CC BY
12# Research Results in Pharmacology
Research Results in Pharmacology 7(3): 33-39
UDC 577.212.2 DOI 10.3897/rrpharmacology. 7.72784
3 Research Article
Transgenic mice Cre-dependently expressing mutant polymerase-gamma: novel test-system for pharmacological study of mitoprotective drugs
Marina V. Kubekina1,2, Yulia Yu. Silaeva2, Alexandra V. Bruter1,2, Diana S. Korshunova1, Leonid A. Ilchuk1,2, Yulia D. Okulova1,2, Mariya O. Soldatova3, Evgeniya Seryogina4, Inga M. Kolesnik5, Polina A. Ukolova4, Mikhail V. Korokin5, Alexey V. Deykin1
1 Center for Precision Genome Editing and Genetic Technologies for Biomedicine, Institute of Gene Biology, Russian Academy of Sciences, 34/5 Vavilova St., Moscow 119334, Russia
2 Core Facility Centre, Institute of Gene Biology (IGB), Russian Academy of Sciences, 34/5 Vavilova St., Moscow 119334, Russia
3 Department of Biology, Medical Genetics and Ecology, Kursk State Medical University, 3 Karl Marx St., Kursk 305041, Russia
4 Cell Physiology and Pathology Laboratory, Orel State University, 95, Komsomolskaya, St., Orel 302026, Russia
5 Department of Pharmacology, Belgorod State National Research University, 85 Pobedy St., Belgorod 308015, Russia
Corresponding author: Marina V. Kubekina (kubekina@genebiology.ru)
Academic editor: Oleg Gudyrev ♦ Received 2 June 2021 ♦ Accepted 9 August 2021 ♦ Published 17 September 2021
Citation: Kubekina MV, Silaeva YuYu, Bruter AV, Korshunova DS, Ilchuk LA, Okulova YuD, Soldatova MO, Seryogina E, Kolesnik IM, Ukolova PA, Korokin MV, Deykin AV (2021) Transgenic mice Cre-dependently expressing mutant polymerase-gamma: novel test-system for pharmacological study of mitoprotective drugs. Research Results in Pharmacology 7(3): 33-39. https://doi. org/10.3897/rrpharmacology.7.72784
Abstract
Introduction: PolG-alpha is a nuclear-encoded enzyme which provides replication and repair of mitochondrial DNA. D257A mutation of PolG-alpha leads to change in the N-terminal "proofreading" domain, which deprives the enzyme of 3'-5' exonuclease activity, resulting in accumulation of mutations in the mitochondrial genome.
Materials and methods: Murine zygotes were microinjected with transgene construction carrying mutant murine Polg coding sequence and GFP coding sequence by a loxP-flanked STOP-cassette. Two Cre-activator strains, CMV-Cre (systemic activation) and Tie2-Cre (endothelial activation), were used for activation of the transgene. To confirm the insertion and Cre-dependent activation of the transgene, genotyping and qPCR copy number measurement of mutant Polg were performed, and GFP fluorescence was assessed.
Results: Two primary transgenic animals were used as the founders for two lines with copy numbers of transgene ~7 and ~5. After systemic activation, the number of the transgene copies decreases to ~1.0 while endothelial specific activation does not affect the number of transgene copies in tail tissue.
Discussion: A murine model with spatial control of mutant Polg expression has been developed. To our knowledge, this is the first transgenic model of tissue-specific mitochondrial dysfunction.
Conclusion: Transgenic mice Cre-dependent expressing mutant polymerase-gamma are a novel test-system for studying mitochondrial biology and efficacy of mitoprotective drugs.
Keywords
Cre-LoxP system, genome editing, IVF, mitochondrial polymerase-gamma, transgene copy number determination, transgenic mice
Copyright Kubekina MVetal. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC-BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Introduction
Mitochondrial dysfunction (MD) represents an inadequate number of mitochondria, or an inability to provide necessary substrates to mitochondria, or a dysfunction in their electron transport and ATP-synthesis machinery (Nicolson 2014). Besides a large group of monogenic mitochondrial diseases (MD) is a key link in the patho-biology of a wide spectrum of disorders, including cardiovascular (Zakirov et al. 2020), neurodegenerative (An-gelova et al. 2021) and metabolic diseases (Prasun 2020).
The mitochondrial genome is characterized by a high density of nucleotide substitutions and significant instability (10-17 times higher than the mutation rate of nuclear genes) (Wallace and Chalkia 2013; Aryaman et al. 2019). In addition, the mitochondrial genome is characterized by heteroplasmy, that is, copies can differ from each other in length, a set of genes, and the presence of mutations (Su et al. 2018). These features are due to rapid mutation processes (Fontana and Gahlon 2020), lack of recombination (El-Hattab et al. 2017), and cytoplasmic gene inheritance (Wei and Chinnery 2020) in the mitochondrial genome. The main reason for such mitochondrial genome instability lies in the absence of histones, the peculiarity of repair mechanisms, and the presence of free oxygen radicals, which are by-products of aerobic respiration (Woo et al. 2012; Nis-sanka and Moraes 2018). Many pathologies are associated with mitochondrial mutations, such as Leber hereditary optic neuropathy, chronic fatigue syndrome, encephalomyo-pathy, etc. (Orekhov et al. 2015; Hsu et al. 2016).
It is obvious that the improvement of approaches to treating mitochondrial pathologies requires adequate test systems. Herein, we describe an approach for creating a murine model that accumulates mutations in the mito-chondrial genome of somatic and germ cells due to the presence of Polg gene mutants.
PolG-alpha is an enzyme that mediates mitochondri-al DNA replication and repair (Copeland and Longley 2003). PolG-alpha is encoded by the nuclear genome and its mutant form PolG-alpha D257A leads to a change in the N-terminal "proofreading" domain, which deprives the enzyme of 3'-5' exonuclease activity. The mutant form of the protein is unable to correct polymerization errors, which leads to the accumulation of mutations in the mi-tochondrial genome. Previously, transgenic animals with constitutive ubiquitous mutant Polg expression have been
created, but their viability and fertility are critically reduced, which greatly complicates the experimental work (Trifunovic et al. 2004).
Materials and methods
Design and manufacture of genetic construct
The genetic construct was created based on the pKB1 vector and the mouse Polg gene ORF. The pKB1 vector was designed for Cre-dependent expression of the genes of interest. It contained an ampicillin resistance gene, as well as insulators and terminators to protect the transgene from the position effect (Bruter et al. 2021), a transcriptional unit under the control of the CAG promoter, a STOP-cassette flanked by LoxP sites (Deykin et al. 2019), multiple cloning site for transgene cloning, an encephalo-myocarditis virus IRES element in the one reading frame with GFP gene and an SV40polyA signal. It is assumed that transgene expression in pKB1 is activated only after site-specific recombination at LoxP sites and subsequent STOP-cassette excision by Cre recombinase (Fig. 1).
Total RNA for Polg cloning was extracted from mouse liver biopsy. The tissue was homogenized using the Pre-cellys 24 homogenizer, and RNA was extracted using a QIAGEN RNeasy Mini Kit. cDNA was synthesized using RevertAid Reverse Transcriptase (Thermo Scientific) and specific primer P1 (all primer sequences are presented in Table 1) for mouse Polg gene 3-UTR. Polg gene (3653 bp) was amplified with Platinum SuperFi polymerase (Invitrogen), using primers P2 and P3. The amplified
Table 1. Primer sequences used in the study
Code Sequence 5'^3'
P1
P2
P3
P4
P5
P6
P7
P8
P9
P10
P11
P12
P13
ATGGCTGCCTTTTGCAAAAAAGC ATTAACGCGTATGAGCCGCCTGCTCTGGAA TAATACGCGTCTAGGGTCCAGGCTGGCTTCG CTCGAGCCCATATCAGGGAACAG CAAAGGAAACATTGTGCCCCAC GTTAGATCTGCTGCCACCGT AGGTGGCAAGTGGTATTCCG GCGGTCTGGCAGTAAAAACTATC GTGAAACAGCATTGCTGTCACTT CTAGGCCACAGAATTGAAAGATCT GTAGGTGGAAATTCTAGCATCATCC GTGCATGTTTGCCTATAAGCTGG GGTAAATATCCAGTGCTTCACCCT
Figure 1. Linearized pKB1-Polg genetic construct design.
fragment was subjected to site-directed mutagenesis after cloning into the intermediate T-vector pTZ57R/T (Ad-dgene). Site-directed mutagenesis was carried out using primers P4 and P5, due to which it was possible to introduce the D257A mutation into the native mouse Polg gene ORF, which deprives the enzyme of 3'-5'-exonucle-ase "proofreading" activity. This mutated Polg gene was sequenced, amplified using primers P2 and P3, treated with the restriction enzyme Mlul (Thermo Fisher Scientific) with subsequent insertion into the pKB1 vector, enzyme treatment and dephosphorylation FastAP, Thermo Fisher Scientific).
Then the construction was prepared for microinjections: circular plasmid DNA was treated with the restriction enzyme Pvul (Thermo Fisher Scientific); the resulting fragments were separated by electrophoresis in agarose gel. A linear fragment 14832 bp, devoid of bacterial sequences, was extracted using a Monarch kit for isolation of DNA fragments from gels and reaction mixtures (New England Biolabs) and dissolved in TE buffer at a concentration of 1 ng/^l (Zvartsev et al. 2019).
Animals and keeping conditions
Several mice strains were used in the work. 6-8-week-old males of hybrid F1 (CBA X C57BL/6) (Stolbovaya Nursery) were used as breeders; immature females (12-13 g) CBA X C57BL/6 were used as donors; 8-10-week-old females CD1 were used as recipients. During the experimental work, the mice were kept in the vivarium of the Institute of Gene Biology of the Russian Academy of Sciences. The mice were kept in conditions of free access to water and food, a 12/12 light cycle, air temperature 23±1°C, and humidity of 42±5%.
Two activator mice of the Cre strain obtained from Jackson Laboratory were used to activate transgene expression, namely B6.C-Tg(CMV-cre)1Cgn/J Stock No: 006054|CMV-Cre (systemic activation) and B6.Cg-Tg(Tek-cre) 1 Ywa/J Stock No: 008863|Tie2-Cre (en-dothelial activation).
cultivation. "Spermoprep" medium was used for sperm culture (Paneco, Russia), and IVF was carried out in the G-IVF PLUS medium (Vitrolife Sweden AB, Sweden).
Transgenic animals creation
Primary F0 transgenic animals were obtained through a microinjection of a gene construct into zygote pronucleus. The method for obtaining primary transgenic animals was described in detail earlier (Zvezdova et al. 2010; Silaeva et al. 2018).
In vitro fertilization
The method of intravital surgical sperm collection was used for IVF according to the protocol (Val and Robleda-no 2013) to obtain F1 offspring from the primary transgene #1683. Two-blastomeric embryos obtained after IVF were transferred to recipients.
Genotyping
Mouse DNA is derived from tail tissue. Tissue samples were lysed in alkaline lysis (25 mM NaOH, 0.2 mM EDTA) and purified by the phenol-chloroform method. The mice were genotyped using the PCR method and the following reagents: HS Taq-polymerase, Red buffer, and dNTP (Evrogen), and the STOP-cassette specific primers - P6 and P7 (292 bp fragment amplification, Fig. 2).
Genotyping of Cre mice was carried out in accordance with the Jackson Laboratory recommendations using primers P8, P9, P10, and P11.
Copy number determination
Transgene copy number was measured by real-time PCR as described earlier (Bruter et al. 2021). We used primers P12 and P13 to measure Polg transgene copy number.
Ethical approval
Solutions and media
The M2 medium (Sigma-Aldrich, USA) was used to wash out the oocytes, the "Droblenie" medium (Paneco, Russia) and mineral oil (Sigma, USA) were used for the oocytes
All the animal experiments were approved and controlled by the IGB RAS Bioethics Commission (the conclusion of the Bioethical Commission dated 30/04/2021). The animal experiments neither posed any biological hazards, nor required any biosafety facility.
1251 1252 1253 1254 U82 1683 1¿84 1751 1752 1770 WT H20 Ctrl*
Figure 2. Polg F0 mice genotyping. Samples by numbers #1251, #1254, #1683 and #1752 are transgenes.
Results
Primary transgenic mice creation with mutant Polg gene inducible expression
In the process of creating the model, 1081 microinjec-ted embryos were obtained; they were transplanted to 104 recipients. As a result, 29 mice were born from 17 recipients, of which 4 turned out to be the primary Polg transgenes. These were mice #1251$, #1254$, #1683$, #1752$. The results of genotyping are shown in Fig. 2.
Transgene copy number was determined for all primary transgenes. Primary transgenic mice often have a mosaic pattern of transgene construct insertion into the genome. The results of the copy number measurement are presented in Table 2. For mouse #1251, the copy number was 0.35 transgene copies per genome, for mouse #1752 - 0.1 transgene copies per genome, for mouse #1254 -0.30 transgene copies per genome, and for mouse #1683, the copy number was ~7 transgene copies per genome.
Obtaining two independent animal lines with induci-ble expression of the mutant Polg gene
All primary transgenes were put into crosses to obtain F1 generation of transgenic animals. Mice #1251 and #1752 died, leaving no offspring. One F1 transgenic mouse (of 90 offspring) 5479$, with a ~7 copy number, was obtained from transgenic mouse #1254 (Table 2). Transgenic animal #1683$ with the highest copy number turned out to be viable, but not capable of independent reproduction. So, we performed a surgical collection of sperm from the epididymis and used the obtained material for IVF
Table 2. Polg transgene copy number in the strains of genetically modified mice
Line Mouse number Generation Copy number
Polg 1251 F0 0.35
Polg 1254 F0 0.30
Polg 1683 F0 7.37
Polg 1752 F0 0.1
Polg 5479 F1 6.71
Polg 6981 F1 5.44
Polg 7513 F2 6.90
Polg 7515 F2 7.36
Polg 7538 F2 6.39
Polg 7539 F2 6.46
Polg*Tie2 893 F3 6.59
Polg*Tie2 898 F3 6.34
Polg*Tie2 903 F3 5.39
Polg*Tie2 904 F3 5.29
Polg*Tie2 905 F3 5.66
Polg*CMV 889 F3 1.77
Polg*CMV 1503 F3 1.61
Polg*CMV 8429 F2 1.20
(the method is described above) to obtain F1 offspring. Two-blastomeric embryos resulting from IVF were transferred to the recipients. As a result, one transgenic mouse F1 was obtained with number 6981$, with a ~5 copy number. Many F2 offspring with a ~7 copy number were obtained from F1 5479$ (Table 2).
As a result, we obtained two independent lines of mice with a transgene ~7 and ~5 copy number for the inducible expression of the mutant form of Polg.
Transgene copies in three Polg strain variants
As a result of Polg transgenic mice crossing of the strain with mice expressing Cre-recombinase systemically and
Polg*Tie
Figure 3. The results of copy number determination in different Polg strains. Transgene copy number of the Polg*CMV is significantly reduced compared to Polg and Polg*Tie2. Copy numbers of Polg and Polg*CMV significantly differ (p < 0.01). Copy numbers of Polg and Polg*Tie insignificantly differ (p~0.05).
in the vascular endothelium, we obtained double transgenes Polg*Tie2 and Polg*CMV. The copy number was determined in all samples from double transgenic mice (Table 2, Fig. 3).
From the chart above, with systemic activation, the transgene copy number decreases to ~1, while with en-dothelial activation, the transgene copy number remains at the same level in the tail tissue. This is the expected result, since systemic activation presupposes widespread recombination of the STOP-cassette from the entire genomic DNA of the organism, leaving only one copy of the transgene per genome. This allows us to evaluate the efficiency of the Cre-LoxP system. In transgenic Polg*Tie2 mice, similar recombination occurs only in vascular endothelial cells.
GFP fluorescence of Polg*CMV pup
We detected GFP fluorescence in transgenic Polg*CMV mouse skin via a UV lamp in just one day after birth (Fig. 4). This means that mutant PolG-alpha and GFP coexpression is activated during embryogenesis.
Figure 4. Transgenic pup (left) skin in the UV chamber compared to two non-transgenic siblings (right).
We only see GFP fluorescence in one pup out of three, the other two are not transgenic, which is confirmed by genotyping results.
Discussion
Mutations of several genes involved in the maintenance of vital functions of mtDNA and in mitochondrial protein synthesis have been described. One of these genes is poly-merase-gamma, which replicates and repairs mitochond-rial DNA. PolG-alpha is an attractive target for the creation of model animals, since this enzyme is encoded by the nuclear genome, within which it is much easier to make genetic engineering modifications. Moreover, a decrease in PolG-alpha function leads to spontaneous mutations accumulation, resulting in heteroplasmic mutant mtDNA, which represents genuine MD caused by oxidative and nitrosative stress, inflammation, xenobiotics exposure, etc. (Payne and Chinnery 2015).
Trifunovic et al. (2004) carried out an experiment to create mice with a mutant form of this enzyme, namely, they deprived it of its 3'-5'-exonuclease activity. Thus, these mice did not repair the errors created by PolG-alpha in the mitochondrial DNA of all mouse organism cells. That study showed that an increase in mtDNA mutations
in somatic cells is associated with a decrease in life expectancy and premature onset of aging. In the mice of this strain, the following was observed: weight loss, decreased subcutaneous fat content, hair loss, kyphosis, osteoporosis, anemia, decreased fertility, and enlarged heart (Tri-funovic et al. 2004). This phenotype negatively affects the viability of transgenes and significantly complicates the maintenance of the animal strain. Our model is free from these drawbacks since it assumes inducible and tissue-specific expression of the mutant form of the protein.
To obtain a universal and viable model, we used a genetic construct based on the Cre-LoxP system, due to which the inducible tissue-specific expression of the mutant Polg gene is possible. Due to the presence of a STOP-cassette, the expression of the protein mutant form and the subsequent phenotypic manifestation are possible only after crossing the obtained model animals with mice with tissue-specific Cre-recombinase activation (Bruter et al. 2021).
For the first time, we were able to develop a model of tissue-specific rather than systemic mitochondrial dysfunction. We believe that mutant PolG-alpha tissue-specific expression will lead to an increase in the number of mitochondrial genome mutations in certain tissues (depending on the activator used), for example, in the vascular endothelium. These animals can be further used in basic research and preclinical trials of mitoprotective drugs.
Separately, it is worth mentioning that our murine model with spatial control of mutant Polg expression has been developed. This means that we can obtain mice with different degrees of heteroplasmy, and at the same time mitochondri-al dysfunction. An increase in a degree of heteroplasmy is achieved by crossing Polg females of the same line in each generation with males of any lines. Thanks to this, we can assess the effect of a degree of heteroplasmy on the phenotype and assess a phenotypic effect of mitotherapeutic drugs.
This strain will make it possible to assess an increased mutational load effect of the mitochondrial genome of a certain tissue on the vital activity of the whole organism. The model of mitochondrial dysfunction proposed by us is more viable and adequate for studying this pathology in specific tissues. It provides wide opportunities for the study of mitochondrial dysfunction in neurons, immune, muscle, endothelial cells, which is of considerable scientific interest. In this work, we did not confirm the mitochondrial dysfunction phenotype in transgenic mice, which is the subject of further research.
Conclusion
Here we describe the creation of the first mouse strain with conditional expression of the mutant polymerase-gamma. As a result of microinjection and embryo transfer of genetically modified embryos, primary transgenic animals were born and bred. After breeding with Cre activators, the transgene expression was confirmed by GFP fluorescence and a decrease in the copy number of the mutant Polg transgene. Thus, transgenic mice Cre-dependently expressing mutant polymerase-gamma is a novel test-sys-
tem for studying mitochondrial biology and efficacy of mitoprotective drugs.
Conflict of interest
The authors have declared that no competing interests exist.
References
■ Angelova PR, Esteras N, Abramov AY (2021) Mitochondria and lipid peroxidation in the mechanism of neurodegeneration: Finding ways for prevention. Medicinal Research Reviews 41(2): 770-784. https://doi.org/10.1002/med.21712 [PubMed]
■ Aryaman J, Johnston IG, Jones NS (2019) Mitochondrial heterogeneity. Frontiers in Genetics 9: 718. https://doi.org/10.3389/ fgene.2018.00718 [PubMed] [PMC]
■ Bruter AV, Korshunova DS, Kubekina MV, Sergiev PV, Kalinina AA, Ilchuk AA, Silaeva YY, Korshunov EN, Soldatov VO, Deykin AV (2021) Novel transgenic mice with Cre-dependent co-expression of GFP and human ACE2: a safe tool for study of COVID-19 pathogenesis. Transgenic Research 30: 289-301. https://doi.org/10.1007/ s11248-021-00249-8 [PubMed] [PMC]
■ Copeland WC, Longley MJ (2003) DNA polymerase gamma in mi-tochondrial DNA replication and repair. The Scientific World Journal 3: 34-44. https://doi.org/10.1100/tsw.2003.09 [PubMed] [PMC]
■ Del Val GM, Robledano PM (2013) In vivo serial sampling, of epididymal sperm in mice. Laboratory Animals 47(3): 168-174. https:// doi.org/10.1177/0023677213478411 [PubMed]
■ Deykin A, Tikhonov M, Kalmykov V, Korobko I, Georgiev P, Mak-simenko O (2019) Transcription termination sequences support the expression of transgene product secreted with milk. Transgenic Research 28(3-4): 401-410. https://doi.org/10.1007/s11248-019-00122-9 [PubMed]
■ El-Hattab AW, Craigen WJ, Scaglia F (2017) Mitochondrial DNA maintenance defects. Biochimica et Biophysica Acta - Molecular Basis of Disease 1863(6): 1539-1555. https://doi.org/10.1016/j.bba-dis.2017.02.017 [PubMed]
■ Fontana GA, Gahlon HL (2020) Mechanisms of replication and repair in mitochondrial DNA deletion formation. Nucleic Acids Research 48(20): 11244—11258. https://doi.org/10.1093/nar/gkaa804 [PubMed] [PMC]
■ Hsu YR, Yogasundaram H, Parajuli N, Valtuille L, Sergi C, Oudit GY (2016) MELAS syndrome and cardiomyopathy: linking mitochondrial function to heart failure pathogenesis. Heart Failure Reviews 21(1): 103-116. https://doi.org/10.1007/s10741-015-9524-5 [PubMed]
■ Nicolson GL (2014) Mitochondrial dysfunction and chronic disease: Treatment with natural supplements. Integrative Medicine (Encini-tas, Calif.) 13(4): 35-43. [PubMed]
■ Nissanka N, Moraes CT (2018) Mitochondrial DNA damage and reactive oxygen species in neurodegenerative disease. FEBS Letters 592(5): 728-742. https://doi.org/10.1002/1873-3468.12956 [PubMed] [PMC]
■ Orekhov AN, Zhelankin AV, Kolmychkova KI, Mitrofanov KY, Kubekina MV, Ivanova EA, Sobenin IA (2015) Susceptibility of monocytes to activation correlates with atherogenic mitochondrial DNA mutations. Experimental and Molecular Pathology 99(3): 672676. https://doi.org/10.1016/j.yexmp.2015.11.006 [PubMed]
■ Payne BA, Chinnery PF (2015) Mitochondrial dysfunction in aging: Much progress but many unresolved questions. Biochimica et
Funding
The reported study was funded by the Russian Foundation for Basic Research, project number 19-34-90073 and by grant from the President of the Russian Federation No. MD-757.2020.7.
Biophysica Acta 1847(11): 1347-1353. https://doi.org/10.1016/j. bbabio.2015.05.022 [PubMed] [PMC]
■ Prasun P (2020) Mitochondrial dysfunction in metabolic syndrome. Biochimica et Biophysica Acta - Molecular Basis of Disease 1866(10): 165838. https://doi.org/10.1016Zj.bbadis.2020.165838 [PubMed]
■ Silaeva YY, Kirikovich YK, Skuratovskaya LN, Deikin AV (2018) Optimal number of embryos for transplantation in obtaining genetic-modified mice and goats. Russian Journal of Developmental Biology 49(6): 356-361. https://doi.org/10.1134/s106236041806005x [in Russian]
■ Su T, Turnbull DM, Greaves LC (2018) Roles of mitochondrial DNA mutations in stem cell ageing. Genes (Basel) 9(4): 182. https://doi. org/10.3390/genes9040182 [PubMed] [PMC]
■ Trifunovic A, Wredenberg A, Falkenberg M, Spelbrink JN, Rovio AT, Bruder CE, Bohlooly-Y M, Gidlöf S, Oldfors A, Wibom R, Törnell J, Jacobs HT, Larsson NG (2004) Premature ageing in mice expressing defective mitochondrial DNA polymerase. Nature 429(6990): 417-423. https://doi.org/10.1038/nature02517 [PubMed]
■ Wallace DC, Chalkia D (2013) Mitochondrial DNA genetics and the heteroplasmy conundrum in evolution and disease. Cold Spring Harbor Perspectives in Biology 5(11): a021220. https://doi.org/10.1101/ cshperspect.a021220 [PubMed] [PMC]
■ Wei W, Chinnery PF (2020) Inheritance of mitochondrial DNA in humans: implications for rare and common diseases. Journal of Internal Medicine 287(6): 634-644. https://doi.org/10.1111/ joim.13047 [PubMed]
■ Woo DK, Green PD, Santos JH, D'Souza AD, Walther Z, Martin WD, Christian BE, Chandel NS, Shadel GS (2012) Mitochondrial genome instability and ROS enhance intestinal tumorigenesis in AP-C(Min/+) mice. The American Journal of Pathology 180(1): 24-31. https://doi.org/10.1016/j.ajpath.2011.10.003 [PubMed] [PMC]
■ Zakirov FH, Zhang D, Grechko AV, Wu WK, Poznyak AV, Orekhov AN (2020) Lipid-based gene delivery to macrophage mitochondria for atherosclerosis therapy. Pharmacology Research & Perspectives 8(2): e00584. https://doi.org/10.1002/prp2.584 [PubMed] [PMC]
■ Zvartsev RV, Korshunova DS, Gorshkova EA, Nosenko MA, Korneev KV, Maksimenko OG, Korobko IV, Kuprash DV, Druts-kaya MS, Nedospasov SA, Deikin AV (2019) Neonatal lethality and inflammatory phenotype of the new transgenic mice with overexpression of human interleukin-6 in myeloid cells. Doklady Biochemistry and Biophysics 483(1): 344-347. https://doi.org/10.1134/ S1607672918060157 [PubMed] [in Russian]
■ Zvezdova ES, Silaeva YY, Vagida MS, Maryukhnich EV, Deikin AV, Ermolkevich TG, Kadulin SG, Sadchikova ER, Goldman IL, Kazansky DB (2010) Generation of transgenic animals expressing the alpha- and beta-chains of the autoreactive T-cell receptor. Molecular Biology 44(2): 311-322. https://doi.org/10.1134/ S0026893310020135 [PubMed] [in Russian]
Author contributions
■ Marina V. Kubekina, postgraduate student, junior researcher at the Institute of Gene Biology, Russian Academy of Sciences, e-mail: kubekina@genebiology.ru, ORCID ID https://orcid.org/0000-0002-8834-1111. Writing the article, molecular cloning, analyzing transgenic mice PCR, and measuring copy number.
■ Yulia Yu. Silaeva, Ph.D, research fellow at the Institute of Gene Biology, Russian Academy of Sciences, e-mail: yulya.silaeva@gmail.com, ORCID ID https://orcid.org/0000-0003-2070-9001. Writing the article and developing a research design.
■ Alexandra V. Bruter Ph.D, research fellow at the Institute of Gene Biology, Russian Academy of Sciences, e-mail: aleabruter@gmail.com, ORCID ID https://orcid.org/0000-0002-2090-2488. Developing a research design.
■ Diana S. Korshunova, senior technician at the Institute of Gene Biology, Russian Academy of Sciences, e-mail: korshunova@genebiology.ru, ORCID ID https://orcid.org/0000-0002-0259-7045. Coducting microinjections and working with the animals in all stages.
■ Leonid A. Ilchuk, senior technician at the Institute of Gene Biology, Russian Academy of Sciences, e-mail: le-chuk12@gmail.com, ORCID ID https://orcid.org/0000-0002-0157-2102. Measuring copy number and working with graphic material.
■ Yulia D. Okulova, senior technician at the Institute of Gene Biology, Russian Academy of Sciences, e-mail: oku-lova@genebiology.ru. Analyzing transgenic mice PCR analysis.
■ Mariya O. Soldatova, 2nd year student of Biology, Medical Genetics and Ecology Department, Kursk State Medical University, e-mail: mar.sold46@gmail.com, ORCID ID https://orcid.org/0000-0001-6637-1654. Genotyping
■ Evgeniya Seryogina, research assistant of Cell Physiology and Pathology Laboratory, Orel State University, e-mail: e.s.seryogina@gmail.com, ORCID ID https://orcid.org/0000-0002-2796-4040. Writing the article.
■ Inga M. Kolesnik, PhD in Medical Sciences, Associate Professor, Department of Pharmacology and Clinical Pharmacology, e-mail: kolesnik_i@bsu.edu.ru. The author was engaged in collection, analysis and interpretation of the data for publication.
■ Polina A. Ukolova, research assistant of Cell Physiology and Pathology Laboratory, Orel State University, e-mail: polya.ukolova@yandex.ru, ORCID ID https://orcid.org/0000-0002-9636-513X. Writing the article.
■ Mikhail V. Korokin, Doctor Habil. of Medical Sciences, Professor, Department of Pharmacology and Clinical Pharmacology, e-mail: mkorokin@mail.ru, ORCID ID https://orcid.org/0000-0001-5402-0697. Conceiving the idea and planning research.
■ Alexey V. Deykin, Ph.D, senior scientist at the Institute of Gene Biology, Russian Academy of Sciences, e-mail: alexei@deikin.ru, ORCID ID https://orcid.org/0000-0001-9960-0863. Conceiving the idea and planning research.
