со со О со to

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Д.

■А

0

-3700

10000- —

7000- р

5000- ^

4000- —

3000- —

2000- —.

ш

А

'ija

1921

-800

15001000750500-

'-2500

В

Г

700

Рис. 4. Анализ области целевого гена в геномной ДНК и кДНК линий-продуцентов FIX методами ПЦР, ПЦР-РВ, Саузерн-блотинга и псевдонозерн-блотинга. Размеры полос маркера приведены в п.н. Л - амплификация полных областей целевых генов в составе геномной ДНК (гДНК) методом ПЦР. Температурный градиент обозначен красными треугольниками, линейное изменение температуры отжига праймеров от 53 до 68. Красными стрелками обозначены продукты амплификации генов FIX, фурина и VKORC1 соответственно. Б - ПЦР-РВ мРНК, праймеры к 5'- и З'-концам ОРС FIX, красной стрелкой обозначен продукт амплификации ожидаемого размера. В - анализ геномной ДНК методом гибридизации по Саузерну c меченными биотином зондами. Зонд IDbla -зонд, направленный к областям IRES, DHFR, гена устойчивости к ампициллину bla и области инициации репликации плазмид ori, зонд FIX - зонд к области ОРС FIX. Красными стрелками указаны размеры обнаруженных рестрикционных фрагментов. Изображение электрофореграммы инвертировано, контраст изображений мембран увеличен для улучшения видимости. Г - анализ кДНК методом псевдонозерн-гибридизации. Обозначения как на панели В, стрелкой указан фактический размер кДНК FIX

(данные не приведены). Пять из 12 отобранных таким образом клональных линий успешно адаптировали к суспензионному культивированию в присутствии водорастворимого витамина K3, удельная прокоагуляционная активность FIX у всех клонов составляла более 185 МЕ/мг. Среди этих пяти кло-

нов была определена основная линия 3B12-86 с Qp 11.2 ± 0.3 пг/клетка/день и две запасные линии -3B12-78 и 3B12-05.

Копийность гена FIX, области его селекционного маркера и вспомогательных генов в геноме линий-продуцентов и родительских популяций кле-

Таблица 4. Таблица очистки FIX

Название фракции FIX:Ar, МЕ/мл Объем фракции, лм FIX:C, МЕ/мл FIX:Ar, МЕ Общий белок по УФ, мг FIX:C, МЕ FIX:C/ белок, МЕ/мг FIX:Ar/ белок, МЕ/мг Выход стадии по FIX:Ar Общий выход по FIX:Ar Доля FIX с про-пептидом, %

Культуральная среда 6.04 115 3.6 695 - 414 - - - - 2.6

Capto MMC фракции проскока и промывки 0.166 273 - 45 - - - - 7% - -

Capto MMC элюат 64.79 9 - 583 4.28 - - 136 84% 84% -

Capto Q фракция проскока 0.07 37 - 3 0.69 - - 4 0.4% - -

Capto Q промывка 200 мМ NaCl 0.05 12.5 - 1 0.48 - - - - -

Capto Q элюция 10 мМ CaCl2 31.75 9.2 25.2 292 1.51 232 154 194 50% 62% 2

Capto Q 150 мМ NaCl + 10 мМ CaCl2 12.95 10.5 - 136 0.88 - - 154 23%

Capto Q 200 мМ NaCl + 10 мМ CaCl2 4.67 10.7 <1 50 0.83 <10.7 <12 60 9% - 5.8

Capto Q 500 мМ NaCl + 10 мМ CaCl2 13.87 4 - 55 0.57 - - 98 10% - -

Capto Heparin фракция проскока 0.72 18 - 13 - - - - 3% - -

Capto Heparin элюат 36.10 9 38.6 325 1.46 347 237 222 76% 32% <2

ток определяли методом количественного ПЦР (рис. 3А,Б). Копийность областей ОРС FIX и DHFR не отличалась статистически значимо у всех исследованных объектов, т.е. ни в одном случае не обнаружены признаки «расцепления» целевого гена и гена селекционного маркера, т.е. изменения копийности гена селекционного маркера отдельно от целевого гена, несмотря на амплификацию генетических кассет в геноме продуцентов. В ходе получения линии 3B12-86 наблюдались изменения копийности гена FIX человека: копийность гена FIX возрастала приблизительно в 5 раз при амплификации, сохранялась при клонировании амплифицированной популяции и затем упала в 4 раза при котрансфекциях плазмид со вспомогательными генами и повторного клонирования. Удельная продуктивность соответствующих линий клеток при этом не уменьшалась. Вероятно, при снятии селекционного давления наблюдалась потеря малоактивных копий генетической кассеты, возникших в процессе геномной амплификации.

Копийность вспомогательных генов во всех полученных клональных линиях была значительно ниже,

чем копийность гена FIX, поскольку отбор клонов клеток по критерию максимальной активности гена vkorcl не проводили, а в случае PACE/furin проведен только один раунд отбора, в котором отобрали треть от всех полученных клонов.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

В основной линии-продуценте 3B12-86 методом ПЦР-РВ оценили изменение уровня экспрессии нескольких генов домашнего хозяйства, связанных с биосинтезом и посттрансляционным процессингом белков (рис. 3B). Ни у одного из проверенных генов не обнаружили значимого изменения уровня экспрессии, что указывает на отсутствие существенного изменения системы биосинтеза и процессинга белка клеток-хозяев, секретирующих FIX с достигнутой продуктивностью.

Оценка целостности области открытой рамки считывания целевого гена

Методом ПЦР с геномной ДНК и праймеров к областям промотора и терминатора использованных экс-прессионных векторов показали, что преобладающие продукты ПЦР имеют «правильную» молекулярную

массу (рис. 4А), а именно, везде выявляется продукт размером 2942 п.н., соответствующий р1.1^9, а в случае геномной ДНК линии 3B12-86 обнаружены также ампликоны длиной 2511 и 852 п.н., соответствующие областям ОРС VKORC1 и PACE/furin. Аналогичная амплификация кДНК из линии 3B12-86 с прайме-рами, гомологичными областям начала и конца ОРС FIX, также выявила только продукт нужного размера (рис. 4Б), что подтверждает отсутствие протяженных делеций или инсерций в области ОРС FIX или мутаций, приводящих к изменению сплайсинга мРНК FIX.

Блотинг по Саузерну на геномной ДНК из линии 3B12-86 с зондом, направленным к области ОРС FIX, выявил один рестрикционный фрагмент длиной 1921 п.н. (рис. 4В), что указывает на отсутствие в геноме продуцента генетических кассет, встроившихся с разрывом ДНК в области ОРС FIX. Блотинг по Саузерну с использованием зонда к участкам ДНК плазмиды, соответствующим области начала репликации плазмиды и области гена Ыа, выявил два рестрикционных фрагмента - тяжелый фрагмент около 3700 п.н., приблизительно соответствующий расчетной интеграции кассеты по сайту ее линеаризации рестриктазой PvuI, а также короткий фрагмент размером около 800 п.н., предположительно соответствующий интеграции кассеты с делецией ДНК вблизи сайта PvuI. Псевдонозерн-блотинг на кДНК, полученных из линий 3B12-86 и 3B12-78, также выявил только мРНК FIX ожидаемой длины (рис. 4Г).

Отсутствие мутаций в области ОРС FIX подтверждено также с помощью ПЦР-амплификации всей области ОРС FIX из геномной ДНК линии 3B12-86, клонирования ампликона и секвенирования вставки в трех плазмидных клонах. Во всех случаях не выявлено изменений в последовательности ОРС FIX (данные не приведены).

Рис. 5. Анализ белковых фракций при хроматографи-ческой очистке FIX методом ДСН-ПААГ. Электрофорез в невосстанавливающих условиях, молекулярные массы в кДа, окраска коллоидным Кумасси синим. Обозначения: М - маркер, «элюат» - фракция элюата соответствующей колонки, «проскок» - фракции не связавшихся с сорбентом белков. Для фракций элюатов с колонки Capto Q указаны соответствующие концентрации NaCl, концентрация CaCl2 всюду одинакова и составляет 10 мМ

Выделение и очистка FIX

Выделение и очистку FIX из кондиционированной среды линии 3B12-86 проводили при помощи трех последовательных стадий - мультимодальной хроматографии с сорбентом Capto MMC, позволяющим извлекать FIX из кондиционированной среды без ее дополнительной подготовки; псевдоаффинной хроматографии на анионообменном сорбенте Capto Q с элюцией прокоагуляционно активных молекул FIX хлоридом кальция при низкой ионной силе; аффинной хроматографии на специализированном сорбенте Capto Heparin, отделяющем гепаринсвязывающие белки от остальных молекул. Суммарный выход продукта составил 32%, удельная прокоагуляцион-ная активность FIX в процессе очистки превысила 230 МЕ/мг, что соответствует показателям известного лекарственного препарата рекомбинантного FIX

(табл. 4). По данным гель-электрофореза (рис. 5) большая часть молекул FIX элюировалась с сорбента Capto Q при добавлении ионов Ca2+ к низкосолевому элюенту, что указывает на наличие у этой части молекул FIX правильно сформированного Gla-домена, структурная перестройка которого при хелатирова-нии ионов Ca2+ вызывает элюцию Gla-белков с анио-нообменного носителя.

ВЫВОДЫ

Разработанный нами ранее набор векторов на основе нетранслируемых участков гена EEF1A1 китайского хомячка может использоваться для получения линий клеток, секретирующих большие количества функционально активного FIX человека. Целевой ген может быть амплифицирован в геноме продуцентов путем культивирования клеток в присутствии воз-

растающих концентраций MTX, что приводит к многократному повышению секреции FIX. Достаточный уровень экспрессии вспомогательных генов vkorc1 и PACE/furin может быть обеспечен котрансфек-цией «совместимых» плазмид с генами устойчивости к антибиотикам. Полученные клональные линии-продуценты FIX содержат относительно небольшое число копий целевого гена и только несколько копий вспомогательных генов в составе хромосомной ДНК, что может способствовать поддержанию постоянства уровня секреции при длительном культивировании.

Сравнительный анализ сверхэкспрессированных ортологов гена фермента VKORC1 показал, что ау-тологичный VKORC1 китайского хомячка обеспечивает вдвое большую ферментативную активность при одинаковом числе копий искусственного гена vkorc1 в геноме. Такой способ сверхэкспрессии гена vkorc1 может применяться для получения в клетках CHO не только продуцентов FIX, но и других витамин К-зависимых белков. Особенно перспективным представляется использование гена vkorc1 китайского хомячка для получения фактора VII свертывания крови человека в клетках CHO. Применяемая в настоящее время для промышленного производства FVII линия клеток BHK сочетает сравнительно высокую актив-

ность комплекса VKOR с низким общим уровнем секреции FVII, а также с определенными ограничениями режима культивирования - в отличие от CHO эта линия требует присутствия в среде фетальной сыворотки крупного рогатого скота и способна к нормальному росту только в адгезионных условиях.

Высокая удельная продуктивность созданной линии-продуцента фактора свертывания крови FIX позволит использовать для промышленного получения FIX простое периодическое культивирование продолжительностью 4-5 дней, титр FIX при этом составляет около 6 МЕ/мл. Такой метод получения FIX не нуждается в специализированных биореакторах с системами перфузии или в разработке способов поддержания жизнеспособности клеточной культуры в течение длительного времени, что значительно упрощает и удешевляет процесс промышленного производства рекомбинантного фактора IX человека. •

Авторы выражают благодарность А.Л. Берковскому за ценные рекомендации и реагенты для коагулометрии.

Работа проводилась при поддержке Минпрома (№ 121/13-ФМП-05.0ЮК) и РФФИ (№ 16-34-01026 и 16-34-60242).

СПИСОК ЛИТЕРАТУРЫ

1. Rogaev E.I., Grigorenko A.P., Faskhutdinova G., Kittler E.L., Moliaka Y.K. // Science. 2009. V. 326. № 5954. P. 817.

2. Puetz J., Soucie J.M., Kempton C.L., Monahan P.E. // Haemophilia. 2014. V. 20. № 1. P. 25-31.

3. Kurachi K., Davie E.W. // Proc. Natl. Acad. Sci. USA. 1982. V. 79. № 21. P. 6461-6464.

4. Anson D.S., Austen D.E., Brownlee G.G. // Nature. 1985. V. 315. № 6021. P. 683-685.

5. De la Salle H., Altenburger W., Elkaim R., Dott K., Dieterle A., Drillien R., Cazenave J.P., Tolstoshev P., Lecocq J.P. // Nature. 1985. V. 316. № 6025. P. 268-270.

6. Kaufman R.J., Wasley L.C., Furie B.C., Furie B., Shoemaker C.B. // J. Biol. Chem. 1986. V. 261. № 21. P. 9622-9628.

7. McGrath B.M., Walsh G. Directory of Therapeutic Enzymes. Boca Raton: CRC Press, 2005.

8. Derian C.K., VanDusen W., Przysiecki C.T., Walsh P.N., Berkner K.L., Kaufman R.J., Friedman P.A. // J. Biol. Chem. 1989. V. 264. № 12. P. 6615-6618.

9. Makino Y., Omichi K., Kuraya N., Ogawa H., Nishimura H., Iwanaga S., Hase S. // J. Biochem. 2000. V. 128. № 2. P. 175-180.

10. Poon M.C., Lillicrap D., Hensman C., Card R., Scully M.F. // Thromb. Haemost. 2002. V. 87. № 3. P. 431-435.

11. Lissitchkov T., Matysiak M., Zavilska K., Laguna P., Gercheva L., Antonov A., Moret A., Caunedo P., Aznar J.A., Woodward M.K., Paez A. // Haemophilia. 2013. V. 19. № 5. P. 674-678.

12. Bond M., Jankowski M., Patel H., Karnik S., Strang A., Xu B., Rouse J., Koza S., Letwin B., Steckert J., Amphleand G., Scoble H. // Semin. Hematol. 1998. V. 35. № 2 Suppl 2. P. 11-17.

13. Berkner K.L. // Annu. Rev. Nutr. 2005. V. 25. P. 127-149.

14. Garcia A.A., Reitsma P.H. // Vitam. Horm. 2008. V. 78. P. 23-33.

15. Bolt G., Steenstrup T.D., Kristensen C. // Thromb. Haemost. 2007. V. 98. № 5. P. 988-997.

16. Wajih N., Hutson S.M., Owen J., Wallin R. // J. Biol. Chem. 2005. V. 280. № 36. P. 31603-31607.

17. De Castilho Fernandes A., Fontes A., Gonsales N., Swiech K., Picanco-Castro V., Faca S., Covas D. // Biotechnol. Appl. Biochem. 2011. V. 58. № 4. P. 243-249.

18. Wilson C.R., Sauer J.M., Carlson G.P., Wallin R., Ward M.P., Hooser S.B. // Toxicology. 2003. V. 189. № 3. P. 191-198.

19. Schulman S., Wang B., Li W., Rapoport T.A. // Proc. Natl. Acad. Sci. USA. 2010. V. 107. № 34. P. 15027-15032.

20. Tie J.K., Jin D.Y., Stafford D.W. // J. Biol. Chem. 2014. V. 289. № 13. P. 9396-9407.

21. Orlova N.A., Kovnir S.V., Hodak J. A., Vorobiev I.I., Gabibov A.G., Skryabin K.G. // BMC Biotechnol. 2014. V. 14. P. 56.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

22. Kozak M. // Nucl. Acids Res. 1987. V. 15. № 20. P. 8125-8148.

23. Griffin A.M., Griffin H.G. Molecular Biology: Current Innovations and Future Trends. Horizon Scientific Press, 1995.

24. Dussault A.A., Pouliot M. // Biol. Procd. Online. 2006. V. 8. P. 1-10.

25. Church G.M., Gilbert W. // Proc. Natl. Acad. Sci. USA. 1984. V. 81. № 7. P. 1991-1995.

26. Harlow E., Lane D. Antibodies: A Laboratory Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory, 1988.

27. Bristol J.A., Furie B.C., Furie B. // J. Biol. Chem. 1993. V. 268. № 10. P. 7577-7584.

28. Rost S., Fregin A., Ivaskevicius V., Conzelmann E., Hortnagel K., Pelz H.J., Lappegard K., Seifried E., Scharrer I., Tuddenham E.G., Muller C.R., Strom T.M., Oldenburg J. // Nature. 2004. V. 427. № 6974. P. 537-541.

29. Tishler M., Fieser L.F., Wendler N.L. // J. Am. Chem. Soc. 1940. V. 62. № 10. P. 2866-2871.

30. Alves D.S., Castello-Banyuls J., Faura C.C., Ballesta J.J. // FEBS Lett. 2011. V. 585. № 8. P. 1169-1174.

i Надоели баннеры? Вы всегда можете отключить рекламу.