CC BY
47
Ukrainian Journal of Ecology
Ukrainian Journal of Ecology, 2018, 8(1), 88-91 doi: 10.15421/2017_191
ORIGINAL ARTICLE
Antifungal activity of several isolates of Trichoderma against Cladosporium and Botrytis
M. Skaptsov1, S. Smirnov1,2, M. Kutsev1, O. Uvarova1, T. Sinitsyna1, A. Shmakov1, A. Matsura1
1 Altai State University, Barnaul, 656049, Russia E-mail: mr.skaptsov@maii.rL, m kucev@mail.ri, uwarowa@mail.r , t.sinitsyna@list.r , ssbgbot@mail. r , amatsyura@gmail. com,, 2PlantaBio LLC, Barnaul, Russia E-mail: serg sm @mail.ru Submitted:23.11.2017. Accepted: 09.01.2018
Trichoderma isolates (SSBGT07, SSBGT08, SSBGT09, SSBGT10) were isolated from the soil samples of the South-Siberian Botanical Garden and identified using morphological observation and ITS region analysis as Trichoderma harzianum, T. asperellum, T. ghanense, and T. longibranchiatum. Antagonistic activity against Cladosporium sp. and Botrytis sp. was evaluated in vitro. All isolates showed antagonistic effect by competition against Cladosporium sp. T. asperellum and T. longibranchiatum showed antagonism against Botrytis sp. All isolates showed hyper sporulation on the sclerotia of Botrytissp. (except the T. ghanense) and colonies of the Cladosporium sp. Our study provides new isolates that affect the Cladosporium sp. and Botrytis sp.
Key words: antifungal activity; Botrytis, Cladosporium, fungi; PCR; Trichoderma
Introduction
Trichoderma species are generally abundant on decaying wood and in soil because of their success in various heterotrophic interactions, including decomposition, parasitism, and even opportunistic endophytism (Druzhinina et al., 2006). Trichoderma spp. have important applications in industry and agrotechnology. Many species are bio control agents of plant pathogenic fungi, plant growth stimulators, destructors and antibiotic producers. Trichoderma plays a major role in controlling of various plant diseases. Trichodermais widely represented in root, soil and foliar environments and used as a biofertilizer because of its ability to establish mycorrhiza-like association with plants. Trichoderma can decompose the crop residues into good quality compost not only in pit level but in situ also, which will improve organic matter along with macro, micronutrients, physic chemical and biological conditions of soil (Saba et al., 2012; Sharma et al., 2012). Many species of Trichoderma can act as bio-remediants and accumulate heavy metals from the environment (Hoseinzadech et al., 2017). This property shows the potential for urban use. But undoubtedly one of the main features is the anti-fungal activity.
Materials and methods
Different Trichoderma species were isolated from soil probe of South-Siberian Botanical Garden. Isolate of Trichoderma species was isolated and identified on potato dextrose agar (PDA). Identification was carried out morphologically and by PCR analysis. Botrytissp. and Cladosporium sp. were isolated from infectious plants. For isolate, a portion of a colony was scraped from the agar plates and transferred into a 1.5-ml Eppendorf tube. DNA was isolated by DiamondDNA kit (ABT LLc., Russia). The primers ITS1 5'- TCCGTAGGTGAACCTGCGG -3', ITS4 5'- TCCTCCGCTTATTGATATGC -3' were used for amplification (White et al., 1990). PCR(s) were carried out in 25 |JL reaction mix which included 5 ng DNA, 2.5 |JL 10x PCR buffer and 25 mM MgCl2 (Sibenzyme Llc., Russia), 1 pL 5mM of mix dNTPs (Medigen Llc., Russia), 1 pL of each 10 mM primer and 1 unit Taq DNA polymerase (Sibenzyme Llc., Russia) in the MyCyclerthermal cycler (Bio-Rad, USA) using protocol: 94.0 °C for 5 min. [94.0 °C for 30 sec., 56.0 °C for 30 sec., 72 °C for 1 min.]x35, 72.0 °C for 5 min., 4.0 °C until the end of the process. PCR products were then purified using spin column. Sequencing by Sanger was conducted in the Syntol LLc., Russia. The sequences of ITS (MG815133-MG815136) obtained in this study have been deposited in GenBank. Similarity checks were done at NCBI website.
For further analysis, sequences of ITS of closely related sequences were downloaded from NCBI. Alignment was done using Muscle, MEGA 7.0(Edgar, 2004). Phylogenetic analysis was done using Mr.Bayes3.2.6with 1000000 MCMC and 100000 Burn-in period (Huelsenbeck, Ronquist, 2001).
Results and discussion
Phylogenetic analysis using ITS region recovered the fungus in a good-supported (0.99 and higher) clade with isolates of Trichoderma asperellum SSBGT07 (KP747443.1), T harzianum SSBGT10 (MG372162), T longibranchiatum SSBGT09 (MG372138.1), and T. ghanense SSBGT08 (KP419976.1). The sequence of Protocrea farinosa (DQ835506.1) was used as outgroup (Fig. 1).
Fig. 1. Phylogenetic analysis based on ITS region of the Trichoderma isolates SSBGT07, SSBGT08, SSBGT09, SSBGT10.
The isolate showed a good growth rate on the PDA agar. Mature conidia were formed in 5-7 days after inoculation. For T. asperellum, we noted a high level of variability of colony morphology. T. asperellum, T. longibranchiatum, T. harzianum were characterized by rapid growth, hyper sporulation, covered the entire petri dish and stopped the development of Cladosporium sp. T. ghanense grew more slowly and less occupied the surface of the Petri dish, but it also had a hyper sporulation in places of conidia congestion of the Cladosporium sp.
Activity against Botrytis sp. for all isolates, was observed through the formation of an intermediate band without growth between colonies. The minimum activity and growth rate were observed in the T. ghanense. Maximum sporulation on sclerotia was observed for the T. longibranchiatum and T. harzianum. Furthermore, on day 12 after inoculation, T. harzianum showed growth and formation of conidia in the growth area of Botrytis sp. We also noted inhibition by T. harzianum of sclerotic formations of Botrytis sp. (Fig. 2).
Ukrainian Journal of Ecology
90
The use of Trichoderma has a high potential in plant protection. Several authors reported that the antagonistic fungi like Trichoderma harzianum, T. viride, and Gliocladium virensinhibited the growth of pathogens by mycoparasitism and antibiosis (Mukherjee et al., 2002; Zeilinger, Omann, 2007). Trichoderma as bio-agents suppressed colony growth of Fusarium oxysporum (Shahid et al., 2014).
Fig. 2. Antagonistic effect of Trichoderma species against Botrytis sp.: a. T asperellum; b. T. ghanense, c. T. iongibranchiatum, d. T harzianum. Antagonistic effect of Trichoderma species against Ciadosporium sp.: e. T asperellum, f. T ghanense, g. T iongibranchiatum, h. T. harzianum. Hyper sporulation by Trichoderma is seen on the colonies of Cladosporium sp. (especially on conidia congestion) and sclerotia of Botrytissp.
Another investigation revealed a high level of hyperparasitism of Trichoderma koningiopsisagainst Macrophominaphaseolina (Mendoza et al., 2015). T. hamatumand T. pseudokonigiishowed a very high antagonistic level against Aspergillusflavus(Thanh et al., 2014). According to some reports, Trichoderma is an antagonist of such species as the Botrytis cinerea, Penicillium crustosum, Alternaría alternata, Fusarium solani, and Aspergillus nidulans(Belete et al., 2015, Rios Velasco et al., 2016). The potential of various species of Trichoderma is expanding with new research. The high level of polymorphism of the Trichoderma species opens great opportunities to select strains with new characteristics, thus, expanding the possibilities of Trichoderma species as a bioagent.
References
Belete, E., Ayalew, A., Ahmed, S. (2015). Evaluation of local isolates of Trichoderma spp. against black root rot (Fusarium solani) on Faba bean. J. Plant Pathol. Microb, 6, 279. doi:10.4172/2157-7471.1000279
Druzhinina, I.S., Kopchinskiy, A.G., Kubicek, C.P. (2006). The first 100 Trichoderma species characterized by molecular data. Mycoscience, 47, 55-64. doi: 10.1007/s10267-006-0279-7
Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. NucleicAcids Res., 32(5), 1792-1797. doi: 10.1093/nar/gkh340
Hoseinzadeh, S., Shahabivand, S., Aliloo, A.A. (2017). Toxic metals accumulation in Trichoderma asperellum and T. harzianum. Microbiology, 86(6), 728-736. doi: 10.1134/S0026261717060066
Huelsenbeck, J.P., Ronquist, F. (2001). MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17(8), 754-755. doi: 10.1093/bioinformatics/17.8.754.
Mendoza, J.L., Pérez, M.I., Prieto, J.M., Velásquez, J.D., Olivares, J.G., Langarica, H.R. (2015). Antibiosis of Trichoderma spp. strains native to northeastern Mexico against the pathogenic fungus Macrophomina phaseolina. Brazilian Journal of Microbiology, 46(4), 1093-1101. doi: 10.1590/S1517-838246420120177.
Mukherjee, P.K., Verma, A., Latha, J. (2002). PCR fingerprinting of some Trichoderma isolates from two Indian type culture collection a need for re-identification of these economically importance fungi. Sci Corres., 83, 372-374.
Rios Velasco, C., Caro Cisneros, J.M., Berlanga Reyes, D.I., Ruiz Cisneros, M.F., Ornelas Paz, J.J., Salas Mari na, M.Á., Guerrero Prieto, V.M. (2016). Identification and antagonistic activity in vitro of Bacíllus spp. and Trichoderma spp. isolates against common phytopathogenic fungi. Rev. mexic. fitopatol., 34(1), 84-99. doi: 10.18781 /R.MEX.FIT.1507-1.
Saba, H., Vibhash, D., Manisha, M., Prashant, K.S., Farhan, H., Tauseef, A. (2012). Trichoderma - a promising plant growth stimulator and biocontrol agent, Mycosphere, 3(4), 55-64. doi: 10.5943/mycosphere/3/4/14.
Shahid, M., Srivastava, M., Singh, A., Kumar, V., Rastogi, S., Pathak, N., Srivastava, A.K. (2014). Comparative study of biological agents, Trichoderma harzianum(Th-Azad) and Trichoderma viride(01 PP) for controlling wilt disease in pigeon pea. J. Microb. Biochem. Technol., 6, 110-115. doi: 10.4172/1948-5948.1000130.
Sharma, B.L., Singh, S.P., Sharma, M.L. (2012). Bio-degradation of crop residues by Trichoderma species vis-a vis nutrient quality of the prepared compost. Sugar Tech, 14, 174-180. doi: 10.1007/s12355-011-0125-x.
Thanh, N.T., Nhung, H.T., Thuy, N.T., Lam, T.T., Giang, P.T., Lan, T.N., Viet N.V., Man V.T. (2014). The diversity and antagonistic ability of Trichoderma spp. on the Aspergillusflavus pathogen on peanuts in north center of Vietnam. World J. Agric. Res., 2(6), 291 -295. doi: 10.12691 /wjar-2-6-8.
White, T.J., Bruns, T., Lee, S., Taylor, J. (1990). Amplification and direct sequencing of fungi ribosomal RNA genes for phylogenetics. In M.A. Innis, D.H. Gelfand, J.J. Sninsky and T.J. White (Eds.), PCR Protocols. A Guide to Methods and Applications (pp. 315-322). San Diego: Academic Press.
Zeilinger, S., Omann, M. (2007). Trichoderma biocontrol: signal transduction pathways involved in host sensing and mycoparasitism. Gene Reg. Syst. Biol., 1, 227-234.
Citation:
Skaptsov, M., Smirnov, S., Kutsev, M., Uvarova, O., Sinitsyna, T., Shmakov, A., Matsura, A. (2018). Antifungal activity of several Isolates of Trichoderma against Cladosporlum and Botrytls. Ukrainian Journal of Ecology, 8( 1), 88-91. I This work Is licensed under a Creative Commons Attribution 4.0. License
