Научная статья на тему 'ВЛИЯНИЕ ПОЛИМОРФИЗМА ГЕНА MC4R НА ОТКОРМОЧНЫЕ И МЯСНЫЕ КАЧЕСТВА СВИНЕЙ'

ВЛИЯНИЕ ПОЛИМОРФИЗМА ГЕНА MC4R НА ОТКОРМОЧНЫЕ И МЯСНЫЕ КАЧЕСТВА СВИНЕЙ Текст научной статьи по специальности «Животноводство и молочное дело»

CC BY
66
22
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
ГЕН MC4R / ГЕНЫ-КАНДИДАТЫ / ПЦР-ПДРФ / ГЕНОТИПИРОВАНИЕ СВИНЕЙ / ПОКАЗАТЕЛИ ПРОДУКТИВНОСТИ СВИНЕЙ

Аннотация научной статьи по животноводству и молочному делу, автор научной работы — Святогорова А.Е., Третьякова О.Л., Гетманцева Л.В., Святогоров Н.А., Клименко А.И.

Перспективность использования технологий геномной селекции, позволяющих расшифровать генотип свиней на стадии рождения и отбирать лучших животных для разведения, обусловила необходимость в изучении генов-маркеров продуктивности. Это позволит увеличивать селекционную точность и надежность племенной ценности свиней и поможет на ранних этапах жизни проводить диагностику племенной ценности животных, улучшать имеющиеся и выводить новые специализированные отцовские линии, которые будут использованы на заключительном этапе гибридизации для получения товарных гибридов. В повышении продуктивных качеств большой интерес представляет ген рецептора меланокортина-4 (MC4R ), как одно из звеньев сложной системы пищевого поведения, он принимает участие в метаболизме жировой ткани. Основной функциональной особенностью МС4R выступают контроль массы тела и регуляция пищевого поведения. Таким образом, основной целью и задачей опыта являлось изучение взаимосвязи полиморфизма гена-маркера МС4R свиней породы дюрок с их мясными и откормочными качествами. Объект. Объектами исследования являлись свиньи породы дюрок (n=55 из них 45 свинок и 10 хрячков) ЗАО «Племзавод-Юбилейный». Непосредственным материалом для исследования служили образцы ткани с ушной раковины свиней площадью 1 см² (ушные выщипы). Материалы и методы. Анализ проводили методом ПЦР-ПДРФ (полимеразной цепной реакции - полиморфизм длин рестрикционных фрагментов) Амплификацию фрагмента (226 п.н.) гена MC4R проводили с использованием праймеров: 5'- TACCCTGACCATCTTGATTG - 3'; 5' - ATAGCAACAGATGATCTCTTTG -3'. Результаты и выводы. По результатам молекулярно-генетического исследования определяли наличие и частоту аллелей и генотипов по гену MC4R . Экспериментальные исследования по ДНК-генотипированию с.-х. животных проводили в лаборатории молекулярной диагностики и биотехнологии с.-х. животных в Донском ГАУ. Согласно проведенным исследованиям у свинок был установлен «желательный» генотип АА по показателям скороспелости, длине туловища и среднесуточному привесу. У хрячков наблюдается существенное превосходство откормочных и мясных показателей по генотипу GG . Также исследования показали, что откормочные и мясные качества свиней зависят от генетических особенностей породы и от пола животных.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по животноводству и молочному делу , автор научной работы — Святогорова А.Е., Третьякова О.Л., Гетманцева Л.В., Святогоров Н.А., Клименко А.И.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

EFFECT OF MC4R GENE POLYMORPHISM ON GROWTH AND MEAT TRAITS OF PIGS

The article presents an analysis of the influence of gen MC4R on growth and meat performance of pigs Duroc. The frequency of alleles and genotypes of said marker gene and its relationship to productivity traits. Introduction. The prospect of using genomic selection technologies that allow deciphering the genotype of pigs at the stage of birth and selecting the best animals for breeding has led to the need to study productivity marker genes. This will increase the breeding accuracy and reliability of the breeding value of pigs and will help in the early stages of life to diagnose the breeding value of animals, improve existing and derive new specialized paternal lines that will be used at the final stage of hybridization to obtain commercial hybrids. In increasing productive qualities, the melanocortin-4 receptor gene ( MC4R ) is of great interest, as one of the links of a complex system of eating behavior, it participates in the metabolism of adipose tissue. The main functional feature of the MC4R is the control of body weight and regulation of eating behavior. Thus, the main purpose and objective of the experiment was to study the relationship of the polymorphism of the MC4R marker gene of Duroc pigs with their meat and fattening qualities. Object. The objects of the study were Duroc pigs (n=55 of them 45 pigs and 10 boars) of the Closed Joint Stock Company «Breeding Plant-Jubilee». Materials and methods. The direct material for the study was tissue samples from the auricle of pigs with an area of 1 cm2 (ear plucking). The analysis was carried out by PCR-PDRF (polymerase chain reaction - restriction fragment length polymorphism) Amplification of a fragment (226 bp) of the MC4R gene was carried out using primers: 5'- TACCCTGACCATCTTGATTG - 3'; 5' - ATAGCAACAGATGATCTCTTTG - 3'. Results and conclusions. Based on the results of a molecular genetic study, the presence and frequency of alleles and genotypes were determined by the MC4R gene. Experimental studies on DNA genotyping of agricultural animals were carried out in the laboratory of molecular diagnostics and biotechnology of agricultural animals in the Don State Agrarian University. According to the conducted studies, the pigs had a «desirable» AA genotype in terms of precocity, trunk length and average daily weight gain. In boars, there is a significant superiority of fattening and meat indicators according to the GG genotype. Studies have also shown that the fattening and meat qualities of pigs depend on the genetic characteristics of the breed and on the sex of the animals.

Текст научной работы на тему «ВЛИЯНИЕ ПОЛИМОРФИЗМА ГЕНА MC4R НА ОТКОРМОЧНЫЕ И МЯСНЫЕ КАЧЕСТВА СВИНЕЙ»

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

16. Wall E. H. The effects of supplementation with a blend of cinnamaldehyde and eugenol on feed intake and milk production of dairy cows // JOURNAL OF DAIRY SCIENCE. 2014. V. 97 (9). P. 5709-5717. https://doi.org/10.3168/jds.2014-7896.

17. Yazdanpanah Z. Effects of cinnamon supplementation on body weight and composition in adults // A systematic review and meta-analysis of controlled clinical trials. 2020. V. 34 (3). P. 448463. https://doi.org/10.1002/ptr.6539.

18. Yesilbag D. Effects of juniper essential oil on growth performance, some rumen protozoa, rumen fermentation and antioxidant blood enzyme parameters of growing Saanen kids // Anim Physiol Anim Nutr. 2017. V. 101. P. e67-e76._https://doi.org/10.1111/jpn.12560.

Информация об авторе

Цис Елена Юрьевна, кандидат сельскохозяйственных наук, научный сотрудник отдела кормления сельскохозяйственных животных Федеральное государственное бюджетное научное учреждение «Федеральный исследовательский центр животноводства - ВИЖ имени академика Л.К. Эрнста» (142132, Московская область, г.о. Подольск, пос. Дубровицы, д.60), тел. 8(916)277-47-27, e-mail: tsis-elen@yandex.ru_ORCID https://orcid.org/0000-0003-1988-1189

DOI: 10.32786/2071-9485-2022-02-37

EFFECT OF MC4R GENE POLYMORPHISM ON GROWTH AND MEAT

TRAITS OF PIGS

12 2 A. E. Svyatogorova , O. L. Tretyakova , L. V. Getmantseva ,

N. A. Svyatogorov 2, A. I. Klimenko3

1North-Caucasus Zonal Veterinary Research Institute - branch of FSBSC FRASC, Novocherkassk 2Don State Agrarian University, Rostov region, Oktyabrsky district, v. Persianovsky 3Federal Rostov Agrarian Scientific Center, Rostov region, Aksai district, v. Dawn

Received 30.03.2022 Submitted 25.05.2022

Summary

The article presents an analysis of the influence of gen MC4R on growth and meat performance of pigs Duroc. The frequency of alleles and genotypes of said marker gene and its relationship to productivity traits.

Abstract

Introduction. The prospect of using genomic selection technologies that allow deciphering the genotype of pigs at the stage of birth and selecting the best animals for breeding has led to the need to study productivity marker genes. This will increase the breeding accuracy and reliability of the breeding value of pigs and will help in the early stages of life to diagnose the breeding value of animals, improve existing and derive new specialized paternal lines that will be used at the final stage of hybridization to obtain commercial hybrids. In increasing productive qualities, the melanocortin-4 receptor gene (MC4R) is of great interest, as one of the links of a complex system of eating behavior, it participates in the metabolism of adipose tissue. The main functional feature of the MC4R is the control of body weight and regulation of eating behavior. Thus, the main purpose and objective of the experiment was to study the relationship of the polymorphism of the MC4R marker gene of Duroc pigs with their meat and fattening qualities. Object. The objects of the study were Duroc pigs (n=55 of them 45 pigs and 10 boars) of the Closed Joint Stock Company «Breeding Plant-Jubilee». Materials and methods. The direct material for the study was tissue samples from the auricle of pigs with an area of 1 cm2 (ear plucking). The analysis was carried out by PCR-PDRF (polymerase chain reaction - restriction fragment length polymorphism) Amplification of a fragment (226 bp) of the MC4R gene was carried out using primers: 5'- TACCCTGACCATCTTGATTG - 3'; 5' -ATAGCAACAGATGATCTCTTTG - 3'. Results and conclusions. Based on the results of a molecular genetic study, the presence and frequency of alleles and genotypes were determined by the MC4R gene. Experimental studies on DNA genotyping of agricultural animals were carried out in the laboratory of molecular diagnostics and biotechnology of agricultural animals in the Don State Agrarian University. According to the conducted studies, the pigs had a «desirable» AA genotype in terms of precocity, trunk

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

length and average daily weight gain. In boars, there is a significant superiority of fattening and meat indicators according to the GG genotype. Studies have also shown that the fattening and meat qualities of pigs depend on the genetic characteristics of the breed and on the sex of the animals.

Key words: gen MC4R, candidate gene, PCR-RFLP, genotyping, productivity traits.

Citation. Svyatogorova A. E., Tretyakova O. L., Getmantseva L. V., Svyatogorov N. A., Klimenko A. I. Effect of MC4R gene polymorphism on growth and meat traits of pigs of pigs. Proc. of the Lower Volga Agro-University Comp. 2022. 2(66). 298-306 (in Russian). DOI: 10.32786/2071-9485-2022-02-37.

Author's contribution. In this experiment, all the authors participated in the planning, execution,and analysis of the research results. The presented version of the article is approved by all the authors.

Conflict of interest. The author declare no conflict of interest.

УДК 636.4.082.12

ВЛИЯНИЕ ПОЛИМОРФИЗМА ГЕНА MC4R НА ОТКОРМОЧНЫЕ И МЯСНЫЕ КАЧЕСТВА СВИНЕЙ

А. Е. Святогорова1, младший научный сотрудник О. Л. Третьякова2, доктор сельскохозяйственных наук, профессор Л. В. Гетманцева2, доктор биологических наук, ведущий научный сотрудник Н. А. Святогоров2, кандидат сельскохозяйственных наук, доцент А. И. Клименко3, академик РАН, доктор сельскохозяйственных наук,

профессор, директор

1Северо-Кавказский зональный научно-исследовательский ветеринарный институт - филиал

ФГБНУ ФРАНЦ, г. Новочеркасск 2Донской государственный аграрный университет, Ростовская область, Октябрьский район, п. Персиановский 3ФГБНУ «Федеральный Ростовский аграрный научный центр», Ростовская область,

Аксайский район, п. Рассвет

Дата поступления в редакцию 30.03.2022 Дата принятия к печати 25.05.2022

Аннотация. Перспективность использования технологий геномной селекции, позволяющих расшифровать генотип свиней на стадии рождения и отбирать лучших животных для разведения, обусловила необходимость в изучении генов-маркеров продуктивности. Это позволит увеличивать селекционную точность и надежность племенной ценности свиней и поможет на ранних этапах жизни проводить диагностику племенной ценности животных, улучшать имеющиеся и выводить новые специализированные отцовские линии, которые будут использованы на заключительном этапе гибридизации для получения товарных гибридов. В повышении продуктивных качеств большой интерес представляет ген рецептора мелано-кортина-4 (MC4R), как одно из звеньев сложной системы пищевого поведения, он принимает участие в метаболизме жировой ткани. Основной функциональной особенностью MC4R выступают контроль массы тела и регуляция пищевого поведения. Таким образом, основной целью и задачей опыта являлось изучение взаимосвязи полиморфизма гена-маркера MC4R свиней породы дюрок с их мясными и откормочными качествами. Объект. Объектами исследования являлись свиньи породы дюрок (n=55 из них 45 свинок и 10 хрячков) ЗАО «Племза-вод-Юбилейный». Непосредственным материалом для исследования служили образцы ткани с ушной раковины свиней площадью 1 см2 (ушные выщипы). Материалы и методы. Анализ проводили методом ПЦР-ПДРФ (полимеразной цепной реакции — полиморфизм длин ре-стрикционных фрагментов) Амплификацию фрагмента (226 п.н.) гена MC4R проводили с использованием праймеров: 5'- TACCCTGACCATCTTGATTG - 3'; 5' -ATAGCAACAGATGATCTCTTTG -3'. Результаты и выводы. По результатам молекулярно-генетического исследования определяли наличие и частоту аллелей и генотипов по гену MC4R. Экспериментальные исследования по ДНК-генотипированию с.-х. животных проводи-

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

ли в лаборатории молекулярной диагностики и биотехнологии с.-х. животных в Донском ГАУ. Согласно проведенным исследованиям у свинок был установлен «желательный» генотип АА по показателям скороспелости, длине туловища и среднесуточному привесу. У хрячков наблюдается существенное превосходство откормочных и мясных показателей по генотипу GG. Также исследования показали, что откормочные и мясные качества свиней зависят от генетических особенностей породы и от пола животных.

Ключевые слова: ген MC4R, гены-кандидаты, ПЦР-ПДРФ, генотипирование свиней, показатели продуктивности свиней.

Цитирование. Святогорова А. Е., Третьякова О. Л., Гетманцева Л. В., Святогоров Н. А., Клименко А. И. Влияние полиморфизма гена MC4R на откормочные и мясные качества свиней. Известия НВ АУК. 2022. 2 (66). 298-306. DOI: 10.32786/2071-9485-2022-02-37.

Авторский вклад. В данном эксперименте все авторы принимали участие в планировании, выполнении, а также анализе полученных результатов исследований. Представленный вариант статьи одобрен всеми авторами.

Конфликт интересов. Авторы заявляют об отсутствии конфликта интересов.

Введение. Интенсификация селекционного процесса в свиноводстве всегда требует научно обоснованных подходов в селекции [5, 7]. Высокая мясная продуктивность свиней - показатель, к которому стремятся все без исключения производители свинины. Для достижения высоких результатов селекции необходимым условием повышения эффективности племенного отбора является получение точной информации о продуктивности животных в раннем возрасте, а также возможности использования их полного генетического потенциала. Главная задача - добиться получения высоких мясных показателей в максимально короткий срок и уменьшения затрат на ее достижение [10].

Внедрение в последнее десятилетие молекулярных маркеров в практическую селекцию позволило эффективно генотипировать животных с хозяйственно ценными признаками [1, 9, 11, 12, 13]. В племенном свиноводстве Европы и Америки геномную селекцию уже применяют [4]. Технологии геномной селекции позволяют расшифровать генотип свиней на стадии рождения и отбирать лучших животных для разведения. Эта новейшая технология призвана в дальнейшем увеличивать селекционную точность и надежность племенной ценности свиней, а также позволяет на ранних этапах жизни проводить диагностику племенной ценности животных, улучшать имеющиеся и выводить новые специализированные отцовские линии, которые будут использованы на заключительном этапе гибридизации для получения товарных гибридов.

В повышении продуктивных качеств большой интерес представляет ген рецептора меланокортина-4 (MC4R) [6, 8], как одно из звеньев сложной системы пищевого поведения он принимает участие в метаболизме жировой ткани. Ген MC4R экспресси-руется в разных участках ЦНС, в частности в таламусе, гипоталамусе, стволе и коре головного, а также участках спинного мозга. Экспрессия MC4R в этих структурах нервной системы свидетельствует об их возможном участии в регуляции вегетативных и нейроэндокринных функций. Основной функциональной особенностью MC4R выступает контроль массы тела и регуляция пищевого поведения [2, 3, 14].

Ген MC4R локализован на хромосоме 1 свиньи в участке (SSC1) q22-q27 [12]. Последовательность гена MC4R была представлена в GenBank под регистрационным номером AF087937. Полиморфизм MC4R определяли в позиции 1426. Замена одного нуклеотида G на А приводит при помощи рестриктазы TaqI к изменению аминокислотного состава МС4-рецептора [4].

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

Цель данного исследования - изучить взаимосвязь полиморфизма гена-маркера MC4R свиней породы дюрок с их мясными и откормочными качествами.

Материалы и методы. Объектами исследования являлись чистопородные свиньи племенного молодняка породы дюрок (n=55 из них 45 свинок и 10 хрячков) ЗАО «Племзавод-Юбилейный» Тюменской области. Следует отметить, что свиньи породы дюрок обладают хорошо выраженными мясными формами, они более скороспелые, чем другие породы свиней. Многолетняя селекция породы дюрок направлена на повышение откормочной и мясной продуктивности.

В процессе выполнения научно-исследовательской работы проводились контрольное выращивание свиней, оценка влияния гена MC4R на откормочные и мясные качества по результатам контрольного выращивания свиней до 100 кг, согласно «Инструкции по бонитировке» по показателям скороспелости (дн), толщине шпика (мм), длине туловища (см) и среднесуточному приросту (г). Далее проводился сравнительный анализ сопоставления генетических исследований с показателями продуктивности испытуемых животных. Экспериментальные исследования по ДНК-генотипированию с.-х. животных проводили в лаборатории молекулярной диагностики и биотехнологии с.-х. животных ФГБОУ ВО «Донской ГАУ» Ростовской области.

У исследованных животных брали биопробы ткани с ушной раковины свиней площадью 1 см2 (ушные выщипы), из которых выделяли ДНК. Генотипический анализ проводили методом ПЦР - ПДРФ (полимеразной цепной реакции — полиморфизм длин рестрикционных фрагметов) [2, 3].

Амплификацию образцов ДНК проводили следующим образом. В состав ПЦР смеси входило 5 мкл раствора буфера; 1 мкл дезоксонуклеозидтрифосфата; по 0,5 мкл прямого и обратного праймера; 0,5 мкл Taq-полимеразы; 12,5 мкл деионизированной воды и 5 мкл ДНК на пробу.

Амплификацию фрагмента (226 п.н.) гена MC4R проводили на амплификаторах «Терцик» и «Т-100» с использованием праймеров, синтезированные в ЗАО «Евроген» (г. Москва): 5'- TACCCTGACCATCTTGATTG - 3'; 5' - ATAGCAACAGATGATCTCTTTG -3'. Режим амплификации: предварительная денатурация при 94 °С - 5 минут, 35 циклов: 94 °С -30 с, 62 °С - 30 с, 72 °С - 30 с; заключительный синтез при 72 °С - 7 мин. Для определения полиморфизма гена MC4R 10 мкл ПЦР смеси обрабатывали 0,2 мкл эндонуклеазы рестрикции TaqI и 0,2 мкл BSA в 2 мкл буфера фирмы ООО «СибЭнзим-М» (Россия) и 7,6 мкл деионизированной воде при 64 °С в течение 2 ч.

Электрофоретическое разделение образцов ДНК в геле агарозы проводили следующим образом:

1. TBE/формамид электрофорез по гену MC4R проводили в 2 % геле агарозы, содержащем 1хТВЕ буфер (0,04 М Трис-ацетат, 1мМ ЭДТА) и бромистый этидий с конечной концентрацией в геле - 0,5 мкг/мл. 1хТВЕ буфер также использовался в качестве рабочего буфера для электрофореза.

2. Образцы помещали в лунки геля.

3. Электрофорез проводился при напряженности электрического поля равной 5 В/см.

4. Визуализацию электрофореграмм проводили на трансиллюминаторе в УФ свете (рисунок 1).

По результатам молекулярно-генетического исследования определяли наличие и частоту аллелей и генотипов по гену MC4R. Статистическую обработку данных проводили по стандартным методикам с использованием программного обеспечения MSEx-cel и STATISTICA 6.0.

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА: НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

$ 9

Рисунок 1 - Электрофореграмма результата ПЦР - ПДРФ гена MC4R/TaqI в 2 % агарозном геле

Figure 1 - Electrophoregram of the result of Polymerase Chain Reaction-Polymorphism of the Lengths of Restriction Fragments of the MC4R/TaqI gene in 2 % agarose gel

(Обозначения: 1,3,5,6,8- генотип AA (226 н.п.); 2- генотип GG (156- и 70 н.п.); 4,7- генотип AG (226-,156- и 70 н.п.); 9 - ДНК-маркер 100 bp (СибЭнзим))

(Designations: 1,3,5,6,8 - AA genotype (226 bp); 2 - GG genotype (156 and 70 bp); 4.7 - AG genotype (226, 156 and 70 bp); 9 - DNA marker 100 bp (SibEnzyme))

Результаты и обсуждение. В результате проведенного ДНК-генотипирования для каждого исследуемого животного были установлены генотипы по гену MC4R.

По результатам проведения ДНК-генотипирования свиней по гену MC4R были установлены все три генотипа AA, AG и GG.

Рисунок 2 - Частота аллелей и генотипов гена MC4R/TagI свинок породы дюрок Figure 2 - Frequency of alleles and genotypes of the MC4R/TagI gene in Duroc pigs

Изучение распределения частот встречаемости аллелей данного гена показало низкую частоту аллеля G и значительное доминирование аллеля A в исследуемой популяции, она составила 0,66 и 0,34 у свинок и 0,70 и 0,30 у хрячков, соответственно (рисунки 2, 3).

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

Рисунок 3 - Частота аллелей и генотипов гена MC4R/TagI хрячков породы дюрок

Figure 3 - Frequency of alleles and genotypes of the MC4R/TagI gene in Duroc boars

У чистопородных животных породы дюрок по гену MC4R в результате изучения влияния генотипов была установлена наибольшая частота генотипа AG у свинок (рисунок 2) и AA у хрячков (рисунок 3). У свинок частота генотипа AG определена на уровне 51,1 %, генотипа AA - 40,0 %, GG - 8,9 %. У хрячков частота генотипа AA составила 50,0 %, AG - 40,0 % и GG - 10,0 %.

Таблица 1 - Откормочные и мясные качества свинок породы дюрок различных

генотипов по гену MC4R

Table 1 - Fattening and meat qualities of Duroc pigs of various genotypes according _to the MC4R gene_

Генотип / Genotype Скороспелость, дн. / Precocity, days. Толщина шпика, мм / Thickness of the fat, mm Длина туловища, см / Body length, cm Среднесуточный прирост, г / Average daily gain, g

GG 167,3±5,56 13,0±1,29* 115,8±1,03 756±56,97

AG 163,4±2,24 14,5±0,67 110,9±4,67 769,6±21,49

AA 161,6±2,87 14,5±0,75 116,8±0,76** 806,8±28,62

Примечание: *- разность между генотипами AG и AA достоверна при р<0,1 **- разность между генотипами AA и AG достоверна при р<0,25 Note: •- the difference between the AG and AA genotypes is significant at р<0,1 ••- the difference between the AA and AG genotypes is significant at р<0,25

Сопоставив результаты исследований гена маркера MC4R с продуктивными показателями, мы установили, что животные с генотипом АА превосходили аналогов AG и GG - генотипов по показателям скороспелости (возраст достижения массы 100 кг), длины туловища и среднесуточного привеса (таблица 1).

Скороспелость у свинок породы дюрок генотипа АЛ меньше на 6 и 4 дней по сравнению с аналогами генотипа GG и AG, длина туловища больше на 1 и 5,9 см и среднесуточный привес больше на 50,8 и 37,2 г, соответственно. В то же время у свинок генотипа GG отмечается низкий показатель толщины шпика по сравнению с аналогами на 1,5 мм и по генотипу AA и по генотипу AG. Такая же тенденция по толщине шпика и среднесуточному привесу наблюдается у корейских ученых Kim K. S. et all (2006 г.) на породе дюрок.

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА: НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

Следовательно, «желательным» у свинок породы дюрок выступает генотип AA для наиболее быстрого роста и получения большего содержания мышечной массы.

Таблица 2 - Откормочные и мясные качества хрячков породы дюрок различных генотипов по гену MC4R

Table 2 - Fattening and meat qualities of Duroc boars of various genotypes according to the MC4R gene

Генотип / Genotype Скороспелость, дн. / Precocity, days. Толщина шпика, мм / Thickness of the fat, mm Длина туловища, см / Body length, Cm Среднесуточный прирост, г / Average daily gain, g

GG 146 9,5* 119* 1050**

AG 144,8±5,85 12,1±1,15 114,8±1,53 957,8±46,75

AA 146,8±2,15 11,2±1,40 117,4±2,04 949,6±36,33

Примечание: *- разность между генотипами AG и GG достоверна при р<0,05 **- разность между генотипами GG и AG достоверна при р<0,1 Note: •- the difference between the AG and GG genotypes is significant at р<0,1 ••- the difference between the GG and AG genotypes is significant at р<0,25

У хрячков наблюдается существенное превосходство откормочных и мясных показателей по генотипу GG. (таблица 2). Согласно проведенному анализу, высокие показатели продуктивности наблюдаются у хрячков с генотипом GG по гену MC4R. Так, по толщине шпика преобладание по отношению к генотипам AG и AA составляет на 2,6 и 1,7 мм, по длине туловища - на 4,2 и 1,6 см и по среднесуточному привесу - на 92,2 и 100,4 г, соответственно.

Также следует отметить зависимость между генотипами и скороспелостью, но она не имеет достаточного уровня достоверности. Отсутствие различий по показателю скороспелости, вероятно, связано с небольшой выборкой животных. Дальнейшие исследования позволят нам уточнить данные корреляции.

Следовательно, можно заключить, что «желательным» генотипом у хрячков породы дюрок по гену MC4R является GG. Также установлено основное влияние гена MC4R .которое идет на толщину шпика, длину туловища и среднесуточный привес в исследуемой выборке хрячков.

В литературе приведены результаты исследований по данному гену у различных пород свиней. Так, согласно американским ученым Kim K. S. et all (2000 г.) у ландрас-ов, крупной белой и гибридов (крупная белая х дюрок), китайским ученым Chen M. et all (2004 г.) у двухпородных гибридов (ландрас х Lantang), а также шведским ученым Bruun C.S. et all (2006 г.) у гибридов (гемпшир х ландрас), обнаружено, что наличие генотипа AA по гену MC4R, коррелирует с повышенной упитанностью туши. Бельгийские исследователи Van Den Maagdenberg K. (2007 г.) также отмечают связь генотипа AA с более высокими показателями упитанности туши и меньшим содержанием постного мяса у гибридов (крупная белая х пьетрен) и (ландрас х крупная белая). Такие же результаты наблюдала и Л. В. Гетманцева с соавторами (2012, 2014) на свиньях крупной белой породы. В своих работах она указывает, что особи с генотипом АА гена MC4R отличались лучшими среднесуточными привесами и большей толщиной шпика, в сравнении с животными с генотипом GG. Свиньи генотипа GG отличались лучшими мясными качествами, но при этом были менее скороспелы. Подобные результаты исследования получили и белорусские исследователи [4] на животных породы йоркшир. Они установили, что по показателям скороспелости, среднесуточного прироста и затратам корма предпочтительным являлся геноти AA, в то время как по этим же показателям у молодняка, полученного от хряков породы ландрас, предпочтительным был генотип GG. О взаимосвязи полиморфизма гена рецептора меланокартина MC4R 4 с про-

304

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

дуктивными показателями свиней, такими как среднесуточный прирост, потребление корма, рост мышц, содержание жира в туше и длина туши, сообщают отечественные ученые Костюнина О. В. и др. (2012 г.). Данные ученые отмечают, что влияние генотипов MC4R на продуктивные показатели зависит от породной принадлежности.

Нами также было замечено, что откормочные и мясные качества («желательные» генотипы по гену MC4R) свиней зависят от генетических особенностей породы и от пола животных.

Выводы. Таким образом, использование полиморфизма гена MC4R у породы дюрок с помощью маркерной селекции может привести к экономически выгодному ведению свиноводства и позволит повысить продуктивность животных.

Библиографический список

1. Бальников А. А. Оценка животных пород йоркшир и ландрас в зависимости от линейной принадлежности и панели генов-маркеров PRKAG3, MC4RM MYOD1 // Российская сельскохозяйственная наука. 2021. № 5. С. 51-57.

2. Бальников А. А. Оценка продуктивных качеств свиней пород йоркшир и ландрас по генам PRKAG3, MC4R И MYOD1 // Генетика и разведение животных. 2021. № 2. С. 28-35.

3. Гончаренко Г. М. Генотипическая структура разных пород свиней по генам MC4R И LEP и их связь с продуктивностью // Свиноводство. 2018. № 4. С. 11-15.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

4. Казутова Ю. С., Бальников А. А., Гридюшко И. Ф. Показатели мясной продуктивности свиней пород ландрас и йоркшир в зависимости от генотипов по генам MC4R, MYOD1, MYF4 // Аграрный вестник Урала. 2021. № 2 (205). С. 65-71.

5. Кононова Л. В., Смирнова Л. М. Интенсификация селекционного процесса на основе ДНК-тестирования // Известия Горского государственного аграрного университета. 2016. Т. 53. № 2.С. 162-166.

6. Максимов А. Г., Максимов Г. В., Гетманцева Л. В. Генотипы по генам FSHB, PRLP, MC4R и продуктивность свиноматок // Ветеринария, зоотехния и биотехнология. 2017. № 7. С. 82-91.

7. Сердюк Г. Н., Иванов Ю. В. Развитие отечественного свиноводства в условиях интенсификации отрасли // Зоотехния. 2018. № 6. С. 21-23.

8. Сердюк Г. Н. Полиморфизм гена-рецептора меланокортина MC4R у свиней различных пород // Генетика и разведение животных. 2018. № 3. С. 27-31.

9. Эффективность использования генетических маркеров в свиноводстве / В. В. Семенов [и др.] // Известия Горского государственного аграрного университета. 2017. Т. 54. № 3. С. 39-45.

10. Belous A. A., Sermyagin A. A., Zinovieva N. A. Genome-wide association study of feed efficiency in russian duroc boars // Journal of Animal Science. 2021. V. 99. № S3. P. 247.

11. Effects of single nucleotide polymorphism markers on the carcass and fattening traits in different pig populations / R. Biziene, K. Morkuniene, R. Miseikiene, N. Peciulaitiene, N. Makstutiene, E. Slyzius // Journal of Animal and Feed Sciences. 2018. Vol. 27. P. 255-262. https://doi.org/10.22358/jafs/95020/2018.

12. Markin N. V. SSR Analysis of Maternal and Paternal Lines Selected in the Don Region (Russia) // American Journal of Agricultural and Biological Science. 2016. Vol. 11. No 1. P. 13-18.

13. Melnikova E. Application of genomic data for reliability improvement of pig breeding value estimates // Animals. 2021. V. 11. № 6.

14. Sermyagin A. A. Feeding behavior as the new breeding traits in pigs // Agricultural Biology. 2021. V. 55. № 6. P. 1126-1138.

Информация об авторах Святогорова Александра Евгеньевна, младший научный сотрудник СКЗНИВИ - филиал ФГБНУ ФРАНЦ (346421, Россия, Ростовская область, город Новочеркасск, Ростовское шоссе, д. 0), ORCID: https://orcid.org/0000-0003-4233-1740 sviatogorova.a@yandex.ru

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА НАУКА И ВЫСШЕЕ ПРОФЕССИОНАЛЬНОЕ ОБРАЗОВАНИЕ

Третьякова Ольга Леонидовна, доктор сельскохозяйственных наук, профессор кафедры разведения сельскохозяйственных животных, частной зоотехнии и зоогигиены им. академика П.Е. Ладана ФГБОУ ВО ДГАУ (346493, Россия, Ростовская область, Октябрьский район, п. Персиановский, ул. Кривошлыкова, 24), ORCID: https://orcid.org/0000-0002-0295-8939 aldebaran.olga@yandex.ru Гетманцева Любовь Владимировна, доктор биологических наук, ведущий научный сотрудник ФГБОУ ВО ДГАУ (346493, Россия, Ростовская область, Октябрьский район, п. Персиановский, ул. Кривошлыкова, 24),

ORCID: https://orcid.org/0000-0003-1868-3148 ilonaluba@mail.ru

Святогоров Николай Алексеевич, кандидат сельскохозяйственных наук, доцент ФГБОУ ВО ДГАУ (346493, Россия, Ростовская область, Октябрьский район, п. Персиановский, ул. Кривошлы-кова, 24), SPIN-код автора 9092-4579 РИНЦ Author ID= 625671 ORCID: https://orcid.org/0000-0002-2495-6969 sviatogorov@mail.ru

Клименко Александр Иванович, академик РАН, доктор сельскохозяйственных наук, профессор, директор ФГБНУ "Федеральный Ростовский агарный научный центр", (346735, Россия, Ростовская обл., Аксайский район, пос. Рассвет, ул. Институтская, 1), ORCID: https://orcid.org/0000-0002-1884-6114 dzni@mail.ru

DOI: 10.32786/2071-9485-2022-02-38 COMPARATIVE ANALYSIS OF BIOPHYSICAL PROPERTIES OF BONE TISSUE OF BROILER CHICKENS USING OSTEOTROPIC COMPOUNDS

A. A. Vlasenko, M. P. Semenenko, E.V. Kuzminova

Federal State Budget Scientific Institution «Krasnodar Scientific Center for Animal Husbandry and Veterinary Medicine», Krasnodar

Received 07.04.2022 Submitted 05.05.2022

Summary

The article presents data on the study of the influence of osteotropic feed additives based on acidic calcium, bentonite of the Kantemirovskoye deposit of the Voronezh region and the drug siliostin on the strength of bone tissue in broiler chickens. These additives contain organic and inorganic forms of silicon, osteotropic micro- and macroelements that have a potentiating effect on bone tissue and increase its strength due to the active intensification of mineral metabolism. Data were obtained to determine the maximum limit load of the bones of the femur and lower limbs of broiler chickens.

Abstract

Introduction. To solve the problem of metabolic bone pathology in poultry farming it is necessary to use veterinary drugs and additives with high pharmacological activity in this pathology. A feature of these pharmaceutical substances is the balance of osteotropic elements, especially silicon, which is an activator of ossification processes at the molecular level. Therefore, when introducing various osteo-tropic feed additives and drugs into the diets, which have a pathogenetic effect and are means of preventing metabolic osteopathology, it is necessary to evaluate the mechanical characteristics of bone tissue in order to determine their strength and ability to withstand a specific load of the muscle mass of a growing poultry. Object. The object of the study was osteotropic feed additives based on acidic calcium, bentonite of the Kantemirovskoye deposit of the Voronezh region and the drug siliostin, which have pharmacological activity in metabolic osteopathology in broiler chickens. Materials and methods. For the experiment, six groups of broiler chickens of the C0BB-500 cross were formed - five experimental and one control (n=20). The chickens were fed with a complete mixed feed according to the following scheme: from the moment of birth to the 14th day of life - start; from 15 to 28 days -growth; from 29 days to slaughter - finish. From the 15th to the 42nd day of life, the experimental groups of poultry were fed with feed additives and their combinations in the basic diet, while the chickens of the control group received only complete compound feed. The duration of the experiment was 28 days. Studies to determine the biophysical properties of the bone tissue of broiler chickens were carried out on an electro-hydraulic press «PI-5000 kN». Results and conclusions. It has been determined that the introduction of the drug siliostin into the diet has the best effect on the mechanical

i Надоели баннеры? Вы всегда можете отключить рекламу.