CC BY
22020, Scienceline Publication
World's Veterinary Journal
World Vet J, 10(3): 380-390, September 25, 2020
DOI: https://dx.doi.org/10.36380/scil.2020.wvj47
Sequencing of bcfC Gene of Salmonella Typhimurium Isolated from Ducks in Egypt
Abeer S. El-Maghraby1*, Abeer Mwafy2, and Hala El-Sawy Ahmed El- Sawy3
'Central Laboratory for Evaluation of Veterinary Biologies (CLEVB), Agriculture Research Centre (ARC), Egypt 2Department of Microbiology, Faculty of Veterinary Medicine, New Valley University, Egypt Veterinary Serum and Vaccine Research Institute (VSVRI), Agriculture Research Centre (ARC), Egypt
Corresponding author's Email: [email protected]; : 0000-0002-4217-0206
ABSTRACT
The main objective of this study was to applying bcfC gene sequence of Salmonella Typhimurium recently isolated from ducks to give insight into the source and origin, molecular epidemiology, disease pattern of Salmonella Typhimurium in Egyptian duck farms. Out of 75 fecal swab samples, 15 (20%) local field isolates were detected and confirmed phenotypically by culturing, gram staining, biochemically and serologically to be Salmonella Typhimurium. The PCR amplification with bcfC gene-specific primers was conducted with genomic DNA, which revealed a product with the approximate size of 467 bp. TheBcfC gene was found in 7 (46.6%) isolates of Salmonella Typhimurium. Phylogenetic and partial gene sequence analysis of bcfC gene of Salmonella Typhimurium showed clear clustering of Egyptian isolates of Salmonella Typhimurium and different Salmonella strains uploaded from GenBank. Sequence identities between the isolated Egyptian strain and different Salmonella Typhimurium strains from GenBank revealed 99.8-100% homology. Open reading frame (ORF) analysis of Salmonella typhimurium bcfC gene using NCBI tool and ORF analysis of bcfC gene protein translation using ExPasy (SIB Bioinformatics Resource Portal) indicated all open reading frames of a specified minimum size in a sequence of (453 bp). The 3 conserved domains region in the nucleotide sequence were PapC N-terminal domain (107-394bp), PRK15193 outer membrane usher protein (56-424bp), and FimD Outer membrane usher protein FimD/PapC (cell motility, extracellular structures, 56-424bp). The PapC N-terminal domain was a structural domain found at the N-terminus of S. typhimurium PapC protein and had a central role in the pili assembly chaperone usher system (CUP). Amino acids alignment report of the sequenced 415 amino acid of Salmonella Typhimurium bcfC gene showed great homology between the Egyptian Salmonella Typhimurium strain and the different Salmonella strains uploaded from GenBank. Nucleotide alignment report of the sequenced Salmonella Typhimurium bcfC gene at (417bp) demonstrated great homology between the Egyptian Salmonella Typhimurium strain and the different Salmonella strains uploaded from GenBank. In conclusion, the Egyptian Salmonella Typhimurium isolate was related to the common sequence types isolated from humans and bovine-based products across the world especially in the United Kingdom, USA, Ireland, and México. Most of the duck farms from which we isolated the Egyptian Salmonella Typhimurium isolates were located in the same geographical area of cattle farms in addition to the duck farms lacked the requirements of biosecurity, which could facilitate the circulatory transmission of salmonella strains between the human beings and other animal farms, including duck farms. Moreover, the PapC N-terminal domain was a central conserved domain encoded by bcfC gene of S. Typhimurium. A PapC N-terminal conserved domain can be used as a vaccine target for vaccine production against S. Typhimurium.
Keywords: bcfC gene, Conserved domain, Duck, GenBank, ORF, Phylogenetic tree, Salmonella Typhimurium, Sequencing.
INTRODUCTION
Salmonella infections are considered one of among the foremost major problems within the poultry industry. Salmonella Typhimurium has been regarded to be frequently related to disease in numerous species, including humans, livestock, domestic fowl, rodents, and birds. Therefore, Salmonella Typhimurium is described as the prototypical broad-host-range serotype (Rabsch et al., 2002). Salmonella typhimurium has been found in 60% of poultry carcass (Mann and McNabb,1984) and is responsible for 93% of the Salmonella infections in ducklings (Badr and Nasef, 2016). Salmonella Typhimurium has been isolated from 40% of hatchlings and 1% of older ducklings in Taiwan, although clear host species specific differences have also been detected. 12 Salmonella has been previously isolated from imported day old ducklings in Brazil and also the USA (Ribeiro et al., 2006 and Gaffga et al., 2012). Because the prevalence of Salmonella in duck products poses a risk to human populations, an urgent need exists to research the prevalence, disease risk to human populations, and also the global epidemiology of Salmonella serovars and specific clones. This information could also be wont to address Salmonella risk and promote evidence-based interventions in global public health (Osman et al., 2014).
380
ISSN 2322-4568
A R
c n
t <
e 5 : :
Q 2
9 2
A U
Q y
2 2
22 0
0
1 —
G
HH
2 A L
A R T
HH
C L E
Pili (fimbriae) play a central role in bacterial colonization and pathogenesis (Li and Thanassi, 2009). Fimbriae are proteinaceous extracellular structures and play a distinct role in adhesion, a major initial step for colonization and entry into host cells. Fimbriae have also referred to as to play a central role in interactions with macrophages, intestinal persistence, biofilm formation and bacterial aggregation in Salmonella serovars (Ledeboer et al., 2006). The fimbrial gene (bcfC) is located on a fimbrial structure and play a vital role in attachment and cell invasion of Salmonella typhimurium (Huehn et al., 2010). Fimbrial gene bcfC is widely distributed among Salmonella, these data are according to the essential functions of adhesion factors for the attachment and internalization processes that occur during pathogenesis (Borriello et al., 2012).
bcfC is fimbrial usher protein consists of three functional domains which are PapC N-terminal domain, PRK15193 outer membrane usher protein and FimD outer membrane usher protein FimD/PapC. PapC (pyelonephritis-associated pilus C) is an integral outer membrane usher protein that forms an assembly platform for pilus biogenesis, PapC has five functional domains, all of which are required for pilus biogenesis, It's a 24-stranded p-barrel transmembrane domain that permits translocation of the polymerized pilus fiber across the outer membrane and 4 globular domains: a periplasmic Nterminal domain (NTD), two periplasmic C-terminal domains (CTD1 and CTD2), and a plug domain (Plug) (Henderson et al., 2011 and Phan et al., 2011). The usher PapC N-terminal functional unit represents primary binding site for chaperone-usher formation (Ng et al., 2004; Nishiyama et al., 2005 and Li et al., 2010).
Therefore, the main aim of this study is applying genetic sequencing and phylogenetic analysis of bcfC gene by using bioinformatics approach to explore more information about bcfC protein and to give insight about the source and origin, molecular epidemiology, disease pattern of Salmonella Typhimurium in Egyptian duck farms. Also, identification of highly conserved domains in Salmonella Typhimurium bcfC gene sequences for vaccine designing production against Salmonella typhimurium.
MATERIALS AND METHODS
Ethical approval
No ethical approval was obtained from the Institutional Animal Ethics Committee because no invasive procedure was performed on the animals. However, this study was conducted in accordance to the Institutional Animal Ethics of Central Laboratory for Evaluation of Veterinary Biologics (CLEVB), Abbasia, Cairo, Agricultural Research Center (ARC).
Samples collection
Totally, 75 fecal swabs were collected that contained 30 from apparently healthy ducks and 45 from diseased ducks, these were collected from five duck farms in Qaluobia, Sharkia and Monofia governorates of Egypt.
Isolation of Salmonella Typhimurium
It was carried out according to methods described by ISO6579 (2002)
Identification of Salmonella Typhimurium
Microscopic examination
Suspected colonies were Gram's stained and microscopically examined according to methods described by Quinn et al. (2002).
Biochemical identification
Biochemical identification was performed on isolated organisms by using the Analytical Profile Index 20E (API 20E) system (Nucera et al., 2006).
Serological identification
Salmonella culture serotyping was carried out according to methods described by Kauffmann-White typing scheme (Popoff, 2001).
Molecular identification
DNA was extracted using the QIA amp DNA Mini kit (Qiagen, Germany, GmbH) according to the manufacturer's instructions with modifications. PCR was performed on extracted DNA by using specific primer (Table 1) supplied from Metabion (Germany) to amplify bcfC gene according to Huehn et al. (2010). PCR was performed in a 25^1 reaction containing 12.5 of Emerald Amp GT PCR Master Mix (Takara, Japan), 1 of each primer of 20 p/mol concentrations, 4.5 of water and 6 of DNA template, using an Applied Biosystems 2720 Thermal Cycler. The products of PCR were separated by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 20 of the products was loaded in each gel slot. A100 base pair (bp) DNA Ladder (Qiagen, Germany, GmbH) was utilized to determine the fragment sizes. The gel was photographed by means of a gel documentation system (Alpha Innotech, Biometra).
381
Table 1. Primer sequences, target gene and amplicon size
Microorganism
Gene
Primer sequences (5'-3')
Amplified segment product (base pair)
Reference
Salmonella Typhimurium
F-5'-accagagacattgccttc c-3'
bcfC
467
Huehn et al., (2010)
R-5'-ttctgatcgccgctattc g-3'
Open reading frame analysis
The NCBI tools website was carried out for Open reading frame analysis (ORF) analysis of bcfC gene sequence of Salmonella Typhimurium (453 bp). ExPASY-Translate Tool-SIB Bioinformatics Resource Portal was used for ORF analysis of bcfC gene sequence of Salmonella Typhimurium (453 bp) (https://web.expasy.org/translate/).
Conserved domain Search
NCBI Search Tool was performed conserved domain analysis of the bcfC protein sequence.
Phylogenetic, amino acids and nucleotide sequence analysis of bcfC gene of Salmonella Typhimurium
It was performed in Elim biopharmaceuticals, Germany. DNA sequences were obtained by Applied Biosystems 3130 genetic analyzer (HITACHI, Japan), a BLAST® analysis was initially performed according to standard methods described by Altschul et al. (1990). A comparative analysis of nucleotide and deduced amino acids sequences was performed using the CLUSTALW multiple sequence alignment program, version 1.83 of Mega Align module of Lasergene DNA Star software in accordance to methods designed by Thompson et al. (1994) and phylogenetic analysis was performed using neighbor joining in MEGA6 (Tamura et al., 2013).
RESULTS AND DISCUSSION
Isolation and identification of Salmonella Typhimurium field isolates
Out of 75 fecal swab samples, 15 isolates were confirmed phenotypically, biochemically and serologically to be Salmonella Typhimurium in a prevalence of 20% (15/75). These finding agree with Osman et al. (2014) (18.5%) and disagree with Abd El-Tawab et al. (2015) (9.6%), Lebdah et al. (2017) (14.2%), Hoszowski and Wasyl (2005) (14.3%) and Ismail (2013) (27.02%). The PCR amplification of Salmonella Typhimurium bcfC gene using specific primer sequences revealed an approximate size of 467 bp (Figure 1). bcfC gene was found in (7/15) (46.6%) Salmonella Typhimurium isolates. These results disagree with Osman et al. (2014) (100%) and Lebdah et al., (2017) (100%).
In this study, the ORF Finder commonly used on the NCBI tools website was performed (Figure 2). The NCBI tool determines the using of all qualified and alternative genetic codes. The ORF finder locates all ORFs of a specified minimum size during a nucleotide sequence. The sequence when subjected to ORF finder showed that all ORFs found of (453 bp) in (Figures 2 and 3). Also the ORF 2 is the largest one (348) nucleotides (nt) and it begins at complement (2-349 nt). It encodes 115 amino acids (aa). While ORF 1 is found downstream to ORF 2 is about (246 nt) long from (207-452 nt). It encodes 81 aa. ORF finder gives information about the coding and non-coding sequences. Detecting the coding and non-coding regions and final product in the form of its amino acid sequences is essential for understanding the evolutionary processes in various pathogens. By analyzing the ORF we will predict the possible amino acids that are producing during the translation process. The prediction of the proper ORF from a newly sequenced gene is a vital step. ORF is essential to design the primers which are required for PCR and sequencing (Orr et al., 2019).
Nucleotide sequence (453bp) was used to predict the domain region in the sequence (Figure 4). PapC N-terminal domain (107-394bp), PRK15193 outer membrane usher protein (56-424bp) and FimD outer membrane usher protein FimD/PapC (cell motility, extracellular structures); (56-424bp). Three domains were found in the bcfC gene sequence of Salmonella. The PapC N-terminal domain is a structural domain found at the N-terminus of the Gram-negative bacteria PapC protein. Pili are assembled using the chaperone usher system. In Gram-negative bacteria, this is can be composed of the chaperone PapD and the usher PapC, this domain constituet the N-terminal domain from PapC. N-terminal domain have a central role in substrate binding. The fimbrial usher protein is play a centeral role in assembling of the pilus in Gram-negative bacteria. Pilus known as one of the major fibrous surface organelles, play a great role in attachment to host tissues and given rise to development of a variety of diseases (Nougayrede et al., 2003). The assembly of fimbriae (or pili) need 2 components for assembly and transport system which consist of a periplasmic chaperone and an outer 'usher' membrane protein (Saier and Rosmalen 1993; Hultgren et al., 1994; Schifferli and Alrutz, 1994). The usher protein has a molecular weight of 86-100 kDa and include a membrane-spanning 24-stranded beta barrel domain, reminiscent of porins, and of 4 periplasmic soluble domains: an N-terminal one of about 120 residues (NTD) (Nishiyama et al., 2005; Huang et al., 2009), a 'middle' domain (plug domain) about 80 residues long (Capitani et al., 2006) and two
382
IG-like domains (each about 80 residues long) at the C-terminus (CTD1 and CTD2 (Phan et al., 2011). Interaction between the NTD and Plug domains is essential step for usher gating. A conserved and immunogenic domain considered as a unique target for various vaccine development against Salmonella (Jha et al., 2015; Singh et al., 2017).
Phylogenetic and partial gene sequence analysis of bcfC gene of Salmonella Typhimurium that was generated using neighbor joining in MEGA6 (Figure 6), showed three major clusters or branches, one representing the Egyptian Salmonella Typhimurium strain isolate with CPO22491.1, LT795114.1, CPO22497.1, LT571437.1, CPO14975.1, CPO14358.1, CPO22658.1, CPO18657.1, CPO24619.1, LN999997.1, CPO14356.1, CPO11233.1, CPO14977.1, the second cluster for CPO16754.1, CPO22003.1, CPO18659.1, CPO18655.1, CPO18635.1, CPO17232.1, CPO18633.1, CPO19383.1, CPO15526.1, CPO15524.1, CPO18661.1, CPO18651.1, CPO18648.1, and the third one for AF129435.1 and AF130422.1.
Nucleotide sequence distance of Salmonella Typhimurium bcfC virulence gene (figure 7) was created by the Mega Align module of laser gene DNA star. Sequence identities between the isolated Egyptian strain and different Salmonella Typhimurium strains uploaded from GenBank revealed that 99.8% to 100% homology. Nucleotide sequence analysis of bcfC virulence gene of the Egyptian isolated strain showed 100% nucleotide identity with the American Salmonella enterica subsp. enterica serovar Typhimurium strain CDC 2009K-1640 (accession No.CP014975), the American Salmonella enterica subsp. enterica serovar Typhimurium strain USDA-ARS-USMARC-1896 (accession No.CP014977) by Nguyen et al. (2016), the Irish Salmonella enteric subsp. enterica serovar Typhimurium strain SL1344RX (accession No.CP011233) by Fitzgerald et al. (2015), the Mexican Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 (accession No.CP014358) and Salmonella enterica subsp. enterica serovar Typhimurium strain YU15-SO2 (accession No.CP014356) by Silva et al. (2016).
In this study the Egyptian Salmonella Typhimurium isolate was distributed into common sequence types isolated from humans and bovine-based products across the world especially in the United Kingdom, USA, Ireland and México. Most of the duck farms from which we isolated the Egyptian Salmonella Typhimurium isolates were located in the same geographical area of cattle farms in addition to these farms lacked the requirements of biosecurity, which facilitates the circulatory transmission of Salmonella strains between human and animal farms to duck farms, present results agree with Murgia et al. (2015); Ktari et al. (2016) and Yang et al. (2019). Wang et al. (2020) recorded that the relatively high frequency of invasive infection of Salmonella in commercial meat-type duck flocks may largely relate to semi-open rearing systems that lack effective biosecurity, the majority of S. Typhimurium isolates were grouped into ST19 (63.89%), the most common sequence types isolated from humans and animal-based food products across the world , Perhaps circulatory transmission generated between contaminated poultry meat and human beings.
So, this study concluded that it is possible that the realistic explanation for the existence of similar strains of salmonella typhimurium isolated from duck farms and cows farms and strains isolated from the human host is the absence of disinfection, sterilization operations and the absence of health requirements by farm workers in addition to that the duck farms were located in the same geographical area of bovine farms. Amino acids alignment report of the sequenced 415 amino acid of Salmonella Typhimurium bcfC gene showed (figure 5) great homology between the Egyptian strain and the different Salmonellae strains from GenBank. On the other hand, nucleotide alignment report of the sequenced 417bp of Salmonella Typhimurium bcfC gene showed (figure 8) high identity between the Egyptian strain and the different Salmonellae strains from GenBank.
100
100
Figure 1. Agarose gel showingPCR-amplified product of bcfC virulence gene of Salmonella Typhimurium isolated from ducks.Lanes (1, 4, 8, 9, 10, 12, and 14): samples positive forbcfCgene (467 bp), Lane (pos.): positive control, Lane (Neg.): Negative control, Lane (L): MW 100bp ladder (DNA marker).
Open Reading Frame Viewer Sequence
ORFs found: 2 Genetic code: 1 Start codon: 'ATG' only
b 8 ~ Find: - O C> | iSL L3= St to t Tools* ÖT'acks' ij "J '
r
[ 20 40 |60 |80 tea 120 |140 jiea |i 38 jEJSJ't [240 [SCO |280 |308 [320 240 |360 |380 |4G0 |420 4^
(IT) ORFfinder 5.15.22432428 n 1 1 n 10"
Six-frame translations
4-1 I *i I ■ I ■ ■ ■ ■ ■ ■ I ■ I ■ II
-l -2 -i I ■ ■ I ■ 1 ■ ■ I I ■ I I I ■ II 11
f pe 4.1 |6o |se Jiea |ias |140 jiea |i 3B 29 |228 [240 |2S0 |280 p00 [320 340 |3S0 |3W |400 |420 | 45^
1: 1..452 [452 nt] 0 Tracks shown: 3/7
Six-frame translation.
Figure 2. Open reading frame analysis of bcfC gene nucleotide sequence
Figure 3. Open reading frame analysis of bcfC gene protein translation using ExPasy (SIB Bioinformatics Resource Portal) showed all ORFs. The frame 2 is the longest one.
Figure 4. Conserved domains exist within the family region
384
Figure 5. Amino acids alignment of bcfC virulence geneof Egyptian isolated strain Salmonella Typhimurium and different Salmonella Typhimurium strains retrieved from GenBank using CLUSTALW multiple sequence alignment program version 1.83 of MegAlign module of Lasergene DNASTAR.
CP02264S 1
С P019657 1
CP024619 1
LM999997 1
CP014356 1
CP011233 1
CP014977 1
CP022491 1
• Еду stram
LT795H4 1
CP022497 1
LT571437 1
CP014975 1
CP0I43S8 1
СРФ1КЭЗ 1 СР017712 1 СР019635 1 СР019645 1 СР019659 1
сроггооз i
CP0167S4 1 СР018648 1 СР019651 1
cpoiseet 1 CP01S524 1 СР015526 1 СР019393 1
AF12943S 1 AF130422 1
0001
Figure 6. Phylogenetic tree for Salmonella Typhimurium bcfC virulence gene partial nucleotide sequences that was generated using neighbor joining in MEGA6, showing clear clustering of the Egyptian isolated strain (marked with red color) and different Salmonella Typhimurium strains uploaded from GenBank.
385
Percent Identity
o 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 LT795114.1 Egy strain CP022497.1 CP0224911 LT571437 1 CP014977.1 CP0149751 CP011233.1 CP0143581 CP014356.1 LN9999971 CP0193831 CP015526.1 CP0155241 CP018661.1 CP018651.1 CP0186481 CP016754.1 CP0220031 CP018659.1 CP0186551 CP018635.1 CP0186331 CP017232.1 AF129435.1 AF1304221 CP024619.1 CP0186571 CP022658.1
1 ■I 100.0 00 100.0 100 0 100.0 100.0 1000 100 0 100.0 100.0 1000 99.8 99.8 99.8 998 998 99.8 99.8 998 998 998 99.8 99.8 998 99.3 99.3 100.0 100.0 1000 1
2 00 r - 100 0 100.0 100.0 1000 100 0 1000 100.0 100.0 998 998 99.8 99 8 998 998 99.8 998 99 8 99 8 998 998 99 8 993 993 100.0 1000 1000 2
3 0.0 ioo : 100.0 100.0 100 0 100.0 100.0 100.0 100.0 99.8 99.8 99.8 998 99.8 998 99.8 99.8 998 998 99.8 99.8 998 99.3 993 100.0 100.0 1000 3
4 00 00 00 0.0 p- - 0.0 100.0 100 0 1000 1000 100.0 1000 99 8 99 8 99.8 99 8 99 8 99 8 99.8 998 99 8 99 8 99.8 998 998 99 3 993 100.0 1000 1000 4
5 0.0 00 00 100.0 1000 100 0 100.0 100.0 100.0 998 998 99.8 998 998 998 99.8 998 998 998 99.8 998 998 993 993 100.0 1000 1000 5
6 0.0 00 0.0 0.0 ■ 1000 00 100 0 100.0 100.0 1000 998 99.8 99.8 998 998 998 99.8 99.8 998 998 99.8 99.8 99 8 99.3 99.3 100.0 1000 100 0 6
7 0.0 00 00 00 0.0 00 10.: : 00 1000 100.0 1000 99 8 99 8 99.8 998 998 99 8 99.8 998 99 8 99 8 998 998 99 8 993 993 100.0 1000 1000 7
8 0.0 00 0.0 0.0 0.0 0.0 100.0 100.0 100.0 99.8 99.8 99.8 99.8 99.8 99.8 99.8 99.8 998 998 99.8 99.8 998 99.3 99.3 100.0 100.0 100.0 8
9 00 00 00 00 0.0 0.0 00 0.0 0.0 1000 998 99 8 99.8 99 8 998 99 8 99.8 998 998 99 8 99.8 998 998 993 993 100.0 1000 1000 9
10 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 100.0 998 99.8 99.8 998 998 99.8 99.8 99.8 998 998 99.8 99.8 998 99.3 99.3 100.0 100.0 100.0 10
11 0.0 0.0 0.0 0.0 0.0 0.0 00 00 0.0 02 99 8 0.0 998 99.8 998 998 998 99.8 998 99 8 998 99.8 998 99 8 993 99.3 100.0 1000 1000 11
12 0.2 02 02 0.2 0.2 02 02 02 0.2 0.2 1000, 00 100.0 1000 100 0 1000 100.0 100.0 1000 1000 1000 100.0 1000 990 990 99.8 998 998 12
13 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 100.0 0.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 99.0 99.0 99.8 99.8 99.8 13
14 02 02 02 02 0.2 02 02 02 0.2 0.2 02 00 1000 1000 100 0 1000 100.0 1000 100 0 1000 100.0 1000 99 0 990 998 99 8 99 8 14
15 0.2 0.2 0.2 0.2 0.2 0.2 02 02 0.2 0.2 0.2 0.0 0.0 100.0 00 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 99.0 99.0 99.8 99.8 99.8 15
16 0.2 02 02 0.2 0.2 02 02 02 0.2 02 02 0.0 00 0.0 00 1000 0.0 100.0 100.0 1000 100 0 100.0 100.0 1000 990 990 99.8 99 8 998 16
17 0.2 02 02 0.2 0.2 0.2 02 02 0.2 0.2 02 0.0 00 0.0 00 100.0 100.0 1000 100 0 100.0 100.0 100.0 990 990 99.8 99 8 998 17
18 0.2 0.2 0 2 0.2 0.2 0.2 0.2 02 0.2 0.2 0.2 00 0.0 0.0 0.0 0.0 100.0 0.0 100.0 100 0 100.0 100.0 100.0 99.0 99.0 99.8 998 99.8 18
19 02 02 02 0.2 0.2 0.2 02 02 0.2 0.2 02 00 00 0.0 00 00 00 0.0 100 0 1000 1000 100.0 1000 990 990 998 998 99 8 19
20 0.2 02 02 0.2 0.2 0.2 02 02 0.2 0.2 0.2 0.0 0.0 0.0 00 0.0 0.0 0.0 tu; : 00 100.0 100.0 100.0 99.0 99.0 99.8 998 998 20
21 0.2 02 02 02 0.2 02 02 02 0.2 0.2 02 00 0.0 0.0 00 0.0 0.0 0.0 00 00 1000 100.0 1000 990 990 99.8 99 8 998 21
22 0.2 02 02 02 0.2 0.2 02 0.2 0.2 0.2 02 0.0 0.0 0.0 00 00 00 0.0 0.0 0.0 100.0 100.0 990 99.0 99.8 998 998 22
23 02 02 02 0.2 0.2 02 0.2 0.2 0.2 0.2 02 0.0 0.0 0.0 00 0.0 0.0 0.0 0.0 00 0.0 0.0 1000 1.0 990 99.0 99.8 998 99 8 23
24 02 02 02 02 0.2 02 02 02 0.2 0.2 02 00 00 0.0 00 00 00 0.0 0.0 00 00 0.0 00 99 0 990 99.8 998 998 24
25 0.7 0.7 07 0.7 0.7 0.7 07 0.7 0.7 0.7 07 1.0 1.0 1.0 10 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 ■ 100.0 0.7 99.3 993 99.3 25
26 0.7 07 07 07 0.7 07 07 07 0.7 0.7 07 10 10 1.0 10 10 10 1.0 10 10 10 1.0 1.0 10 00 99.3 0.0 99 3 99 3 26
27 0.0 0.0 00 0.0 0.0 0.0 00 0.0 0.0 0.0 00 0.2 0.2 0.2 02 0.2 0.2 0.2 02 02 0.2 0.2 0.2 02 0.7 100.0 1000 27
28 00 00 00 0.0 0.0 0.0 00 00 0.0 0.0 00 02 02 0.2 02 0.2 02 0.2 02 02 02 02 02 02 07 0.7 1000 29 28 29
29 0.0 0.0 0.0 0.0 0.0 0.0 00 0.0 0.0 0.0 00 02 02 0.2 02 0.2 02 0.2 02 02 02 0.2 0.2 02 07 0.7 0.0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28
Figure 7. Nucleotide sequence distance analysis of bcfC virulence gene of Egyptian isolated strain and other Salmonella Typhimurium strains from GenBank.
H a] or i ty TCGCC GCTATTC GC GTTCCATGTGGAGTAGTC GC GTAACC GCCAG GCCCCC AG ATTAAGGCC GCTATTCAATCC AAGAAA
10 20 3D 40 50 60 70 60
LT795114.1 ................................................................................................................................................................80
Egy strain ................................................................................................................................................................B0
CP022497.1 ................................................................................................................................................................B0
CP022491.1 ................................................................................................................................................................B0
LT571437.1 ................................................................................................................................................................B0
CP014977.1 ................................................................................................................................................................B0
CP014975.1 ................................................................................................................................................................B0
CP011233.1 ................................................................................................................................................................B0
CP01435B. 1 ................................................................................................................................................................B0
CP014356.1 ................................................................................................................................................................B0
LN999997.1 ................................................................................................................................................................B0
CP0193B3.1 ................................................................................................................................................................B0
CP015526.1 ................................................................................................................................................................B0
CP015524.1 ................................................................................................................................................................B0
CP018661.1 ................................................................................................................................................................B0
CP018651.1 ................................................................................................................................................................B0
CP018648.1 ................................................................................................................................................................80
CP016754.1 ................................................................................................................................................................80
CP022003.1 ................................................................................................................................................................B0
CP018659.1 ................................................................................................................................................................80
CP018655.1 ................................................................................................................................................................80
CP018635.1 ................................................................................................................................................................B0
CP018633.1 ................................................................................................................................................................80
CP017232.1 ................................................................................................................................................................B0
AF129435.1 .................................G.............................T................................B0
AFl 30422.1 .................................G.............................T................................B0
CP024619.1 ................................................................................................................................................................B0
CP018657.1 ................................................................................................................................................................BO
CP022658.1 ................................................................................................................................................................BO
Majority ATAGCTGTTCTCC GCACTGCC GCCTG GGCTCC GATCCTG ACTATTC GC GCCGGTAAAGGTGTAATTCAATAGCAAC GC AT
90 100 110 120 130 140 150 160
LT795114.1 ................................................................................................................................................................160
Egy strain ................................................................................................................................................................160
CP022497.1 ................................................................................................................................................................160
CP022491.1 ................................................................................................................................................................160
LT571437.1 ................................................................................................................................................................160
CP014977.1 ................................................................................................................................................................160
CP014975.1 ................................................................................................................................................................160
CP011233.1 ................................................................................................................................................................160
CP014358.1 ................................................................................................................................................................160
CP014356.1 ................................................................................................................................................................160
LN 999997.1 ................................................................................................................................................................160
CP019383.1 ................................................................................................................................................................16D
CP015526.1 ................................................................................................................................................................160
CP015524.1 ................................................................................................................................................................160
CP018661.1 ................................................................................................................................................................160
CP016651.1 ................................................................................................................................................................160
CP018648.1 ................................................................................................................................................................160
CP016754.1 ................................................................................................................................................................160
CP022003.1 ................................................................................................................................................................160
CP018659.1 ................................................................................................................................................................160
CP018655.1 ................................................................................................................................................................160
CP018635.1 ................................................................................................................................................................160
CP018633.1 ................................................................................................................................................................16D
CP017232.1 ................................................................................................................................................................160
AF129435.1 .........T............................................................................................................................................160
AF130422.1 .........T............................................................................................................................................160
CP024619.1 ................................................................................................................................................................160
CP018657.1 ................................................................................................................................................................160
CP022658.1 ................................................................................................................................................................160
386
majority TAATACCTTCATCCCAGTATTTCGGTGGGATATAGCCTCTGGCGCTGGCAACCATCGCCGCCTGCGGGATGCTAATGTCG
170 180 190 200 210 220 230 240
LT795114.L ................................................................................................................................................................240
Egy strain ................................................................................................................................................................240
CP022497.1 ................................................................................................................................................................240
CP022491.1 ................................................................................................................................................................240
LT571437.L ................................................................................................................................................................240
CP014977. L ................................................................................................................................................................240
CP014975.L ................................................................................................................................................................240
CP011233.1 ................................................................................................................................................................240
CP01435B.1 ................................................................................................................................................................240
CP014356.1 ................................................................................................................................................................240
LN999997.L ................................................................................................................................................................240
CP019383.L ................................................................................................................................................................240
CP015526.1 ..............................................................................................................................................................240
CP015524.1 ................................................................................................................................................................240
CP018661.L ................................................................................................................................................................240
CP018651.L ................................................................................................................................................................240
CP018648.1 ................................................................................................................................................................240
CP0167 54.1 ................................................................................................................................................................240
CP022003.1 ................................................................................................................................................................240
CP018659.1 ................................................................................................................................................................240
CP018655.L ................................................................................................................................................................240
CP018635.L ................................................................................................................................................................240
CP018633.1 ................................................................................................................................................................240
CP0172 32.1 ................................................................................................................................................................240
AF129435.L ................................................................................................................................................................240
AFI 30422.L ................................................................................................................................................................240
CP024619.L ................................................................................................................................................................240
CP0186 57.1 ................................................................................................................................................................240
CP0226 5B.1 ..............................................................................................................................................................240
Ir-lajonty AGACGTTGCTGCGCAAAATCAAAGCGGGTCCGGGCGGCCGGTATCGCACTGGCGAGATCCGGGCAACTTCCCGCCGCCGC
250 260 270 280 290 300 310 320
LT795114.1 ................................................................................................................................................................320
Egy strain ................................................................................................................................................................320
CP022497.1 ................................................................................................................................................................320
CP022491.1 ................................................................................................................................................................320
LT571437.1 ................................................................................................................................................................320
CP014977.1 ................................................................................................................................................................320
CP014975.1 ................................................................................................................................................................320
CP011233.1 ................................................................................................................................................................320
CP014358.1 ................................................................................................................................................................320
CP014356.1 ................................................................................................................................................................320
LN999997.1 ................................................................................................................................................................320
CP019383.1 ...........................................................A........................................320
CP015526.1 ...........................................................A........................................320
CP015524.1 ...........................................................A........................................320
CP018661.1 ...........................................................A........................................320
CP018651.1 ...........................................................A........................................320
CP016648.1 ...........................................................A........................................320
CP0167 54.1 ...........................................................A........................................320
CP022003.1 ...........................................................A........................................320
CP018659.1 ...........................................................A........................................320
CP018655.1 ...........................................................A........................................320
CP01B635.1 ...........................................................A........................................320
CP018633.1 ...........................................................A........................................320
CP017232.1 ...........................................................A........................................320
AF129435.1 ................................................................................................................................................................320
AFI 30422.1 ................................................................................................................................................................320
CP024619.1 ................................................................................................................................................................320
CP01B657.1 ................................................................................................................................................................320
CP022658.1 ................................................................................................................................................................320
Ir-iaj ОГ i ty CTTCGCCAACAGTGGAAACGCCCCGGTGTTTACCCCCATAI I I I IAAGCATTTCAGGCGTCAGGCAGGCGCGTAATCCGC
330 340 350 360 370 380 390 400
LT795114.1 ................................................................................................................................................................400
Egy strain ................................................................................................................................................................400
CP022497.1 ................................................................................................................................................................400
CP022491.1 ................................................................................................................................................................400
LT571437.1 ................................................................................................................................................................400
CP014977.1 ................................................................................................................................................................400
CP014975.1 ................................................................................................................................................................400
CP011233.1 ................................................................................................................................................................400
CP014358.1 ................................................................................................................................................................400
CP014356.1 ................................................................................................................................................................400
LN999997.1 ................................................................................................................................................................400
CP019383.1 ................................................................................................................................................................400
CP015526.1 ................................................................................................................................................................400
CP015524.1 ................................................................................................................................................................400
CP018661.1 ................................................................................................................................................................400
CP018651.1 ................................................................................................................................................................400
CP0ie648.1 ................................................................................................................................................................400
CP016754.1 ................................................................................................................................................................400
CP022003.1 ................................................................................................................................................................400
CP018659.1 ................................................................................................................................................................400
CP016655.1 ................................................................................................................................................................400
CP018635.1 ................................................................................................................................................................400
CP018633.1 ................................................................................................................................................................400
CP017232.1 ................................................................................................................................................................400
AF129435.1 ................................................................................................................................................................400
AFI 30422.1 ................................................................................................................................................................400
CP024619.1 ................................................................................................................................................................400
CP018657.1 ................................................................................................................................................................400
CP022658.1 ................................................................................................................................................................400
387
iMajority TGTCATCGGTGGÛCÛCG
410
LT795114.1 ..................................417
Egy strain ..................................417
CP022497.1 ..................................417
CP022491.1 ..................................417
LT571437.1 ..................................417
CP014977.1 ..................................417
CP014975.1 ..................................417
CP011233.1 ..................................417
CP014358.1 ..................................417
CP014356.1 ..................................417
LN 999997.1 ..................................417
CP019383.1 ..................................417
CP015526.1 ..................................417
CP015524.1 ..................................417
CP018661.1 ..................................417
CP018651.1 ..................................417
CP018648.1 ..................................417
CP016754.1 ..................................417
CP022003.1 ..................................417
CP018659.1 ..................................417
CP016655.1 ..................................417
CP018635.1 ..................................417
CP018633.1 ..................................417
CP017232.1 ..................................417
AF129435.1 ..................................417
AF130422.1 ..................................417
CP024619.1 ..................................417
CP018657.1 ..................................417
CP022658.1 ..................................417
Figure 8. Nucleotides alignment of bcfC virulence gene sequence of Egyptian strain of Salmonella Typhimurium and different Salmonella Typhimurium strains retrieved from GenBank using CLUSTALW multiple sequence alignment program version 1.83 of MegAlign module of Lasergene DNASTAR.
DECLARATIONS
Author's contributions
Abeer Saad El-Maghraby designed the idea and concept of the review article, planned the study and Abeer Saad El-Maghraby, AbeerMwafy and Hala Ahmed Al-Sawy designed and performed study design. All authors shared in writing, and approved the final version of manuscript.
Acknowledgements
This study was supported by the Central Laboratory for Evaluation of Veterinary Biologics (CLEVB), Abbasia, Cairo and Veterinary Serum and Vaccine Research Institute (VSVRI), Abbasia, Cairo, Egypt.
Competing interests
The authors declared that no competing interests exist.
REFERENCES
Abd El-Tawab AA, Ammar AM, Soad AN, El-Hofya FI and Nabil NM (2015). Studies on different Salmonella serotypes isolated from poultry in different governorates in Egypt. Benha Veterinary Medicine Journal, 28 (2): 169-175.
Altschul SF, Gish W, Miller W, Myers EW and Lipmanl DJ (1990). Basic Local Alignment Search Tool. Journal of Molecular Biology, 215 (3): 403410. DOI: https://www.doi.org/10.1016/S0022-2836(05)80360-2
Badr H and Nasef SA (2016). Pathogenicity of Salmonella Typhimurium isolated from Pekin duck. 3rd Conference of Sciences Association of Animal Health Research Institute, 4 (1): 267- 277.
Borriello G, Lucibelli MG, De Carlo E, Auriemma C, Cozza D, Ascione G, Scognamiglio F, Iovane G and Galiero G (2012). Characterization of enterotoxigenic E. coli (ETEC), Shiga-toxin producing E. coli (STEC) and necrotoxigenic E. coli (NTEC) isolated from diarrhoeic Mediterranean water buffalo calves (Bubalusbubalis). Research in Veterinary Science, 93:18-22. DOI: https://doi.org/10.1016/j.rvsc.2011.05.009
Capitani G, Eidam O and Markus G Grutter (2006). Evidence for a novel domain of bacterial outer membrane ushers. Proteins, 65 (4): 816-823. DOI: https://doi.org/10.1002/prot.21147
Fitzgerald SF, Dillon SC, Wiencko H, Hokamp K, Cameron ADS and Dorman CJ (2015). Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College Dublin, Dublin 2, Ireland Source DNA and bacteria available from Charles Dorman, Dept. of Microbiology, Trinity College Dublin, Dublin 2, Ireland ([email protected]). Available at: https://www.ncbi.nlm.nih.gov/nuccore/CP011233.
Gaffga NH, Behravesh CB, Ettestad PJ, Smelser CB, Rhorer AR, Cronquist AB, Comstock NA, Bidol SA, Patel NJ, Gerner-Smidt P et al. (2012): Outbreak of Salmonellosis Linked to Live Poultry from a Mail-Order Hatchery. New England Journal of Medicine, 366:2065-2073.
Henderson NS, Ng TW, Talukder I and Thanassi DG (2011) Function of the usher N-terminus in catalysing pilus assembly. Molecular Microbiology,79:954-967.
Hoszowski A and Wasyl D (2005). Salmonella prevalence and resistance to antibiotics in Poland. Medycyna Weterynaryjna, 61 (6): 660-663.
Huang Y, Smith BS, Chen LX, Baxter RH and Deisenhofer J (2009) Insights into pilus assembly and secretion from the structure and functional characterization of usher PapC. Proc Natl Acad Sci USA 106:7403-7407.
HuehnS, La Ragione RM, Anjum M, Saunders M, Woodward MJ, Bunge C, Helmuth R,Hauser E, Guerra B, Beutlich J et al. (2010). Virulotyping and antimicrobial resistance typing of Salmonella enterica serovars relevant to human health in Europe. FoodBorne Pathogens and Disease,7(5): 523535. DOI: https://doi.org/10.1089/fpd.2009.0447
388
Hultgren SJ, Jacob-Dubuisson F and Striker R (1994). Chaperone-assisted self-assembly of pill independent of cellular energy. Journal of Biological Chemistry, 269 (17): 12447-12455. PMID: 7909802.
Ismail RHI (2013). Some studies on bacterial causes of respiratory troubles in ducklings. M. V. Sc. Thesis, Faculty of VeterinaryMedicine, Zagazig University.
ISO 6579 (2002). Microbiology of food and animal feeding stuffs horizontal method for the detection of Salmonella. International Standards Organization, Geneva.DOI: https://www.iso.org/obp/ui/#iso:std:iso:6579:ed-4:v1 :en
Jha R kumar A, Saxena A, Pandey M, Kumar R and Saxena MK (2015). Heterogenous expression and functional evaluation of in silico characterized recombinant OmpC of Salmonella Typhimurium as a functional poultry vaccine to eradicate zoonotic transmission. African journal of Biotechnology, 14: 2862-2870.
Ktari S, Ksibi B, Gharsallah H, Mnif B, Maalej S, Rhimi F and Hammami A (2016). Molecular epidemiological characteristics of Salmonella enterica serovars Enteritidis, Typhimurium and Livingstone strains isolated in a Tunisian university hospital. Acta Pathologica, Microbiologica, et Immunologica Scandinavica, 124 (3): 194-200. DOI: http://doi.org/10.1111/apm.12484
Lebdah Mohamed A, Amal AM Eid, Soad A Nasef and Hamad EM (2017). Phenotypic and genotypic characterization of paratyphoid Salmonellae isolated from poultry in Delta Area- Egypt. Zagazig Veterinary Journal, 45 (3): 262-272. DOI: http://doi.org/10.21608/ZVJZ.2017.7951
Ledeboer NA, Frye JG, McClell and M and Jones BD (2006). Salmonella enterica serovar Typhimurium requires the Lpf, Pef, and Tafi fimbriae for biofilm formation on HEp-2 tissue culture cells and chicken intestinal epithelium. Infection and Immunity, 74 (6): 3156-3169.DOI: https://doi.org/10.1128/IAI.01428-05
Li H and Thanassi DG (2009). Use of a combined cryo-EM and X-ray crystallography approach to reveal molecular details of bacterial pilus assembly by the chaperone/usher pathway. Current Opinion in Microbiology, 12: 326-332.
LiQ, Ng TW, Dodson KW, Kin So SSK, Bayle KM, Pinkner JS, Scarlata S, Hultgren SJ and Thanassi DG (2010). The differential affinity of the usher for chaperone-subunit complexes is required for assembly of complete pili. Molecular Microbiology, 76(1):159-172. DOI: https://doi.org/10.1111/j.1365-2958.2010.07089.x
Mann E and McNabb CD (1984). Prevalence of Salmonella contamination in market-ready geese in Manitoba. Avian Diseases, 284: 978-983. Available at: https://books.google.com.eg/books?id=UI9cBAAAQBAJ&pg=PA232&dq
Murgia M, Bouchrif, B, Timinouni M, Al-Qahtani A, Al-Ahdal MN, Cappuccinelli P, Rubino S and Paglietti B (2015). Antibiotic resistance determinants and genetic analysis of Salmonella enterica isolated from food in Morocco. International Journal of Food Microbiology, 215: 3139.
Ng TW, Akman L, Osisami M and Thanassi DG (2004). The usher N terminus is the initial targeting site for chaperone-subunit complexes and participates in subsequent pilus biogenesis events.Journal of Bacteriology, 186 (16): 5321-5231.
Nguyen SV, Harhay DM, Bono JL, Smith TPL, Fields PI, Dinsmore BA, Santovinia M, Kelley CM, WaR, Bosilevac JM and Harhay GP (2016). The complete and closed genome sequences of ten Salmonella enterica subsp. Enterica serotypes Typhimurium isolated from human and bovine sources. Meat Safety and Quality Research Unit, USDA-ARS U.S. Meat Animal Research Center, 844 Rd 313, Clay Center, NE 68933, USA. Available at: https://www.ncbi.nlm.nih.gov/nuccore/CP014977
Nishiyama M, Horst R Eidam O (2005).Structural basis of chaperoneä€"subumt complex recognition by the type 1 pilus assembly platform FimD. The EMBO Journal, 24 (12): 2075-86.DOI: https://doi.org/10.1038/sj.emboj.7600693
Nougayrede JP, Fernandes PJ and Donnenberg MS (2003). Adhesion of enteropathogenic Escherichia coli to host cells. Cell Microbiology, 5: 359 -372.
Nucera DM, Maddox CW, Hoien-Dalen P and Weigel RM (2006). Comparison of API 20E and invA PCR for Identification of Salmonella enterica Isolates from Swine Production Units. Journal ofClinical Microbiology, 44 (9): 3388-3390. DOI: https://doi.org/10.1128/JCM.00972-06.
Orr MW, Mao Y, Storz G and Shu-Bing Q (2019). Alternative ORFs and small ORFs: shedding light on the dark proteome. Nucleic Acids Research, 48 (3): 1029-1042. DOI: https://doi.org/10.1093/nar/gkz734
Osman KM, Marouf SH, Zolnikov TR and AlAtfeehy N (2014). Isolation and characterization of Salmonella enterica in day-old ducklings in Egypt. Pathogens and Global Health, 108 (1): 37-48.DOI: https://doi.org/10.1179/2047773213Y.0000000118
Phan G, Remaut H, Wang T, Allen WJ, Pirker KF, Lebedev A, Handerson NS, Geibel S, Volkan E, Yan J et al. (2011).Crystal structure of the FimD usher bound to its cognate FimC-FimH substrate. Nature, 474 (7349): 49-53. Available at: https://doi.org/10.1038/nature10109.
Popoff MY (2001). Antigenic formulas of the Salmonella serovars, WHO Collaborating Center for reference and research on Salmonella, Institut Pasteur, Paris, France. (8th edition). Available at: https://www.scielo.br/scielo.php?script=sci_arttext&pid=S0074-02762003000400013
Quinn PJ, Carter ME, Markey B and Carter GR (2002). Clinical Veterinary Microbiology, First edition, London: Mosby, Edinburg, pp. 287-292.
RabschW, Andrews HL, Kin-gsley RA, Prager R Tschäpe H, Adams LG and Bäumler AJ (2002). Salmonella entericaserotype Typhimurium and its host adapted variants. Infection and immunity, 70 (5): 2249-2255. DOI: https://doi.org/10.1128/IAI.70.5.2249-2255.2002
RibeiroS, Galleti MCM, Orsi MA, Ferrati AR, Mendonja AO, Doretto Júnior L, Camillo SCA and Reischak D (2006). Incidence of Salmonella in imported day-old ducklings. Brazil, 1998-2003. Brazilian Journal of Poultry Science, 8 (1): 39-43. DOI:https://doi.org/10.1590/S1516-635X2006000100006
Saier Jr MH and Rosmalen MV (1993). "Structural and evolutionary relationships between two families of bacterial extracytoplasmic chaperone proteins which function cooperatively in fimbrial assembly". Research in Microbiology, 144 (7): 507-527. DOI: https://doi.org/10.1016/0923-2508(93)90001-I.
Schifferli DM andAlrutz MA (1994). Permissive linker insertion sites in the outer membrane protein of 987P fimbriae of Escherichia coli. Journal of Bacteriology, 176 (4): 1099-1110. DOI: https://doi.org/10.1128/jb.176.4.1099-1110.1994.
Silva C, Calva E, Puente JL, Zaidi MB and Vinuesa P (2016). Complete genome sequence of Salmonellaenterica serovar Typhimurium strain YU15 (Sequence Type 19) harboring the Salmonellagenomic island 1 and virulence plasmid pSTV. Journal of Genome Announcement, 4 (2): e00252-e002516. DOI: https://doi.org/10.1128/genomeA.00252-16.
Singh Y, Tiwari A, Kumar R and Saxena MK (2017). Cloning, sequencing and phylogenetic analysis of stn gene of Salmonella Typhimurium. Biosciences Biotechnoloy Research Asia, 14 (4): 1387-1393.
Tamura K, Stecher G, Peterson D, Filipski A and Kumar S (2013). MEGA6: molecular evolutionary genetics analysis. version 6.0. Molecular Biology and Evolution, 30 (12): 2725-2729. DOI:https://doi.org/10.1093/molbev/mst197.
Thompson JD, Higgins DG and Gibson TJ (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22 (22): 4673-4680. DOI: https://doi.org/10.1093/nar/22.22.4673.
389
Wang J, Jinxin Li, Fengli Liu, Yongyou Cheng and Jingliang Su (2020). Characterization of Salmonella enterica isolates from diseased poultry in Northern China between 2014 and 2018. Pathogens, 9 (95): 1-13. DOI: https://doi.org/10.3390/pathogens9020095
Yang X, Wu Q, Zhang J, Huang J, Chen L, Wu S, Zeng H, Wang J, Chen M, Wu H et al. (2019). Prevalence, Bacterial Load, and Antimicrobial Resistance of Salmonella Serovars Isolated From Retail Meat and Meat Products in China. Frontiers in Microbiology, 10: 2121. DOI: https://doi.org/10.3389/fmicb.2019.02121
390
