CC BY
0Sero-Virological studies on Newcastle Disease and Avian Influenza in Farmed Ostriches (Struthio camelus) in Saudi Arabia
Salah Shaban Abdelrhman*1'4., Ehab Abd-ELsabour M. Rihan2'5., , Hany M. Almotairy3., Ali H. Al
Jassem1 and M. H. Al-Blowi1.
'Animal Resources Adm., Ministry of Agriculture 11195, Riyadh, Kingdom of Saudi Arabia 2 Veterinary Diagnostic Laboratory, Ministry of Agriculture, Riyadh ''454, Saudi Arabia 3King AbdelAziz City for Science and Technology, Riyadh, Saudi Arabia 4Veterinary Serum and Vaccine Research Institute, Cairo, Egypt 5Animal Health Research Institute, Dokki-Giza-Egypt
Corresponding author's email: salahvirol@yahoo.com ABSTRACT
Two hundred and sixteen samples (80 Tracheal swabs and 136 blood serum) were collected from four commercial ostrich farms in the Kingdom of Saudi Arabia for isolation of Newcastle disease (ND) and Avian Influenza (AI) viruses or detection of their antigens and antibodies by RT-PCR and Enzyme Linked Immune Sorbant Assay (ELISA) respectively. Neither AI and ND viruses nor their antigens were isolated or detected in any of the collected swabs samples. Also, Antibodies to avian influenza virus were not detected in the collected serum samples. Antibodies to ND virus were detected in 0.0%, 80.0%, 74.1%, and 80.0% in serum samples from farms 1, 2, 3 and 4, respectively. Mean ND ELISA antibody titer were 0.0, 646.3, 1068.5 and 1440.5 in farms 1, 2, 3 and 4, respectively. Ostriches vaccinated with live ND vaccine by drinking water were negative for ND antibodies, while ostriches vaccinated with live ND vaccine by spray method and boosted by inactivated oil emulsion ND vaccine gave the highest immune response. Ostriches vaccinated with inactivated oil emulsion ND vaccine (4x chicken dose/ostrich) elicited effective immune response and transferred maternal antibodies to ostrich chicks at the rate of 85.7% and 66.7% with mean ELISA antibody titer of 1450.5 and 1350.15 at 7 and 21 day old, respectively. Key words: Avian Influenza, ELISA, Newcastle disease, ostrich, RT-PCR, Saudi Arabia.
INTRODUCTION
Newcastle Disease (ND) and Avian Influenza (AI) are among the most economic important viral diseases threatening ostrich industry worldwide. Newcastle Disease Virus (NDV) is an enveloped virus;
samples of ostriches that died following nervous signs (Ghiamirad et al., 2010).
Worldwide many subtypes of Influenza Viruses were recorded in ostriches. First isolation of AI in
has a negative sense single strand RNA genome caused by Avian paramyxovirus type1 which is classified with the other avian paramyxoviruses in the genus Avulavirus, subfamily Paramyxovirinae, family Paramyxoviridae, order Monanegavirals (Lamb et al., 2005). Newcastle Disease was first described in commercial ostrich flock aged 5 to 9 months with a mortality rate of 28% in Israel (Samberg et al., 1989). Cadman et al., (1994) carried out a serological survey of nine ostrich farms in Zimbabwe and reported that 23% of the birds tested were positive for ND virus antibodies. The disease was described in ostrich chicks with facial edema and consistent nervous signs in the Republic of South Africa (RSA) (Huchzermeyer, 1996). Virulent NDV was isolated from ostriches dying while held in quarantine in Denmark (Jorgensen et al., 1998). Recently, NDV was first reported in the Iranian commercial ostrich farms by isolation from 4 brain
ostrich was reported in RSA from one month old ostrich showing 80% mortality; the subtype of the isolated virus was Low Pathogenic Avian Influenza (LPAI) H7N1 (Allwright et al., 1993). Other LPAI (i.e., H9N2, H6N8 and H5N9) infection in ostriches were reported in RSA (Manvell et al., 1998, Abolnik et al., 2010). Highly Pathogenic Avian Influenza (HPAI) (e.g., H5N2 subtypes) was also reported in ostriches in USA (Panigrahy et -al., 1995) and HPAI H7N1 in Italy (Capua et al., 2000). First HPAI (H5N1) in commercial ostriches was reported in Saudi Arabia in 2007 (Lu et al., 2010) in an outbreak where 13460 ostriches were culled.
There is little information about infectious diseases in commercial ostrich farms in Saudi Arabia. Since ostrich (Struthio camelus) are kept in free range farms, they may come in contact with wild birds and become exposed to different pathogens such as NDV
To cite this papery Abdelrhman SS, M. Rihan E A-E, , M. Almotairy H, H. Al Jassem A and Al-Blowi MH.. 2013. Sero-Virological studies on Newcastle Disease and Avian Influenza in farmed ostriches (Struthio camelus) in Saudi Arabia. J. World's Poult. Res. 3(2): 38-42. Journal homepage: http://jwpr.science-line.com/
and avian influenza virus. The aim of the present study is to conduct a sero-virological investigation on the current situation of avian influenza and ND in commercial farmed ostriches in Saudi Arabia.
MATERIALS AND METHODS
Samples
One hundred and thirty-six blood serum and 80 tracheal swab samples were collected between September 2011 to November 2012 from four ostrich farms located in Central, North and West regions in Saudi Arabia (Table 1).
Enzyme-Linked Immunosorbent Assay (ELISA)
ELISA test was performed using IDEXX Flock Check (ND and AI viruses antibody test kits).
The test procedure was in accordance with IDEXX Flock Check Manual instructions.
Virus Isolation
Virus Isolation was done by inoculation of 0.2 ml swab supernatant into the allantoic cavity of 9-11 days old embryonated SPF eggs (Alexander and Senne., 2008, Allwright et al., 1993) and the eggs were candled daily for 4 days. All eggs with dead embryos were chilled while with surviving embryos were chilled on day 6. Harvested allantoic fluid was tested for Haemagglutination (HA) activity.
PCR
• RNA extraction and first-strand cDNA
Viral RNA was extracted from tracheal swabs using QIAamp® Viral RNA Mini Kit (50) Isolation kit QIAGEN®GmbH). Then Reverse transcription to the extracted RNA using Transcriptor® First Strand cDNA Synthesis Kit (Roche® Version 6.0) was performed according to Manufacturer' instructions.
• Realtime-RTPCR for detection of AIV:
Primers; LightMix® KIT Inf A M2 primer (Cat.
No. 40-0234-16) labeled with flourescein probe
containing internal positive control (IPC) and positive control for AIV M2 gene (synthetic oligonucleotides) (TIB MOLBIOL Syntheselabor GmbH).
• A LightCycler® FastStart DNA Master plus HybProbe KIT (Roche) and Light Cycler® 2.0 device were utilized for real-time PCR using 5 pl of the cDNA in a total volume of 20 pl. The temperature profile was used as follows: 10 min at 95 °C, and 50 cycles of 5s at 95 °C, 5s at 62 °C, and 15s at 72 °C. Fluoro phore-specific emission data were collected during the annealing step. Crossing point (Cp) values were calculated with LightCycler 3.5 software using the second derivative maximum method.
• One Step RealTime RT-PCR for NDV detection: Primers;
APMV-1 - F M + 4100 5_-AGTGATGTGCTCGGACCTTC-3_; APMV-1-R M-4220- 5_-CCTGAGGAGAGGCATTTGCTA-3_ and APMV-1 Probe- 4169
5_FAM]TTCTCTAGCAGTGGGACAGCCTGC[TAMRA]3(Biosear chtech.,INC.Novato,CA) For the RRT-PCR, the Qiagen® one-step RT-PCR kit and LightCycler® 2.0 device, 20ul reaction volumes were used. Extensive optimization was performed on all three primer-probe sets on the following parameters: annealing temperature, MgCl2 concentration, primer concentration, probe concentration, and primer ratios. The assays for M gene were developed with the following amounts per reaction; 5ul of the extracted RNA template, 0.5 ul of kit-supplied enzyme mix (including Hot Start Taq polymerase and RT), 4ul of kit-supplied buffer (5x),10 pmol of the reverse primer, 10pmol of the forward primer, 6 pmol of probe, 0.8 ul of kit-supplied deoxynucleoside triphosphates (final concentration: 320 mM each), 1ul of 25 mM MgCl2 (combined with MgCl2 in kit-supplied buffer, final concentration 3.70 mM) and 13 U of RNase inhibitor (Promega, Madison, Wis.). For each primer set, the RT step was 30 min at 50°C, followed by 15 min at 95°C. The cycling conditions for the APMV-1 matrix primers consisted of 40 cycles of 10 s of denaturation at 94°C, 30 s of annealing at 52°C, and extension at 72°C for 10s (Wise et al., 2004).
Table 1. serum and tracheal swabs samples from ostrich farms
Sample
Farm No. Serum Swabs
7 days 21 days 6 month
Breeders Tracheal
1 NA1 NA NA 20 20
2 10 10 10 NA 20
3 14 12 10 20 20
4 NA NA 10 20 20
'NA: Not Available
RESULTS AND DISCUSSION
Ostrich farming is considered a new industry compared with the highly advanced and modernized poultry industry established in Saudi Arabia many years ago.
Saudi Arabia is considered NDV endemic country in its commercial poultry sector. Moreover
HPAI (H5N1) was previously reported in poultry and ostrich farms in Saudi Arabia in 2007. The present study aimed to evaluate the current situation of both diseases in commercial ostrich farms in Saudi Arabia.
The obtained results revealed that, Neither AI and ND viruses nor their antigens were isolated in embryonated chicken eggs or detected by RT-PCR in any of the 80 collected swab samples.
Abdelrhman SS, M. Rihan E A-E, , M. Almotairy H, H. Al Jassem A and Al-Blowi MH.. 2013. Sero-Virological studies on Newcastle Disease and Avian
Influenza in farmed ostriches (Struthio camelus) in Saudi Arabia. J. World's Poult. Res. 3(2): 38-42. junaQQSmSaiSB http://jwpr.science-line.com/
As previously reported, there is a conflict on the suitable serological test for detection of antibodies against avian influenza in ostrich sera. Williams et al. (1997) reported that ostrich sera are highly cross reactive when tested with Haemagglutination Inhibition test (HI) for the presence of non specific inhibitors of haemagglutinin resulting in a high number of false positive results. The study by Toffan et al. (2010) that evaluated the best serological test for detection of antibodies against avian influenza in ostrich sera concluded that validated ELISA is considered suitable
test for screening purpose and should be preferred to Agar Gel Immune Diffusion test (AGID).
In the present study, ELISA seemed to be the best screening method to detect avian influenza and ND antibodies in ostrich sera. The obtained results showed that all tested sera were negative for avian influenza antibodies, which revealed that ostrich farms in Saudi Arabia are considered free from avian influenza.
All farms included in the present study practiced vaccination against ND, but the vaccination regimen (Method and dose) varied between farms (Table 2).
Table 2. Vaccination programme applied in the four ostrich farms
Farm Age Type of vaccine Dose Method of administration
1 15 day old Hitchner live 1Xchicken dose/ostrich Drinking water
3 month Lasota live
7 day old Lasota live Eye drop
2 30 day old Inactivated oil emulsion ND 1Xchicken dose/ostrich Intramuscular
15 day old Inactivated oil emulsion 1ml/ostrich
3month ND Intramuscular
3 Breeder Inactivated oil emulsion 2ml/ostrich
(ND) (4x chicken dose)
1 day old (ND+IB) Live 1Xchicken dose/ostrich Spray
21 day old Inactivated oil emulsion 0.3ml/2kg
4 3 month ND 0.3ml/2kg
6 month Inactivated oil emulsion (ND+IB) 2.5ml/10kg Intramuscular
breeder 8ml/1bird (16x chicken dose)
'NA: Not Available; ND: Newcastle Disease; IB: Infectious Bronchitis
Table 3. Positive ND antibodies in serum samples from ostrich
Farm No. Growing Breeders Mean positive %
7days | 21days | 6 month
1 NA1 0.0% 0.0
2 0.0% 80.0% 0.0% NA 80.0
3 85.7% 66.7% 0.0% 70.0% 74.1
4 NA 0.0% 80.0% 80
1NA: Not Available
Table 4. ND HI titer at different age of the four ostrich farms
Farm A ge
7 | 21 6 Month Breeder
1 Mean NA1 0.0%
2 Mean 0.0% 646.3 0.0% NA*
3 Mean 1452.2 1350.15 0.0% 1068.5
4 Mean NA 0.0% 1440.5
1NA: Not Available
In the first farm, ostriches that were vaccinated with Hitchner and La Sota live vaccines (1x chicken dose/ostrich by drinking water) did not elicit antibodies in any of tested sera, This result in consistent with result obtained by (Sakai et al., 2006) who found that only 9 from 30 tested serum samples from ostrich immunized 3 times at 2 weeks intervals with live ND vaccine by drinking water tested positive.
In the second farm, young ostriches were primed at 7 day of age with (1x chicken dose/ostrich live La Sota vaccine by eye drop and boosted at 30 days old by Inactivated ND vaccine 1x chicken dose/ostrich by intramuscular route. In this regimen, ND antibodies
were found in 0.0%, 80% and 80% of tested sera at 7, 21 days and 6 months of age, respectively (Table 3). This finding revealed that live la Sota vaccine elicit immune response when given by eye drop at a dose of 1x chicken dose/ostrich at 7 days of age. This finding is in disagreement with the results obtained by Blignaut et al. (2000) who reported that immunization by eye drop with a live La Sota vaccine in 5 weeks old ostriches did not elicit a humoral immune response.
In both third and fourth farms, we noticed that, Vaccination regimens for ND depends mainly on inactivated oil emulsion vaccines with gradual increase in vaccination doses/ostrich by age. In farm 3
nasnataipiiri Abdelrhman SS, M. Rihan E A-E, , M. Almotairy H, H. Al Jassem A and Al-Blowi MH.. 2013. Sero-Virological studies on Newcastle Disease and Avian Influenza in farmed ostriches (Struthio camelus) in Saudi Arabia. J. World's Poult. Res. 3(2): 38-42. EHaiBgpia http://jwpr.science-line.com/
vaccination regimen started with double chicken dose/ostrich at 15 day old, then the dose increased to reach 4x chicken dose/ostrich for older birds. Whereas in farm 4, ND vaccination dose reached 16x chicken dose/breeder ostrich (8ml/ostrich).
The positive tested breeder sera from farms 3 and 4 were 70% and 80%, respectively (Table 3). The higher percentage of positive samples in farm 4 agreed with Maderios (1997) who recommended gradual increase in ND oil emulsion vaccine starting with 2x chicken doses at 2 weeks old and thereafter increasing gradually by age until reaching 10x chicken dose/ostrich at 12 months of age.
The mean ND ELISA antibody titer were 0.0%, 646.3,1068.5 and 1440.5 in farms 1, 2, 3 and 4, respectively (Table 4). This finding revealed that higher dose in farm 4 gave the highest antibody titer while vaccination with eye drop 1x chicken dose/ostrich gave the lowest titer.
Maternally derived antibodies (MDAbs) against ND were not detected in any of the tested sera collected from farm 2, whereas in farm 3 MDAbs were detected in 85.7% and 66.7% of the tested sera in 7 and 21 day old ostriches with mean ELISA titer of 1450.5 and 1350.15, respectively (Table 3). This finding revealed that the vaccination regimen using 4x chicken dose /ostrich is effective to induce maternally derived antibodies in ostrich chicks.
The present results revealed that ostrich farms in Saudi Arabia are considered free from avian influenza. Live ND Vaccines administered through drinking water failed to produce immune response, while vaccination by spray method and boosted by inactivated vaccine appeared to be effective to induce immune response with maternal derived antibodies in ostrich chicks. The antibody titer is correlated with the dose of inactivated vaccine.
REFERENCES
Abolnik C., Gerdes G. H., Sinclair M., Ganzevoort B.W., Kitching J. P. (2010). Phylogenetic analysis of influenza A viruses (H6N8, H1N8, H4N2, H9N2, H10N7) isolated from wild birds, ducks, and ostriches in South Africa from 2007 to 2009. Avian Dis. 54(sl): 313-322. Alexander D.J. & Senne D.A. (2008). Newcastle Disease and Other Avian Paramyxoviruses. In: A Laboratory Manual for the Isolation, Identification and Characterization of Avian Pathogens, Dufour-Zavala L. Swayne D.E., Glisson J.R., Jackwood M.W., Pearson J.E., Reed W.M, Woolcock P.R., 4th ed., Am. Asso. of Avian Pathologists, Athens, GA, 135-141. Allwright D.M., Burger W.P., Geyer A. and Tarblanche A.W. (1993). Isolation of avian influenza-A virus from ostriches (Struthio camelus). Avian Pathology 22: 59 - 65. Blignaut A, Burger WP, Morley A.J., Bellstedt D.U. (2000). Antibody responses to La Sota strain vaccines of Newcastle disease virus in ostriches (Struthio camelus) as detected by enzyme-linked
immunosorbent assay. Avian Dis. 44(2):390-8.
Cadman H.F., Kelly P.J., Zhou R., Davelaar F. and Mason P.R. (1994). A serosurvey using enzyme-linked immunosorbent assay for antibodies against poultry pathogens in ostriches (Struthio camelus) from Zimbabwe. Avian Diseases, 38, 621- 625.
Capua I., Mutinelli F., Bozza, M.A., Terregino C., and Cattoli G. (2000). Highly pathogenic avian influenza (H7N1), in ostriches (Struthio camelus). Avian Pathology, 29 (6): 643 - 646.
Ghiamirad M, A. Pourbakhsh, H. Keyvanfar, R. Momayaz, S. Charkhkar and A. Ashtari (2010): Isolation and characterization of Newcastle disease virus from ostriches in Iran, African Journal of Microbiology Research, 4(23), pp. 2492-2497.
Jorgensen P.H., Lomniczi B., Manvell R.J., Holm E. and Alexander D.J. (1998). Isolation of avian paramyxovirus type 1 (Newcastle disease) viruses from a flock of ostriches and emus in Europe with inconsistent serology. Avian Pathology, 27, 352- 358.
Huchzermeyer F.W. (1996). Velogenic Newcastle disease in ostriches in South Africa. Proc. of Improving our Understanding of Ratites in a Farming Environment (p. 44). Oxford, UK.
Lamb R.A., Collins P.L., Kolakofsky D., Melero J.A., Nagai Y., Oldstone B.A., Pringle C.R., Rima K. (2005). Family paramyxoviridae In Fauquet CM, Mayo MA, Maniloff J, Dessel breger U, Ball LA virus Taxonomy, Eighth report of the International committee on Taxonomy of viruses Elsevier Academic press: San Diego, pp. 655668.
Lu. Huaguang., M. M. Ismail, Owais A. Khan, Yousef Al Hammad, Salah Shaban Abdel Rhman, and Mohamed Hamad Al-Blowi (2010). Epidemic Outbreaks, Diagnostics, and Control Measures of the H5N1 Highly Pathogenic Avian Influenza in the Kingdom of Saudi Arabia, 2007-08. Avian disease 54:350-356.
Madeiros, C. (1997). Vaccination of ostriches against Newcastle disease. Veterinary Record 140: 188.
Manvell R.J., Jorgensen P.H., Nielsen O.L. and Alexander D.J.(1998). Experimental assessment of the pathogenicity of two avian influenza A H5 viruses in ostrich chicks (Struthio camelus) and chickens. Avian Pathology, 27, 400_404.
Panigrahy B., Senne D.A., and Pearson J.E. (1995). Presence of Avian influenza virus (AIV) subtypes H5N2 and H7N1 in emus (Dromaius novaehollandiae) and rheas (Rhea americana): Virus isolation and serologic findings. Avian Diseases; 39, 64-67.
Sakai K., Kaori Yada., Sakabe G., Orie Tani, Kazuki M., M. Nakamura and Kazuaki Takehera (2006). Serological and virological studies of Newcastle disease and Avian Influenza in slaughter- age ostriches in Japan. J. Vet. Med. Sci. 68 (5): 491494.
Samberg Y., Hadash D. U., Perelman B and Meroz,
naSHtMBipiiri Abdelrhman SS, M. Rihan E A-E, , M. Almotairy H, H. Al Jassem A and Al-Blowi MH.. 2013. Sero-Virological studies on Newcastle Disease and Avian Influenza in farmed ostriches (Struthio camelus) in Saudi Arabia. J. World's Poult. Res. 3(2): 38-42. EHaiBgpia http://jwpr.science-line.com/
M.(1989) 'Newcastle disease in ostriches: Field case and experimental infection, Avian Pathology, 18: 2, 221 — 226.
Toffan A., Adriaas Oliver, Marizia Mancin, Valentina Tuttoilmondo, Danile Fucco, Capua I. and Calogero Terregino. (2010) Evaluation of different serological test for the detection of antibodies against highly pathogenic Avian Influenza in experimentally infected ostrich (Struthio camelus). Avian pathology 39(10): 1115.
Williams R., Boshoff C.H., Verwoerd D., Schoeman
M., Wyk A.V., Gerdes T.H. & Ross, K. (1997). Detection of antibodies to Newcastle disease virus in ostriches (Struthio camelus) by an indirect ELISA. Avian Diseases, 41, 864_869. Wise Mark. G, D. L. Suarez, Bruce S. Seal, J. C. Pedersen, Dennis A. Senne, Daniel J. King, D. R. Kapczynski, and Erica Spackman1(2004): Development of a Real-Time Reverse-Transcription PCR for Detection of Newcastle Disease Virus RNA In Clinical Samples. Journal Of Clinical Microbiology, 42 (1) 329-338
Abdelrhman SS, M. Rihan E A-E, , M. Almotairy H, H. Al Jassem A and Al-Blowi MH.. 2013. Sero-Virological studies on Newcastle Disease and Avian Influenza in farmed ostriches (Struthio camelus) in Saudi Arabia. J. World's Poult. Res. 3(2): 38-42. BSMBWgl http://jwpr.science-line.com/
