Научная статья на тему 'Сравнение частот встречаемости аллелей и генотипов полиморфного маркера G1846A гена CYP2D6 в трех этнических группах Чукотского АО'

Сравнение частот встречаемости аллелей и генотипов полиморфного маркера G1846A гена CYP2D6 в трех этнических группах Чукотского АО Текст научной статьи по специальности «Фундаментальная медицина»

CC BY
732
182
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Биомедицина
ВАК
RSCI
Ключевые слова
цитохром Р450 2D6 / фармакогенетика / cytochrome Р450 2D6 / CYP2D6 / G1846A / CYP2D6 / G1846A / pharmacogenetics

Аннотация научной статьи по фундаментальной медицине, автор научной работы — Казаков Р. Е., Игнатьев И. В., Коман И. Э., Сычев Д. А., Кукес В. Г.

Аллель 1846A гена CYP2D6 (CYP2D6*4) является фактором риска возникновения нежела тельных лекарственных реакций при применении лекарственных средств, являющихся суб стратами изофермента цитохрома Р450 2D6 (CYP2D6), включая в адреноблокаторы и пси хотропные препараты. Нами определены частоты встречаемости аллелей и генотипов по лиморфного маркера G1846A в трех этнических группах Чукотского АО: русских, чукчей и эвенов. Знание межэтнических различий клинически значимых аллельных вариантов, по мимо теоретического интереса, может применяться при разработке региональных реко мендаций по применению лекарственных средств.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по фундаментальной медицине , автор научной работы — Казаков Р. Е., Игнатьев И. В., Коман И. Э., Сычев Д. А., Кукес В. Г.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

COMPARISON OF OCCURENCES OF THE ALLELES AND GENOTYPES OF POLYMORPHOUS MARKER G1846A OF GENE CYP

Allele 1846A of gene CYP2D6 (CYP2D6*4) is a risk factor of the adverse drug reactions during application of the cytochrome Р450 isoform 2D6 (CYP2D6) substrata drugs, including adrenoblockers and psychotropic drugs. We have explored the allelic and genotype frequencies of the G1846A polymorphism in three ethnic groups of Chukotka – Russians, Chukchians and Evenians. Understanding the interethnic differences of clinically significant allelic variants can be used for working out regional drug references and for theoretical research.

Текст научной работы на тему «Сравнение частот встречаемости аллелей и генотипов полиморфного маркера G1846A гена CYP2D6 в трех этнических группах Чукотского АО»

___________

ГЕНЕТИКА

Сравнение частот встречаемости аллелей и генотипов полиморфного маркера G1846A гена CYP2D6 в трех этнических группах Чукотского АО

Р.Е. Казаков, И.В. Игнатьев, И.Э. Коман, Д.А. Сычев, В.Г. Кукес

Филиал «Клиническая фармакология» ГУНЦ БМТРАМН, Москва Институт клинической фармакологии ФГУНЦ ЭСМП Росздравнадзора, Москва

Аллель 1846А гена СУР206 (СУР206*4) является фактором риска возникновения нежелательных лекарственных реакций при применении лекарственных средств, являющихся субстратами изофермента цитохрома Р450 2D6 (CYP2D6), включая в-адреноблокаторы и психотропные препараты. Нами определены частоты встречаемости аллелей и генотипов полиморфного маркера 01846А в трех этнических группах Чукотского АО: русских, чукчей и эвенов. Знание межэтнических различий клинически значимых аллельных вариантов, помимо теоретического интереса, может применяться при разработке региональных рекомендаций по применению лекарственных средств.

Ключевые слова: цитохром Р450 2D6, СУР206, 01846А, фармакогенетика.

Изучение генетических особенностей человека, определяющих индивидуальный фармакологический ответ, является первостепенной задачей клинической фармакогенетики. Учет таких особенностей позволяет в ряде случаев индивидуализировано подойти к выбору лекарственных средств (ЛС) и режимов их дозирования, что способствует повышению эффективности и снижению риска развития нежелательных лекарственных реакций (НЛР). В первую очередь перспективными объектами исследования являются гены, контролирующие синтез и работу ферментов метаболизма ЛС, в частности изоферментов цитохрома Р450, и других ферментов I и II фаз биотрансформации [1, 2, 3, 4].

Изофермент 2D6 цитохрома Р450 (CYP2D6) участвует в метаболизме более 20% всех известных лекарственных средств, в том числе амитриптилина, амфетамина, кодеина, карведилола, фенацен-тина, галоперидола, метадона и других.

Субстратами CYP2D6 также являются многие психотропные ЛС, включая все трицик-лические антидепрессанты, некоторые нейролептики, опиаты, ряд ингибиторов обратного захвата серотонина [7].

Информация, полученная в ходе исследования этнических особенностей в распределении частот аллелей и генотипов клинически значимых полиморфных маркеров, имеет прогностическую ценность, является основой для разработки и внедрения алгоритмов назначения ЛС в соответствии с индивидуальным генотипом пациента, позволяет заранее оценить масштабы позитивного эффекта генетических тестов с учетом этнических особенностей населения регионов России.

В настоящей статье представлены результаты исследования частот встречаемости аллелей и генотипов полиморфного маркера G1846A гена CYP2D6 в трех этнических группах Чукотского АО: русских, чукчей и эвенов. Обнаруженные различия в

их распределении должны учитываться при разработке и внедрении в медицинскую практику фармакогенетических тестов.

Материал и методы

Генетическому обследованию было подвергнуто 262 человека, относящихся к трем этническим группам (83 чукчей, 53 эвена и 126 русских). Возраст испытуемых от 10 до 16 лет.

ДНК из крови выделяли стандартным фенольным методом с модификациями [8].

ПЦР проводили в термоциклере Терцик («ДНК-Технология», Россия) с использованием Taq-полимеразы («СибЭнзим», Россия) в буфере производителя. Подобранная эмпирически температура отжига составила 55°С; концентрация хлорида магния в амплификационной смеси — 2мМ. Дизайн праймеров проводился с использованием программы Windows 32 PrimerSelect 4.05©1993-2000 DNSTAR Inc.

Последовательность праймеров реакции:

C2D6-1-F1 3' CGGGAGACCAGGGGGAGCATAGG -5' C2D6-1-R1 3'- GACCGTTGGGGCGAAAGGGGGGT-5'

Идентификация аллелей осуществлялась методом ПЦР-ПДРФ (полимеразная цепная реакция — полиморфизм длин рестрикционных фрагментов). Амплифици-рованный фрагмент ДНК длиной 358 пар нуклеотидов затем подвергался рестрикции (рестриктаза PspN4I, «СибЭнзим», Россия) в течение ночи при температуре 37°С в буфере производителя. Сайт узнавания рест-риктазы — GGNANCC. При расщеплении аллеля G образовывались фрагменты длиной 116, 220 и 22 п.н. соответственно. В случае аллеля А присутствовали только фрагменты 116 и 243 п.н. Результаты рестрикции анализировали с помощью электрофореза в 8%-ном полиакриламидном геле. Визуализацию результатов проводили в ультрафиолетовом свете (312 нм) после окрашивания раствором бромистого этидия.

Результаты и обсуждение

Результаты измерения частот встречаемости аллеля 1846А гена CYP2D6 трех этнических групп Чукотского АО приведены на рис. 1.

Русские Чукчи Эвены

р = 0,020 р = 0,803

р = 0,013

Рис. 1. Сравнение частот встречаемости аллеля 1846А гена СУР206 (СУР206М) в трех этнических группах Чукотского АО

У русских среди 252 проанализированных аллелей полиморфного маркера G1846Л гена CYP2D6 частота встречаемости аллеля 1846А составляла 15%, а частота встречаемости аллеля 1846G, соответственно, 85%. У чукчей из 166 аллелей частота встречаемости аллеля 1846А была 7%, (1846G — 93%). У эвенов среди 106 аллелей частота встречаемости аллеля 1846А была 6%, (1846G — 94%).

Нами установлено, что частота встречаемости аллеля 1846А достоверно различается у русских, проживающих в Чукотском АО, и у представителей коренного населения региона (чукчей и эвенов; р = 0,020 и р = 0,013, соответственно). Частоты встречаемости аллеля 1846А у чукчей и эвенов достоверно не различаются (р = 0,803).

На рис. 2 представлено распределение генотипов трех этнических выборок. Видно, что по распределению генотипов чукчи и эвены также не имеют существенных отличий друг от друга: носителями генотипа 1846GG были 86% чукчей и 89% эвенов, носителями гетерозиготного генотипа 1846GА были 14% чукчей и 11% эвенов. В группе

н

11

ІІШ 11 .

Русские Чукчи Эвены

(п = 126) (п = 83) (п = 53)

ШШШ Генотип 1846И5 К\\\\М Генотип 1846ЄА ■ Генотип 1846АА

Рис. 2. Сравнение частот встречаемости генотипов полиморфного маркера 01846Л гена СУР206 в трех этнических группах Чукотского АО

русских, имеющих, как сказано выше, достоверно большую частоту аллеля 1846А, реже встречается генотип 184600 — у 71% лиц, и чаще встречается генотип 18460А — у 29% лиц. Редкий генотип 1846АА, не обнаруженный у чукчей и эвенов, был встречен, в единственном числе, в выборке русских и поэтому не рассматривается при анализе. Распределение генотипов достоверно не отличалось от соотношения Харди-Вайнберга.

К настоящему моменту в литературе описано более 70 аллелей и аллельных вариантов1 гена СУР2Б6 [5]. Известно, что нуклеотидная замена 18460>А на границе третьего интрона и четвертого экзона гена СУР2Б6 приводит к нарушению сплайсинга и, как следствие, к образованию в мРНК одноосновной делеции [10]. Такая делеция вызывает сдвиг рамки считывания, в результате чего образуется усеченный фермент, не обладающий активностью [11]. Поэтому гомозиготы 1846АА ха-

1 В литературе в последнее время принято комбинацию аллелей называть «гаплотип»; мы считаем, что это неверно, поскольку гаплотипом можно называть только такие комбинации аллелей, которые наследуются сцеплено, большинство же авторов, использующих данный термин, вообще не рассматривают факт сцепления, поэтому мы используем более корректный термин «аллельный вариант».

рактеризуются сниженной интенсивностью метаболизма ЛС-субстратов CYP2D6 и относятся по фенотипу к группе «медленных» метаболизаторов (poor metabo-lizers, РМ) [9, 12]. У этой категории пациентов повышен риск возникновения НЛР при применении ЛС, являющихся субстратами CYP2D6, и они нуждаются в снижении доз данных ЛС (см. табл.).

Сложнее обстоит дело с гетерозиготами 1846AG, так как их фенотип зависит от второго функционального аллеля. Если второй аллель кодирует полностью функциональный фермент, то у таких лиц обнаруживается нормальная ферментативная активность, и они относятся к фенотипической группе ЕМ (extensive metabolizers). В случае, если второй аллель кодирует фермент, обладающий сниженной активностью, то у таких лиц также могут развиваться НЛР при приеме ЛС — субстратов CYP2D6. Они относятся к фенотипической группе IM (intermediate metabolizers) [12].

Так как, по нашим данным, среди населения Чукотского АО присутствуют носители аллеля 1846А как среди русского населения, так и среди коренного населения, представляется целесообразным разработка и внедрение в регионе определения генотипа CYP2D6 для индивидуализации применения ЛС-субстратов CYP2D6. Кроме того, информация о выявленных межэтнических различиях в частотах встречаемости аллелей и генотипов полиморфного маркера G1846A гена CYP2D6, должна быть учтена при разработке регионального формуляра по применению ЛС. Из-за того, что генотип 1846АА, предполагающий отсутствие ферментативной активности цитохрома CYP2D6, встречается редко, особенно у коренного населения, а у гетерозигот активность фермента определяется вторым нормально функционирующим аллелем, то для предсказания фенотипической группы необходимо определять и учитывать влияние других клинически значимых полиморфных маркеров в комплексе.

Нежелательные лекарственные реакции, риск которых повышен у «медленных» метаболизаторов по CYP2D6

Лекарственные средства - субстраты СУР2Э6 Нежелательные лекарственные реакции

Метопролол Бронхоспазм,гипотония, брадикардия, AV-блокада, асистолия

Тимолол (внутриглазное применение) Системные нежелательные реакции: брадикардия, гипотония, AV-блокада

Дилтиазем Брадикардия

Флекаинид Желудочковые тахиаритмии

Пропафенон Нейротоксичность, бронхоспазм

Фенформин Молочнокислый ацидоз

Пропафенон Нейротоксичность

Тиоридазин Желудочковая тахикардия по типу «пируэт»

Нортриптилин и другие трициклические антидепрессанты Гипотония, ажитация, сонливость

Флувоксамин Гастроинтестинальные нежелательные реакции

Галоперидол Экстрапирамидные расстройства

Дексфенфлурамин Тошнота, рвота, головная боль

Симвастатин Повышение уровня трансаминаз, миалгии

Пергексилина малеат Гепатотоксичность

Метоклопрамид Экстрапирамидные расстройства

3,4-метилендиоксиметамфетамин (экстази) Повышение токсичности: нейротоксичность, гепертермии, гиперпролактинемии и др.

Известно, что частота встречаемости аллеля 1846А (СУР2Б6*4) варьирует у разных рас и этносов. У европеоидов она изменяется от 11,6 до 20,7% [6]. В наших исследованиях частота встречаемости аллеля 1846А у русских (15%) согласуется с литературными данными для европеоидной расы. У азиатской расы данный аллель встречается с меньшей частотой: 0,5% у японцев, 1,2% у китайцев, 2,8% у малайцев [6]. Определенная нами частота встречаемости аллеля 1846А у чукчей и эвенов (7 и 6%) существенно превышает значения, характерные для большинства азиатских народов. Интересно, что близкие значения частоты встречаемости аллеля 1846А были обнаружены у инуитов Канады (7,5%) [6].

Выводы

Нами определены частоты встречаемости аллелей и генотипов полиморфного маркера 01846Л в трех этнических группах

Чукотского АО: русских, чукчей и эвенов. Частота встречаемости клинически значимого аллеля 1846Л у двух народов — представителей коренного населения Чукотского АО (чукчей и эвенов), не имела достоверных различий и составляла 7 и 8% соответственно. Частота встречаемости данного аллеля у русских (15%), проживающих в том же регионе, достоверно выше, чем у представителей коренного населения Чукотского АО. В соответствии с этим, в группе русских чаще, чем у представителей коренного населения Чукотского АО, встречается генотип 18460А и реже — генотип 184600.

Наличие функционально-дефектного аллеля 1846Л у населения Чукотского АО является предпосылкой для практического применения в регионе фармакогенети-ческих тестов, основанных на определении аллельных вариантов клинически значимых полиморфных маркеров, в том числе

и маркера G1846A. Данные тестов позволят осуществлять выбор режима дозирования ЛС — субстратов цитохрома CYP2D6.

Частота аллеля 1846А чукчей и эвенов сильно отличается от частот, характерных для представителей большинства монголоидных народов, населяющих Азию, и близка к значениям, обнаруженным у инуитов Канады.

Литература

1. Кукес B.r. Метаболизм лекарственных средств: клинико-фармакологические аспекты. — М., 2004.

2. Кукес B.r., Дрожжин А.П., Сычев Д.А. Основы клинической фармакогенетики // В кн. Молекулярная медицина, под ред. Пальцева М.А. — М., 2004.

3. Ляхович B.B., Bавuлuн B.А., Гришанова А.Ю. и др. Фармакогенетика и современная медицина // Bестнuк РАМН, М 3, с. 40-45, 2004.

4. Середенин С.Б. Лекции по фармакогенетике. — М., 2004.

5. Bertilsson L., DahlM-L., Dalen P. et al. Molecular genetics of CYP2D6: clinical relevance with focus on psychotropic drugs // Br. J. Clin. Pharmacol., 53, 111-122, 2002.

6. Bradford L.D. CYP2D6 allele frequency in European Caucasians, Asians, Africans and their descendants // Pharmacogenomics., 3(2), 229-243, 2002.

7. Brosen K. Differences in interactions of SSRIs // Int. Clin. Psychopharmacol., 13 Suppl., 5., 4547,1998.

8. Budowle B., Baechtel F.S. Modifications to improve the effectiveness of restriction fragment length polymorphism // Appl. Electrophor., 1, 181-187, 1990.

9. Chou W-H., Yan F-X, Robbins-Weilert D.K Comparison of two CYP2D6 genotyping methods and assessment of genotype-phenotype relationships // Clinical. Chemistry, 49(4), 542551, 2003.

10. Gough A.C., Miles J.S., Spurr N.K. et al. Identification of the primary gene defect at the cytochrome P450 CYP2D locus // Nature, 347(6295), 773-776,1990.

11. Hanioka N., Kimura S., Meyer U.A. et al. The human CYP2D locus associated with a common genetic defect in drug oxidation: a G1934A base change in intron 3 of a mutant CYP2D6 allele results in an aberrant 3' splice recognition site / / Am. J. Hum. Genet, 47(6), 994-1001, 1990.

12. Zanger U.M., Raimundo S., Eichelbaum M. Cytochrome P450 2D6: overview and update on pharmacology, genetics, biochemistry // Naunyn-SchmiedebergTsArch. Pharmacol., 369, 23-37, 2004.

COMPARISON OF OCCURENCES OF THE ALLELES AND GENOTYPES OF POLYMORPHOUS MARKER G1846A OF GENE CYP2D6 IN THREE ETHNIC

GROUPS OF CHUKOTKA

R.E.Kazakov, I.V.Ignatiev, I.E.Koman, D.A.Sychev, V.G.Kukes

Branch « Clinical Pharmacology » SC BMTRussian Academy of Medical Science,

Institute of Clinical Pharmacology FGU«NC ESMP»

Allele 1846A of gene CYP2D6 (CYP2D6*4) is a risk factor of the adverse drug reactions during application of the cytochrome P450 isoform 2D6 (CYP2D6) substrata drugs, including adrenoblockers and psychotropic drugs. We have explored the allelic and genotype frequencies of the G1846A polymorphism in three ethnic groups of Chukotka - Russians, Chukchians and Evenians. Understanding the interethnic differences of clinically significant allelic variants can be used for working out regional drug references and for theoretical research.

Key words: cytochrome P450 2D6, CYP2D6, G1846A, pharmacogenetics.

i Надоели баннеры? Вы всегда можете отключить рекламу.