УДК: 575.224
PREVALENCE OF THE CCR5 DELTA32 MUTATION IN THE TUNDRA NENETS OF YAMAL
© T. Ammosova1, A. s. Egorov2, E.V. Fedorova2, s. L. Avrusin2, A.V. santimov2, s. Nekhai1
1 Howard University, Washington, USA;
2 Saint Petersburg State Pediatric Medical University, Russia
Resume. CCR5 delta 32 is a genetic variant of CCR5 - deletion mutation of a gene that has a specific impact on the adhesive function of T cells. It is believed that this mutation arose approximately two and a half thousand years ago and eventually spread in Europe. It has been hypothesized that this allele was favored by natural selection during the Black Death. In the heterozygotes, this mutation strongly reduces the chance of HIV infection In the homozygotes, it completely protects against HIV infection. CCR5 delta32 mutation in the heterozygous state occurs in Europe with a frequency of 5-14 %. The incidence of CCR5 delta32 outside of Europe is very low, and in many non-European ethnic groups it is completely absent. The prevalence of this mutation in the population of the Nenets has not previously investigated. It was assumed to have a lower frequency than in Europeans. We carried out an investigation with 54 blood samples of Nenets living in Yamalo-Nenets Autonomous District. DNA was extracted with was OIAamp DNA Mini Kit (OIAGEN) according to the manufacturer protocol. To identify the CCR5 delta32 deletion polymerase chain reaction was conducted using primers: CCR5-D32-F: 5TTTCATTACACCTGCAGTC3\ CCR5-D32-R: 5,TGAAGATAAGCCTC^C^GCC3, under the following conditions: 95°-5'x1; 95°-15"^ 55°-15"^72°-60"x40; 72°-10'x1 ^ 4°-~. Products of the reaction were separated in 2 % aga-rose gel for 1.5 hours. Gel documentation was performed using a Gel Doc XR Plus (Bio-Rad, USA). The prevalence of CCR5 delta32 mutation in Nenets was found to be 9.3 %. This was a higher than expected frequency, and it corresponds to the average prevalence of CCR5 delta32 mutation in Europe. Our finding suggests possible European origin of the Nenets.
Key words: CCR5 delta32; Nenets; ethnic groups.
introduction
CCR5 delta 32 is agenetic variant of CCR5 receptor with 32 nucleotides deletion that affects its li-gands binding. CCR5 is recognized as a number of cytokines including RANTES, MIP-1a and MIP-10. These cytokines are expressed by immune cells, including NK-cells, T-lymphocytes, macrophages, and play a crucial role in the migration and activation of immune cells. Thus, any change in the sequence of the CCR5 gene or its expression can be associated with a dysfunction of the immune system and the development of autoimmune diseases [3]. CCR5 delta 32 mutation reduces number of CCR5 receptors on the surface of T lymphocytes. The CCR5 expression levels influence migration of inflammatory cells into the synovium and, as a result, the susceptibility to juvenile idiopathic arthritis [4]. In the heterozygotes this mutation significantly reduces HIV infection and in the homozygots it fully protects against HIV infection [12]. Meta-analysis data indicated that CCR5 delta32 polymorphism might act as a protective factor in type 1 diabetes development, and as a risk factor for Kawasaki disease and Behcet's disease [5, 10].
Coalescence theory analysis of modern haplotype genealogy placed the origin of the CCR5 delta32-con-taining ancestral haplotype at about 700 years ago, with an estimated range of 275-1875 years [11] in one study and 700-3500 years ago in the other study [8], and eventually spread to Europe. Analysis of all available data
on CCR5 delta32 frequencies in the Old World allowed for construction of a geographical gene map to analyze possible correlations between allele frequencies and eight climatic-geographic parameters [6]. A strong positive correlation was found between the allele frequency and latitude, a strong negative correlation with annual radiation balance, and a weaker negative correlation with longitude. Exclusion of latitude reduced the negative correlation between the allele frequency and annual radiation balance, but it still remained large and significant. The existence of correlations between the cline of CCR5 delta32 frequencies and climatic-geographic parameters suggest for an effect of either natural environmental factors or large-scale population movements on the distribution of this allele [6].
Distribution of CCR5 gene mutations in populations has distinct ethnic and racial features. The geographic cline of CCR5 delta32 frequencies and its recent emergence are consistent with a historic strong selective event such as an epidemic of a pathogen similar to HIV-1 that utilizes CCR5 therefore driving its frequency upward in ancestral Caucasian populations (Table 1) [11].
Frequency of CCR5 delta 32 allele in 16 European populations was found to form a gradient from north to south with the highest frequency of the allele in Denmark and lowest in Corsica [7]. Prevalence of CCR5 delta 32 outside of Europe is extremely low and in many non-European ethnic groups it is completely absent [9].
Frequency of the CCR5 delta32 allele in populations, ranked in descending order of delta 32 frequency
Ethnic Group No. of Individuals Allele Frequency SD
Swedish 131 0.137 0.021
Russian 50 0.136 0.034
Estonian 158 0.133 0.019
Polish 30 0.133 0.044
Slovakian 30 0.133 0.044
Tatar 50 0.120 0.032
Australian 395 0.118 0.011
British 422 0.117 0.011
Irish 31 0.113 0.040
German 208 0.108 0.015
Czech 161 0.102 0.017
Spanish 56 0.098 0.028
Ashkenazi 503 0.097 0.009
Finn 195 0.091 0.015
French 230 0.089 0.013
Austrian 36 0.089 0.033
Danish 24 0.083 0.040
Albanian 73 0.082 0.023
Slovenian 110 0.077 0.018
Turkish 40 0.063 0.027
Italian 172 0.055 0.012
Azerbaijani 40 0.050 0.024
Bulgarian 29 0.045 0.027
Greek 160 0.044 0.011
Uzbek 29 0.034 0.024
Bulgarian Gypsy 47 0.032 0.018
Kazakh 50 0.030 0.017
Mexican 42 0.024 0.017
Uigur 45 0.022 0.016
Tuvinian 50 0.020 0.014
Georgian 50 0.00 0.00
Lebanese 51 0.00 0.00
Saudi 100 0.00 0.00
Cheyenne 100 0.00 0.00
Pima Indian 78 0.00 0.00
Pueblo Indian 100 0.00 0.00
Korean 50 0.00 0.00
Chinese 40 0.00 0.00
Distribution of allele frequencies of CCR5 delta 32 in Russia shows clinal variability from the north to the southeast, with the highest frequency in Pomors (Figure 1) [1]. Deletion of 32 base pairs of the C-C chemokine receptor type 5 was not detected in Yakut [2]. The prevalence of the CCR 5 delta 32 mutations in other ethnic groups of the Far North of Russia has not been previously determined.
objective
To determine the prevalence of the CCR5 delta 32 mutation in the population of the Nenets. Based on the previously conducted studies, prevalence of CCR5 delta 32 mutation was expected to be significantly lower than in Europeans populations.
Fig. 1. Decreasing prevalence of ccR5-delta32 mutation in Russian population [1]. Sign "Seyaka" indicates the position of sampling of material
MATERIALS AND METHODS
The materials for the study were 54 blood samples (dried on filter paper) of Tundra Nenets children living in boarding Seyaha village, Yamal-Nenets Autonomous District.
DNA was isolated using QIAamp Mini Kit (QIAGEN) according to the attached protocol. To identify deletions CCR5 delta32 used polymerase chain reaction with the flanking primers: CCR5-D32-F: 5XTTCATTACACCTGCAGTC3\ CCR5-D32-R: 5TGAAGATAAGCCTCACAGCC3' under the following conditions 95°-5'x1; [95°-15»^55°-15»^72°-60»]x40; 72°-10'x1^4°-ro; products of the reaction were separated on 2 % agarose gels for 1.5 hours; gel documentation was carried out using a Gel Doc XR Plus (Bio-Rad). As a result of PCR amplification are produced two fragments 196 bp — wild type and 164 bp — delta32 mutation (Figure 2).
RESULTS
CCR5 delta 32 mutation in heterozygous form was detected in 5 children, and homozygous mutations were not found at all. Therefore we found the prevalence of heterozygous form of CCR5 delta 32 mutation in Nenets population to be 9.3 %.
DISCUSSION/CONCLUSION
Prevalence of CCR5 delta32 mutation was expected to be significantly lower than among Europeans. However, the prevalence of the studied allele among Nenets living in the Yamal-Nenets Autonomous District, was close to the average prevalence among Europeans.
Nenets belong to the so-called "Samoyed" people (corrupted self-reference Saamoa) which is the same as Saami (formerly Lapps or Lapons) in Finland (Suomi — the Finnish name for Finland), or transliterated into English Samodi.
Saamoa speak the Samoyedic language which is a branch of the Uralic language family and it is known they moved from farther south in Siberia to the northernmost part of what later became Russia before the 12th century [12].
Fig. 2. Results of gel documentation of PCR
It is known that the allele CCR5 delta32 is rare in African, Asian, Middle Eastern, and American Indian populations, suggesting its recent origin [11]. It is assumed that high frequency of CCR5 delta32 mutation in Europe is a results of strong selection from bubonic plague (11). This hypothesis is popular in population genetic and medical literature, though quantitative assessment is absent. Three lines of evidence (predictions from a population genetic model, the geographical distribution of the allele, and the clinical effect of the deletion) indicate that the smallpox Variola major virus is a more likely candidate [13].
It is known that the population of people living in the northernmost part of Siberia declined tremendously after several outbreaks of smallpox [14], though little is known about the outbreaks of plague [14].
Our results support the hypothesis that the high frequency of the variant of this allele in European and in Yamal populations arose through strong selection from rather smallpox than from plague.
Acknowledgements
This study was supported by National Institutes of Health Grant 5UH1 HL03679-04 to SN and a grant from Rock Foundation, NYC, USA.
REFERENCES
1. Kofiadi I.A. Geneticheskaya ustoychivost' k zaraz-heniyu VICh i razvitiyu SPID v populyatsiyakh Rossii i sopredel'nykh gosudarstv [Genetic resistance to HIV infection and development of AIDS in populations of Russia and neighboring countries]. Avtoref. dis. na soisk. uch. st. kand. biol. nauk. M.; 2008. Available from: http:// www.dna-technology.ru/files/images/d/0b136b567d2 5d4be1dfa26a8b39ec2b9.pdf (accessed 18.09.2014).
2. Nikolaeva I. A., Maksimova N. R., Nikolaeva T. Ya., Puzyrev V. P. Deletsionnyy polimorfizm gena retsepto-ra khemokina 5 i risk razvitiya rasseyannogo skleroza v Yakutii [Deletion polymorphism in the gene for the receptor of the chemokine 5 and the risk of developing multiple sclerosis in Yakutia]. Yakutskiy meditsin-skiy zhurnal. 2007; 2 (18): 10-12.
3. Ghorban K., Dadmanesh M., Hassanshahi G., Mome-ni M., Zare-Bidaki M., Arababadi M. K., Kennedy D. Is the CCR5 A 32 mutation associated with immune system-related diseases? Inflammation. 2013; 36 (3): 633-42.
4. Hinks A., Martin P., Flynn E., Eyre S., Packham J. Childhood Arthritis Prospective Study (CAPS), UKRAG Consortium, BSPAR Study Group, Barton A., Worthington J., Thomson W. Association of the CCR5 gene with juvenile idiopathic arthritis. Genes Immun. 2010; 11 (7): 584-89.
5. Lee Y. H., Kim J. H., Song G. G. Chemokine receptor 5 A32 polymorphism and systemic lupus erythema-
tosus, vasculitis, and primary Sjogren's syndrome: Meta-analysis of possible associations. Z Rheumatol. 2014; Mar 7. Available from: http://link.springer.com/ article/10.1007 %2Fs00393-014-1356-5 (accessed 18.09.2014).
6. Limborska S.A., Balanovsky O. P., Balanovskaya E. V., Slominsky P. A., Schadrina M. I., Livshits L.A., Kravchen-ko S.A., Pampuha V. M., Khusnutdinova E. K., Spit-syn V.A. Analysis of CCR5Delta32 geographic distribution and its correlation with some climatic and geographic factors. Hum Hered. 2002; 53 (1): 49-54.
7. Lucotte G., Mercier G. Distribution of the CCR5 gene 32-bp deletion in Europe. J Acquir Immune Defic Syn-dr Hum Retrovirol. 1998; 19 (2): 174-77.
8. Novembre J., Galvani A. P., Slatkin M. The Geographic Spread of the CCR5 Д32 HIV-Resistance Allele PLoS Biol. 2005; 3 (11): e339.
9. Sabeti P. C., Walsh E., Schaffner S. F., Varilly P., Fry B., Hutcheson H. B., Cullen M., Mikkelsen T. S., Roy J., Patterson N., Cooper R., Reich D., Altshuler D., O'Brien S., Lander E. S. The case for selection at CCR5-Delta32. PLoS Biol. 2005; 3 (11): e378.
10. Song G. G., Kim J. H., Lee Y. H. The chemokine receptor 5 delta32 polymorphism and type 1 diabetes, Behcet's disease, and asthma: a meta-analysis. Immunol Invest. 2014; 43 (2): 123-36.
11. Stephens J. C., Reich D. E., Goldstein D. B., Shin H. D., Smith M. W., Carrington M., Winkler C., Huttley G. A., Allikmets R., Schriml L., Gerrard B., Malasky M., Ramos M. D., Morlot S., Tzetis M., Oddoux C., di Gio-vine F. S., Nasioulas G., Chandler D., Aseev M., Hanson M., Kalaydjieva L., Glavac D., Gasparini P., Kanavakis E., Claustres M., Kambouris M., Ostrer H., Duff G., Baranov V., Sibul H., Metspalu A., Goldman D., Martin N., Duffy D., Schmidtke J., Estiv-ill X., O'Brien S. J., Dean M. Dating the origin of the CCR5-Delta32 AIDS-resistance allele by the coalescence of haplotypes. Am J Hum Genet. 1998; 62 (6): 1507-1515.
12. Golovnev A. V., Osherenko G. Siberian survival. Nenets and their story. Cornel Univ. Press; 1999.
13. Galvany A. P., Slatkin M. Evaluating plague and smallpox as historical selective pressures for the CCR5-del-ta32 HIV-resistance allele. Proc Natl Acad Sci USA. 2003; 100 (25): 15276-279.
14. Forsyth J. A history of the peoples of Siberia: Russia's North Asian Colony 1581-1990. Cambridge University Press.; 1992.
распространенность мутации ccr5 delta32
среди тундровых ненцев ямала
Аммосова Т., Егоров А. С., Федорова Е. В., Аврусин С.Л.,
Сантимов А. В., Нехай С.
♦ Resume. CCR5 delta32 - генетический вариант CCR5, представляющий собой делецию 32 пар оснований, который приводит к нарушению адгезивных свойств кодируемого ею белка CCR5 Т-клеток. Предполагается, что эта мутация возникла примерно две с половиной тысячи лет назад и со временем распространилась в Европе. В гетерозиготном состоянии эта мутация сильно уменьшает шанс инфицирования клетки ВИЧ, в гомозиготном, по-видимому, приводит к полной невозможности инфицирования ВИЧ. Мутация CCR5 delta32 в гетерозиготном состоянии встречается в Европе с частотой 5-14 %. Встречаемость CCR5 delta32 за пределами Европы крайне мала, во многих неевропейских этнических группах она полностью отсутствует. Распространенность данной мутации в популяции ненцев ранее не исследовалась, предполагалось, что она должна быть ниже, чем у европейцев. Нами было проведено исследование 54 образцов крови ненцев, проживающих на территории Ямало-Ненецкого автономного округа. Для выделения ДНК использовался QIAamp DNA Mini Kit (QIAGEN) в соответствии с прилагаемым протоколом. С целью идентификации делеции CCR5 delta32 применялась полимеразная цепная реакция с применением праймеров: CCR5-D32-F: 5 * CTTCATTACACCTG CAGTC 3\ CCR5-D32-R: 5TGAAGATAAGCCTCACAGCC3' при следующих условиях: 95°-5'x1; 95°-15»^55°-15» ^72°-60»x40; 72°-10'x1 ^ 4°-продукты реакции были разделены в 2%-м агарозном геле в течение 1,5 часов; гель-документирование проводилось с помощью Gel Doc XR Plus (Bio-Rad, США). По результатам проведенного исследования распространённость исследуемой мутации среди ненцев составила 9,3 %. Таким образом, распространенность мутации CCR5 delta32 среди ненцев, проживающих в Ямало-Ненецком округе, соответствует ее распространенности у европейцев. Это может свидетельствовать о европейском происхождении ненцев.
♦ Key words: CCR5 delta32; ненцы; этнические группы. ЛИТЕРАТУРА
1. Кофиади И.А. Генетическая устойчивость к заражению ВИЧ и развитию СПИД в популяциях России и сопредельных государств. Автореф. дис. на соиск. уч. ст. канд. биол. наук. М.; 2008. Доступен по: http:// www. dna-technology. ru/files/images/d/0b136b567 d25d4be1dfa26a8b39ec2b9.pdf (дата обращения 18.09.2014).
2. Николаева И. А., Максимова Н. Р., Николаева Т. Я., Пузырев В. П. Делеционный полиморфизм гена рецептора хемокина 5 и риск развития рассеянного склероза в Якутии. Якутский медицинский журнал. 2007; 2 (18): 10-12.
3. Ghorban K., Dadmanesh M., Hassanshahi G., Mome-ni M., Zare-Bidaki M., Arababadi M. K., Kennedy D. Is the CCR5 A 32 mutation associated with immune
ОРИГИНАЛЬНЫЕ СТАТЬИ
69
system-related diseases? Inflammation. 2013; 36 (3): 633-42.
4. Hinks A., Martin P., Flynn E., Eyre S., Packham J. Childhood Arthritis Prospective Study (CAPS), UKRAG Consortium, BSPAR Study Group, Barton A., Worthington J., Thomson W. Association of the CCR5 gene with juvenile idiopathic arthritis. Genes Immun. 2010; 11 (7): 584-89.
5. Lee Y. H., Kim J. H., Song G. G. Chemokine receptor 5 Д32 polymorphism and systemic lupus erythematosus, vasculitis, and primary Sjogren's syndrome: Meta-analysis of possible associations. Z Rheumatol. 2014; Mar 7. Available from: http://link.springer.com/ article/10.1007 %2Fs00393-014-1356-5 (accessed 18.09.2014).
6. Limborska S. A., Balanovsky O. P., Balanovskaya E. V., Slominsky P.A., Schadrina M. I., Livshits L.A., Kravchen-ko S. A., Pampuha V. M., Khusnutdinova E. K., Spit-syn V.A. Analysis of CCR5Delta32 geographic distribution and its correlation with some climatic and geographic factors. Hum Hered. 2002; 53 (1): 49-54.
7. Lucotte G., Mercier G. Distribution of the CCR5 gene 32-bp deletion in Europe. J Acquir Immune Defic Syn-dr Hum Retrovirol. 1998; 19 (2): 174-77.
8. Novembre J., Galvani A. P., Slatkin M. The Geographic Spread of the CCR5 Д32 HIV-Resistance Allele PLoS Biol. 2005; 3 (11): e339.
9. Sabeti P. C., Walsh E., Schaffner S. F., Varilly P., Fry B., Hutcheson H. B., Cullen M., Mikkelsen T. S., Roy J., Pat-
♦ Информация об авторах
terson N., Cooper R., Reich D., Altshuler D., O'Brien S., Lander E. S. The case for selection at CCR5-Delta32. PLoS Biol. 2005; 3 (11): e378.
10. Song G. G., Kim J. H., Lee Y. H. The chemokine receptor 5 delta32 polymorphism and type 1 diabetes, Behcet's disease, and asthma: a meta-analysis. Immunol Invest. 2014; 43 (2): 123-36.
11. Stephens J. C., Reich D. E., Goldstein D. B., Shin H. D., Smith M. W., Carrington M., Winkler C., Huttley G.A., Allikmets R., Schriml L., Gerrard B., Malasky M., Ramos M. D., Morlot S., Tzetis M., Oddoux C., di Gio-vine F. S., Nasioulas G., Chandler D., Aseev M., Hanson M., Kalaydjieva L., Glavac D., Gasparini P., Kanavakis E., Claustres M., Kambouris M., Ostrer H., Duff G., Baranov V., Sibul H., Metspalu A., Goldman D., Martin N., Duffy D., Schmidtke J., Estiv-ill X., O'Brien S. J., Dean M. Dating the origin of the CCR5-Delta32 AIDS-resistance allele by the coalescence of haplotypes. Am J Hum Genet. 1998; 62 (6): 1507-1515.
12. Golovnev A. V., Osherenko G. Siberian survival. Nenets and their story. Cornel Univ. Press; 1999.
13. Galvany A. P., Slatkin M. Evaluating plague and smallpox as historical selective pressures for the CCR5-del-ta32 HIV-resistance allele. Proc Natl Acad Sci USA. 2003; 100 (25): 15276-279.
14. Forsyth J. A history of the peoples of Siberia: Russia's North Asian Colony 1581-1990. Cambridge University Press.; 1992.
Аммосова Татьяна — канд. мед. наук, научный сотрудник, Ammosova Tatyana — PhD, Assistant Research Professor, Howard
Центр серповидноклеточной анемии. Университет Говарда. University, College of Medicine. 2400 Sixth St NW, Washington,
2400 Sixth St NW, Washington, DC 20059, USA. DC 20059, USA. E-mail: tatiana.ammosova@howard.edu. E-mail: tatiana.ammosova@howard.edu.
Егоров Андрей Сергеевич — ассистент, кафедра госпитальной EgorovAndrey Sergeyevich — MD, Research Fellow, Chair of
педиатрии. ГБОУ ВПО СПбГПМУ Минздрава России. 194100, Hospital Pediatrics. Saint Petersburg State Pediatric Medical
Санкт-Петербург, ул. Литовская, д. 2. University. 2, Litovskaya St., St. Petersburg, 194100, Russia.
E-mail: egorov.doc@gmail.com. E-mail: egorov.doc@gmail.com.
Федорова Елена Владимировна — аспирант, кафедра госпи- Fedorova Elena Vladimirovna — MD, Research Fellow, Chair of
тальной педиатрии. ГБОУ ВПО СПбГПМУ Минздрава России. Hospital Pediatrics. Saint Petersburg State Pediatric Medical
194100, Санкт-Петербург, ул. Литовская, д. 2. University. 2, Litovskaya St., St. Petersburg, 194100, Russia.
E-mail: detymedic@mail.ru. E-mail: detymedic@mail.ru.
Аврусин Сергей Львович — канд. мед. наук, доцент, кафедра Avrusin Sergey Lvovich — MD, PhD, Associate Professor, Chair of
госпитальной педиатрии. ГБОУ ВПО «Санкт-Петербургский Hospital Pediatrics. Saint Petersburg State Pediatric Medical
государственный педиатрический медицинский университет» University. 2, Litovskaya St., St. Petersburg, 194100, Russia.
Минздрава России. 194100, Санкт-Петербург, ул. Литов- E-mail: avrusin4@gmail.com. ская, д. 2. E-mail: avrusin4@gmail.com.
Сантимов Андрей Вячеславович — аспирант, кафедра госпи- SantimovAndrey Vyacheslavovich — MD, Research Fellow, Chair
тальной педиатрии. ГБОУ ВПО СПбГПМУ Минздрава России. of Hospital Pediatrics. Saint Petersburg State Pediatric Medical
194100, Санкт-Петербург, ул. Литовская, д. 2. University. 2, Litovskaya St., St. Petersburg, 194100, Russia.
E-mail: a.santimoff@gmail.com. E-mail: a.santimoff@gmail.com.
Нехай Сергей — канд. физ. наук, доцент, Центр серповидно- NekhaiSergei — Ph.D., Director, RCMI Proteomics Core Faci-
клеточной анемии. Университет Говарда. 2400 Sixth St NW, lity, Associate Professor, Center for Sickle Cell Disease. Howard
Washington, DC 20059, USA. University, College of Medicine. 2400 Sixth St NW, Washington,
E-mail: snekhai@howard.edu. DC 20059, USA. E-mail: snekhai@howard.edu.