CC BY
13
Ukrainian Journal of Ecology
Ukrainian Journal of Ecology, 2018, 8(4), 264-265
ORIGINAL ARTICLE
The potentional use of hyperparasitic Tuberculins persicina and Fasarium sambucinusfor biocontrol of Puccinia sp.
M.V. Skaptsov1, M.G. Kutsev1, S.V. Smirnov12, O.V. Uvarova1, T.A. Sinitsina1,
A.A. Kechaykin1, A.I. Shmakov1
South-Siberian Botanical Garden, Altai State University, pr. Lenina 61, Barnaul, 656049, Russia 2 PlantaBio LLC, Lesosechnaya, 25, Barnaul, 656906, Russia Submitted: 29.10.2018. Accepted: 03.12.2018
We have discovered and introduced in culture in vitro hyperparasitic fungi: Tuberculinа persicina (Ditmar) Sacc. and Fusarium sambucinus Fuckel. In nature, these species caused a significant damage and antagonistic effect against the rust fungus Puccinia sp. on elderberry. The isolation and identification of regional hyperparasitic fungi are necessary to provide a pool of biological agents for biocontrol. The high activity of isolated isolates, as well as the possibility of obtaining spores on solid nutrient media, is promising for the biocontrol of rust fungi infecting wild and cultivated trees. Key words: Tuberculina, Fusarium, biocontrol, plant diseases, hyperparasitism.
Due to the high load on biosystems with synthetic insecticides and fungicides, the use of biological agents is a promising direction. Most often, natural antagonists of insects, bacterial and fungal rots, and rust fungi are used as biological agents. Many anamorphic forms of fungi are hyperparasites of rust fungi, and due to the complex life cycle, new species are constantly found. Verticillium lectures and spherelopsis phylum are often used as promising biocontrol agents, as well as Tuberculina photiniae, Zygosporium gibbum, Cladosporium uredinicola, Scytalidium uredinicola, Aphanocladium album, Cladosporium tenuissimum, Cladosporium cladosporioides, Cladosporium pseudocladosporioides, Ramularia sp. and many others (Spencer & Atkey, 1981; Plachecka, 2005; Bartkowska, 2007; Manimohan & Mannethody, 2011; Zhao et al., 2017; Torres et al., 2017). Tuberculina persicina is an anamorph stage of Helicobasidium purpureum which is rust parasites (Lutz et al., 2004). In this regard, often discussed the possibility of using Tuberculina sp. for biological control of rust fungi. In our study was detected hyperparasitism species T. persicina and F. sambucinum in infected trees Sambucus racemose by rust fungus Puccinia sp., and were put in culture in vitro.
Methods
T. persicina and F. sambucinuswas isolated from the infected with Puccinia sp. trees in the South-Siberian Botanical Garden. The fungi were transferred to potatodextrose agar (PDA) and incubated at 25 °C, under diffuse light. The individual fungus colony was transferred to fresh media until a clear culture was isolated. Identification was carried out morphologically and by PCR analysis (BLAST algorithms). For isolate, a portion of a colony was scraped from the agar plates and transferred into a 1.5ml Eppendorf tube. DNA was isolated by DiamondDNA kit (ABT LLc., Russia). The primers ITS1 5'- TCCGTAGGTGAACCTGCGG -3', ITS4 5'- TCCTCCGCTTATTGATATGC -3' were used for amplification (White et al., 1990). PCR(s) and sequencing were carried out as our previous studies (Skaptsov et al., 2017; Skaptsov et al., 2018).
Results and Discussion
Puccinia sp. infected the trees species Sambucus racemosa. At the same time on the spots of Puccinia sp. two types of hyperparasitic fungi were identified. Morphological and BLAST search data using ITS markers allowed us to identify hyperparasites. In most cases, T. persicina sclerotia were found. In some cases, its teleomorphic stage of H. purpureum was formed on sclerotia. Both stages were isolated and cultured in vitro. (fig. 1). To a lesser extent, Puccinia sp. was infected with F. sambucinum. A significant reduction in the growth of Puccinia spots has been identified. In most cases, after the appearance of T. persicina sclerotia, Puccinia sp. suspended and the spot dries up. Parts of the T. persicina sclerotia and mycelium of F. sambucinum were transferred to nutrient media. The isolates showed a good growth rate on the PDA agar. Mature conidia were formed in 7 days after inoculation. T. persicina sclerotia formed dense masses on nutrient media and did not form a teleomorphic stage in in vitro culture. Many species are bio control agents of plant pathogenic rust fungi. Tuberculina plays a major role in controlling of various plant diseases. A promising use of anamorphic forms may be to protect the forest due to the high risk of reproduction of teleomorphic forms in cultural species that are their parasites. In this regard, long-term field studies are necessary conditions for the transition stage in anamorphic teleomorphic to prevent the risk of fungal diseases of crop species.
265
The potentional use of hyperparasitic Tuberculina persicina and Fasarium sambucinus
Figure 1. Morphology of T. persicina and F. sambucinum on nature and in vitro culture. a. Puccinia sp. on Sambucus racemosa leaves; b. F. sambucinum on Puccinia sp. spot; c. T persicina sclerotia on Puccinia sp. spot; d - f. F. sambucinum, T. persicina teleomorph and anamorph on PDA plate; g - i. F. sambucinum, T. persicina anamorph and teleomorph spores
References
Bartkowska, A. (2007). Parasitism of rust fungi spores by Ramularia species. Phytopathologia Polonica, 43, 61-67.
Lutz, M, Bauer, R., Begerow, D., Oberwinkler, F. (2004). Tuberculina - Thanatophytum/Rhizoctonia crocorum - Helicobasidium: a unique mycoparasitic-phytoparasitic life strategy. Mycological Research, 108(3), 227-238.
Manimohan, P., Mannethody, S. (2011). Zygosporiumgibbum: a new and remarkable rust hyperparasite. Mycosphere, 2(3), 219-222. Plachecka, A. (2005). Microscopical observations of Sphaerellopsis filum, a parasite of Puccinia recondite. Acta Agrobotanica, 58(1), 67-71. Skaptsov, M., Smirnov, S., Kutsev, M., Uvarova, O., Sinitsyna, T., Shmakov, A., A. Matsyura (2018). Antifungal activity of several isolates of Trichoderma against Cladosporium and Botrytis. Ukrainian Journal of Ecology, 8(1), 88-91.
Skaptsov, M., Smirnov, S., Kutsev, M., Uvarova, O., Sinitsyna, T., Shmakov, A. & A. Matsyura (2017). Pathogenicity of Simplicillium lanosoniveum to Coccus hesperidum. Ukrainian Journal of Ecology, 7(4), 689-691.
Spencer, D.M., Atkey, P.T. (1981). Parasitic effects of Verticillium lecaniion two rust fungi. Transactions of the British Mycological Society, 77(3), 535-542.
Torres, D.E., Rojas-Martinez R.I., Zavaleta Mejia E., Guevara-Fefer, P., Marquez-Guzman G.J., Perez-Martinez, C. (2017). Cladosporium cladosporioidesand Cladosporiumpseudocladosporioidesas potential new fungal antagonists of Puccinia horiana Henn., the causal agent of chrysanthemum white rust. PLoS ONE, 12(1), e0170782, doi:10.1371/journal.pone.0170782
White, T.J., Bruns, T., Lee, S., Taylor, J. (1990). Amplification and direct sequencing of fungi ribosomal RNA genes for phylogenetics. In: M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White (Eds.), PCR Protocols. A Guide to Methods and Applications. San Diego: Academic Press, 315-322 Zhao, Y., Xie, J., Li, M., Zhu, L., Zhou, T., Chen, Y. (2017). Tuberculina photiniae sp. nov. (Helicobasidiales, Basidiomycota) supported by morphological characteristics and phylogenetic data. Phytotaxa, 317(2), 113-112.
Citation:
Skaptsov, M.V., Kutsev, M.G., Smirnov, S.V., Uvarova, O.V., Sinitsina, T.A., Kechaykin, A.A., Shmakov, A.I. (2018). The potentional use of hyperparasitic Tubercuiina persicina and Fasarium sambucinusfor biocontroi of Pucciniasp. Ukrainian Journal of Ecology, 8(4), 264-265. I :■ E^^MIThis work is licensed under a Creative Commons Attribution 4.0. License
Ukrainian Journal of Ecology, 8(4), 2018
