CC BY
24
ОРИГИНАЛЬРЫЕ ИССЛЕДОВАНИЯ
Распространенность серотипов вируса денге у пациентов с геморрагической лихорадкой денге в Пешаваре (Пакистан)
Рехман Ф.У.1, Кхан С.У.2, Кхан М.Т.3, Ахмед И.4, Кхан Х.У.2, Хассан Ф.У.5, Кхан З.6
1 Кафедра зоологии Высшего государственного научного колледжа Пешавара, 25000, г. Хайбер-Пахтунхва, Исламская Республика Пакистан
2 Кафедра зоологии Пешавар^ого университета, г. Пешавар, Исламская Республика Пакистан
3 Департамент лесного хозяйства и управления дикой природой, Университет Харипура, г. Харипур, Исламская Республика Пакистан
4 Совместная лаборатория врожденного иммунитета Китайской академии сельскохозяйственных наук и Мичиганского государственного университета, Ключевая лаборатория ветеринарной биотехнологии Китайской академии сельскохозяйственных наук, Харбинский институт ветеринарных исследований, 150069, г. Харбин, Китайская Народная Республика
5 Кафедра микробиологии Кохатского университета науки и технологий, 26000, г. Кохат, Исламская Республика Пакистан
6 Кафедра зоологии Университета Исламия-колледж, 25120, г. Пешавар, Исламская Республика Пакистан
По клиническому течению различают 2 формы лихорадки денге: лихорадочную форму - классическую (DF) и геморрагическую (DHF). Этиологическими агентами лихорадки денге являются 4 серотипа вируса денге (DENV): DENV1, DENV2, DENV3 и DENV4.
Цель исследования - определение ассоциации серотипов DENV с развитием геморрагической лихорадки денге в пакистанском округе Пешавар.
Материал и методы. У пациентов с DF/DHF отобрано 200 образцов крови. Все образцы были тестированы с помощью NS1 ELISA и признаны положительными. РНК возбудителя экстрагировали и затем преобразовывали в кДНК с помощью обратной транскриптазы Revert AID (Thermofisher scientific). Целевой для транскрипции и амплификации являлась область c-prM, которая была амплифицирована методом поли-меразной цепной реакции (ПЦР). Серотипы DENV (1-4) были идентифицированы с помощью вложенной ПЦР при использовании специфичных для серотипов праймеров (TS1, TS2, TS3 и TS4). Полученные образцы подвергали гель-электрофорезу и определяли размер продукта.
Результаты и обсуждение. 164 (82%) исследованных образца были признаны положительными как с помощью иммуноферментного анализа NS1, так и с помощью ПЦР в обратной транскрипции (ОТ-ПЦР), в то время как 36 (18%) образцов были отрицательными по результатам ОТ-ПЦР. В исследуемой когорте было 60% мужчин и 40% женщин. В группе больных с положительным результатом тестирования у 40 пациентов была установлена DHF, среди них 24 (15%) мужчины и 16 (10%) женщин. Возраст большинства пациентов этой группы варьировал от 10 до 30 лет. Все пациенты с DHF были первичными и не имели в анамнезе лихорадки денге. Во всех образцах крови больных DHF с использованием в тестировании серо-тип-специфичных праймеров был определен DENV2. Полученные результаты позволяют считать, что DENV2 был в первую очередь связан с развитием DHF.
Заключение. DENV2 является доминирующим серотипом у пациентов, пострадавших во время вспышки денге в Пешаваре.
Ключевые слова:
серотипы вируса денге; лихорадка денге; геморрагическая лихорадка денге; DENV2;
полимеразная цепная реакция в реальном времени; иммунофермент-ный анализ
Финансирование. Исследование не имело спонсорской поддержки. Конфликт интересов. Авторы заявляют об отсутствии конфликта интересов.
Вклад авторов. Разработка дизайна исследования, проведение опросов, сбор образцов, выполнение лабораторных работ и написание рукописи - Рехман Ф.У.; руководство исследованием и работой в лаборатории - Кхан С.У. и Ахмед И.; статистическая обработка данных - Хан М.Т.; проверка рукописи и помощь в сборе данных - Хассан Ф.У. и Хан Х.; редактирование, проверка грамматики - Хан З.
Для цитирования: Рехман Ф.У., Кхан С.У., Кхан М.Т., Ахмед И., Хассан Ф.У., Кхан Х., Кхан З. Распространенность серотипов вируса денге у пациентов с геморрагической лихорадкой денге в Пешаваре (Пакистан) // Инфекционные болезни: новости, мнения, обучение. 2023. Т. 12, № 2. С. 49-56. 001: https://doi.org/10.33029/2305-3496-2023-12-2-49-56 (англ.) Статья поступила в редакцию 16.12.2022. Принята в печать 28.03.2023.
Prevalence of dengue virus serotypes in dengue hemorrhagic fever patients of Peshawar, Pakistan
Rehman F.U.1, Khan S.U.2, Khan M.T.3, Ahmed I.4, Khan H.U.2, Hassan F.U.5, Khan Z.6
1 Department of Zoology, Government Superior Science College Peshawar, 25000, Khy-ber Pakhtunkhwa, Pakistan
2 Department of Zoology, University of Peshawar, Peshawar, Khyber Pakhtunkhwa, Pakistan
3 Department of Forestry and Wildlife management, University of Haripur, Pakistan
4 Harbin Veterinary Research Institute, CAAS- Michigan State University Joint Laboratory of Innate Immunity, state key Laboratory of Veterinary Biotechnology, Chinese academy of Agricultural sciences, 150069, Harbin, China
5 Department of Microbiology, Kohat University of Science and Technology, KP, Kohat, 26000, Pakistan
6 Department of Zoology, Islamia College Peshawar, Peshawar, Khyber Pakhtunkhwa, Pakistan
Dengue virus (DENV) is categorized into 4 serotypes: DENV1, DENV2, DENV3, and DENV4. The objective of this study is to determine the association of DENV serotypes with dengue hemorrhagic fever (DHF) in DHF patients of Peshawar district, Pakistan.
Material and methods. A total of 200 blood samples were collected from dengue fever (DF) and DHF patients. All of the samples were considered to be positive by NS1 ELISA. RNA was extracted and then converted into cDNA by using Revert AID Reverse transcriptase (Thermofisher scientific) the target region for transcription and Amplification is a c-prM region which was amplified by Regular PCR and by using Nested PCR, the DENV serotypes (1-4) was identified by using serotypes specific primers (TS1, TS2, TS3, and TS4) the samples was run through gel electrophoresis and then read the product size.
Results. 164 (82%) samples were considered to be positive by both NS1 ELISA and real-time-PCR while 36 (18%) were negative by real-time-PCR. The study population consists of 60% male and 40% female. Within positive samples, 40 patients have DHF of which 24 (15%) were male and 16 (10%) were females. Most of the affected patients have an age range between 10-30 years followed by 30-40 years. All of the DHF patients were primary patients and had no previous dengue fever history. By using Serotype-specific primers all the DHF samples were positive for Serotype-2 (DENV2). This shows that DENV2 was primarily associated with DHF.
Conclusion. DENV2 is considered to be prevalent serotype during dengue epidemic in District Peshawar, Khyberpakhtunkhwa, Pakistan.
Funding. The study had no sponsor support.
Conflict of interest. The authors have declared that there is no conflict of interests regarding the publication of this article. Contribution. Designed the study, carried out the surveys, collected samples, performed laboratory work and wrote the manuscript - Rehman F.U.; supervised surveys and laboratory work - Khan S.U. and Ahmed I.; analysed data statistically -Khan M.T.; reviewed the manuscript and facilitated in Data Collection - Hassan F.U., Khan H.; corrected the language, grammar of the article - Khan Z.
For citation: Rehman F.U., Khan S.U., Khan M.T., Ahmed I., Hassan F.U., Khan H., Khan Z. Prevalence of dengue virus serotypes in dengue hemorrhagic fever patients of Peshawar, Pakistan. Infektsionnye bolezni: novosti, mneniya, obuchenie [Infectious Diseases: News, Opinions, Training]. 2023; 12 (2): 49-56. DOI: https://doi.org/10.33029/2305-3496-2023-12-2-49-56 Received 16.12.2022. Accepted 28.03.2023.
Keywords:
dengue virus serotypes; dengue fever; dengue hemorrhagic fever; DENV2; real-time-PCR; ELISA
Dengue is the most critical medical problem in tropical and sub-tropical regions of the world transmitted by the bite of the mosquito Aedes aegypti [1, 2]. Dengue virus (DENV) is the causative agent of dengue infection. DENV belongs to the genus Flavivirus within the family Flaviviridae. The virion of DENV is enveloped which contains positive-sense
single-stranded RNA with a length of 11 kilobase pair [3]. On the basis of differences in the nucleotide sequence, DENV is categorized into 4 serotypes: DENV1, DENV2, DENV3, DENV4, and ten genotypes. All of these four serotypes circulate globally with usually high prevalence in the most endemic countries for dengue viruses [4].
Fig. 1. Prevalence of dengue fever in various districts are replaced by Localities of study area
1 - Peshawar Saddar-GT Road associated areas; 2 - Peshawar University Road and Khyber Teaching Hospital (KTH); 3 - Ring Road Peshawar and associated areas; 4 - Bara Road Peshawar and associated areas; 5 - Kohat Road Peshawar and associated areas.
Dengue infection is normally asymptomatic with a mild flu-like syndrome also known as Dengue fever (DF). However, its clinical manifestation can extend from a self-restricting DF to extreme dengue hemorrhagic fever (DHF) and genuine dengue shock disorder (DSS) [5, 6]. DF is described by early elevation in body temperature followed by late cephalalgia, muscle pain (myalgia), pain in the eye is replaced by retro-orbital pain, and rashes on the skin [7]. Convalesce from the infection occurs within 1-2 weeks and prolonged asthenia for an extended period usually is observed. Platelets and white blood cell count diminish habitually perceive [8]. Under certain conditions, DF leads to a DHF followed by a transitory increment in the permeability of blood vessels bringing about seepage of plasma with hyperthermia, drain, haemoconcentration, and thrombocytopenia which can prompt DSS [1].
Transformation of DF to DHF normally occurs in patients with previous DF history due to the phenomenon of antibody-dependent enhancement (ADE). During ADE in a patient, antibodies are already circulating against the previous DENV serotype which binds to the epitopic region of the heterologous DENV serotype and hence eases the virus entry to the cells bearing "Fc" receptor. Similar mechanism also occurs during primary infection in newborns of dengue immune mother [9, 10].
The expansion of dengue virus serotypes has increased the risk of severe infection including many secondary infections, resulting in an increase in dengue disease epidemics. The overall worldwide incidence of dengue disease is 50-100 million and 250,000-500,000 cases of DHF annually. The mortality rate of DHF/DSS is 5-10%. Both males and females are affected by dengue disease however males are more affected as compared to females [11].
Since there is no particular treatment for dengue infection precautionary procedures rely on vector control and individual assurance measures, which are hard to authorize and keep up, and are costly. The most excellent strategy for anticipation is the production of a safe and effective vaccine which works again all the DENV infection-causing serotypes. Such an improvement is an earnest need, specifically for kids living in endemic regions [12]. In July 2017 dengue epidemics occurred in Khyber Pak-htunkhwa province which affects more than 15 districts of the province while more than 500 DENV-positive cases were reported as per government sources there were around 75,000 suspected cases, more than 24,382 cased found confirmed/positive. Death toll due to Dengue is 73 till date. The majority of the positive cases were reported in Peshawar city [13]. The serotypes responsible for such cases were not yet analyzed. Therefore, this study aims to determine DENV serotypes in DHF patients attending the tertiary care hospital of Peshawar city.
Table 1. Primers used in the study
D1 Forward Primer 3'TTGCACCAACAGTCAATGTCTTCAGGTTC'5 511 bp
D2 Reverse primer 5'TCAATATGCTGAAACGCGCGAGAAACCG'3
Serotypes Specific primers
TS1 5' CGTCTCAGTGATCCGGGGG 3' 482bp
TS2 5' CGCCACAAGGCCATG AACA 3' 119bp
TS3 5' TAACATCATCATGAGACAGAGC 3' 290bp
TS4 5' CTCTGTTGTCTTAAACAAGAGA 3' 392bp
Material and methods
Patients
This study was conducted in Different Dengue affected areas and in the Khyber teaching hospital of Peshawar district, Khyber Pakhtunkhwa Pakistan. A total of 200 Dengue Positive Samples of various Localities of Peshawar district were included in this study as shown in Fig. 1.
Sample collection
A total of 200 blood samples were collected from susceptible patients of the study area which138 samples were collected from Khyber teaching hospital (KTH) and 62 were collected from the various study regions. Patients with signs and symptoms such as cephalalgia, myalgia, temperature, arthralgia, hyperthermia, skin rash, abdominal pain, vomiting, and retro orbicular pain were selected for blood sample collection. Voluntary informed consent was taken from each infected individual in the study. A well-prepared questionnaire was used to gather medical plus demographic data of every patient in the study population. The patient's basic history including the person's name, sex, gender, disease, signs and symptoms, and previous history of DENV, etc. was collected in the form of questionnaires.
Blood sample, 3 mL, was collected in a sterilized syringe from patients with Dengue Fever, DHF, and DSS. After sample collection serum was separated from blood at 2500 rpm for 10 minutes and was kept at -20 °C for further analysis.
Table 2. Diagnosis of dengue virus infection by NS1 ELISA and real-time-PCR in study population
NS1+
PCR+ 164 (82%)
PCR- 36 (18%)
Total 200 (100%)
Table 3. Prevalence of DENV serotypes among dengue infected patients of study population
Gender Total patients DENV2 detected DENV2 non detected
Male 120 100 20
Female 80 64 16
Total 200 164 36
Serological assay
Enzyme-linked immune sorbent assay (ELISA) was used to detect IgG (Anti DENV-IgG kit and IgM [(Anti DENV-IgG kit and IgM kit (Scientific Diagnostic Korea) against DENV in the blood serum of Dengue Patients as per manufacturer protocol.
RNA extraction
RNA was extracted using 100|_il of serum sample with an RNA kit (TRIzol, USA) using the protocol from manufacturer.
DENV Serotyping
The extracted RNA was then converted into cDNA by using Revert AID Reverse transcriptase (Thermofisher scientific) the target region for transcription and amplification is a C-prM region which was amplified by regular PCR and by using nested PCR the DENV serotypes (1-4) (Thermofisher scientific) was identified by using serotypes specific primers as shown in Table 1.
Gel electrophoresis
The amplified DNA of nested PCR was run in 2% agarose gel prepared in 100 ml of 0.5x buffers (Tris-Cl, Boric Acid EDTA) and 15 |l ethidium bromides. Loading dye (3|l) was mixed with nested PCR products and run in Agarose gel, 100 bp (Fermentas, USA) DNA ladder marker (10 |l) was also laded parallel to the samples and was run for 30 minutes. DNA bands were become visible and compared by DNA ladder marker, and then visualized under UV trans illuminator (Cell Bioscience, Taiwan).
Statistical analysis
The two-way ANOVA is performed to analyze the effect of the category of infection and serotype for gender and age groups. The ANOVA revealed that there is not a statistically significant interaction between the effect of the category of infection and serotype p=0.077. The other two-way ANOVA is performed to analyze the positivity effect and serotype with gender. The ANOVA revealed that there is not a statistically significant interaction between the effect of Positivity and serotype p=0.27.
Results
Diagnosis of dengue virus infection by NS1 ELISA and realtime PCR in the study population
A total of 200 blood samples were collected from DF/DHF patients. Two types of diagnostic procedures were performed for the detection of the virus (NS1 ELISA and real-time PCR) and compared the result. All of the samples were considered to be positive by NS1 ELISA and a total of 164 blood samples were positive by both NS1 ELISA and real-time PCR. The use of NS1 ELISA is arguably an appropriate and reliable method for early diagnosis in a laboratory setting where the facility of real-time PCR is not available. However, for well-equipped laboratories, the use of real-time PCR is a rapid, sensitive, and suitable diagnostic test that cannot only detect viral RNA but also specify the viral serotypes at the same time (Table 2).
Prevalence of serotypes among dengue-infected patients of the study population of DF patients
For the detection of viral RNA, all serum samples were run through real-time PCR. A total of 164 (18%) samples were considered to be DENV positive by real-time PCR while 36 (18%) samples were RNA negative. To find out DENV serotypes all the positive samples were analyzed through regular PCR by using serotypes-specific primers. Only the DENV2 serotype was detected among positive samples. The prevalence of the DENV2 serotype was highest in males (n=100) as compared to females (n=64) as shown in Table 3.
Prevalence of serotypes among DHF patients of the study population
Similarly, among positive samples, 40 blood samples were collected from patients with DHF including 24 males and 16 females. Among DHF patient's prevalence of DENV2 is highest in males as compared to female patients (Fig. 2).
180 160 140 120 100 80 60 40 20 0
Males
40
40
Females
I I
24
16
Total no Total DENV2 Gender of DF DHF detected patients patients
Fig. 2. Prevalence of serotypes among DHF patients of study population
Overall age-wise prevalence of DENV serotype among patients of the study population
To determine the prevalence of DENV serotypes and their correlation with primary DHF different age groups were created such as <10 years, 11-20, 21-30, 31-40, 41-50, and >51 years. The entire 164 (82%) sample was positive for the DENV2 serotype, 40 of which were suffering from DHF. The numbers of male patients were more than female patients. All of the age groups from <10 years to >51 years were infected with the DENV2 serotype. Most males and females belonging to age groups 11-30 followed by 31-40 were affected by DENV2.
Similarly, among DHF patients 2 (5%) were <10 years. Other infected DHF patients were showing the following results: 10
(25%), 9 (22%), 8 (20%), 6 (15%), 3 (8%), 2 (5%) in the age group 11-20, 21-30, 31-40, 41-50 , and >50 years respectively.
Out of total 40 most of DHF positive patients were male (60%) while (40%) were female (Table 4 and Fig. 3).
Clinical features of dengue-infected individuals
Common symptoms in both DF/DHF patients observed during the study period in the following ratio: fever (100%), headache (92/95%), body and joint pain (92/100%), nausea (85/70%), vomiting (56/80%), retro-orbital pain (69/62%), fatigue (93/97%), skin rash (15/100%), while 12% DHF patients have pleural effusion and ascites (Fig. 4).
%
100 и
9080706050403020100
100
DF, % DHF, %
Fig. 3. Age wise prevalence of DENV2 serotype in DF and DHF patients
Table 4. Age wise prevalence of DENV2 serotype in DF and DHF patients
Age groups, years Gender 1 DF DHF
<10 Male 2 1
Female 2 1
11-20 Male 24 6
Female 16 4
21-30 Male 25 5
Female 17 4
31-40 Male 15 5
Female 10 3
41-50 Male 17 4
Female 11 2
>51 Male 17 3
Female В 2
Male 100 24
Total Female 64 16
164 40
Discussion
During the Last decades, epidemics of DHF have occurred in Pakistan, India, Bangladesh, China, SriLanka, and Maldives. ALL four serotypes of Dengue cause similar types of infections but DENV2 and DENV3 are more often associated with severe and fatal DHF [14]. In the current study, we analyzed the
association of the DENV serotype which is responsible for the most severe DHF in the recent epidemic of dengue in Peshawar district, Pakistan. According to the present study, most of the DF cases and few DHF and DSS cases were reported in the months of October and November followed by December. It was reported earlier that the ratio of male patients was higher in all age groups as compared to females because females mostly stayed inside the house as well as properly covered their bodies and hence were less prone to vector bite [2, 15].
Demographic data analysis showed that the infection rate in males was double the rate in females, with a male-to-female ratio of 2:1, an observation that corresponds with previous results from studies of the Khyber Pakhtunkhwa province [7]. In the present study, a total of 200 blood samples were collected from susceptible patients in the study area. The ratio of male patients including DF and DHF were more as compared to female patients, similarly, patients in the age groups between 11-30 years followed by 31-40 years of age people were mostly affected by DHF. Most of the male which have DHF either are students or servants who were exposed to different environments. Another reason is that most of the people in affected localities belong to middle-class or poor families which can travel by local transport remove the highlighted terms similarly during summer the males and children sleep without wearing shirts making them easy targets for vector bites [3].
Ascite Pleural effusion Skin rash Retro orbital pain Vomiting Nusea Fatigue Headach Body ache + joint pain Fever
100
DHF, % DF, %
97
100
100 100
20 40 60 80
Numbers of Dengue positive patients (NS1 ELISA + RT-PCR)
100 %
Fig. 4. Clinical features of dengue infected individuals
Lack of awareness about vector prevalence is also a factor removed the highlighted term in the affected area mostly use room cooler therefore the water remains present for many days without changing it. During 2013 and 2015, in severe dengue outbreaks in district Mansehra and Swat district of Khyber Pak-htunkhwa, Pakistan, the majority of deaths were reported due to DHF where DENV variants analyzed were closely related to strains previously detected from Lahore and Karachi [1]. In previous Dengue epidemics in Pakistan from 1994-2017, the most prevalent serotype was DENV2. Similarly, during the 2015 dengue epidemics, dengue cases were reported continuously from adjacent districts including Kohat, Mansehra, and Malakand, also sporadic cases were reported from districts Shangla, Lower Dir, and Upper Dir which is nearby to the district Swat [16]. All four serotypes (DENV1, DENV2, DENV3, and DENV4) cause DF but the most prevalent worldwide serotypes are DENV2 and DENV3.
In the current study, DENV2 was the predominant serotype found circulating in the dengue outbreak in Pakistan which is consistent with the previous studies. real-time-PCR analysis shows that out of 200 positive cases, 164 samples were positive for DENV2. While peoples from previously affected areas of Khyber Pakhtunkhwa (Malakand, Kohat, Charsadda, Swat, Dir) are attached to the Peshawar district, Charsadda and Kohat districts are nearby to the Peshawar, both districts were affected by DENV2 and DENV3 epidemics during 2013 and 2015, it was possible that dengue vectors extension of current epidemics has linked to previously affected districts. In the current study it is analyzed that such comparison between dengue serotypes of the previously affected area and the current study area shows that the serotypes were not completely eradicated from the Khyber Pakhtunkhwa, and also there is no preventive measurement for mosquito control hence the serotypes are still circulated in the region hence affect peoples of Peshawar which is capital of province city and a central region which connect peoples of the surrounded area particularly previously affected regions in every aspect.
It was previously known that secondary DENV infection happening in the region which is endemic to DENV or areas affected by more than one serotype at a time which corresponds to a major public health risk and is also associated with the progression of disease from DF to DHF and DSS [13]. In the current study, we found DENV2 to be the predominant serotype involved in the dengue outbreaks in Peshawar in contrast to Suleiman et al. [1]. Moreover, all patients with DHF were associated with DENV2 removed the highlighted term supporting that DENV2 is also primarily associated with fatal DHF. The change in temperature and humidity (ecological conditions) plays a significant role in the survival/breeding of vector mosquitoes and their population density. A more recent study [17], has shown that higher temperature (>25 °C) produces a large number of mosquitoes with frequent blood-feeding nature.
АВТОР ДЛЯ КОРРЕСПОНДЕНЦИИ
Also, it is documented that a 1 °C increase in temperature (above average) may increase the risk of dengue transmission by 1.95 times [17-20].
In our study, there was seen a peak in DF and DHF hospitalization during September-October and November which may be directly related to overcrowding population, and the increase in temperature and humidity. Peshawar is mostly affected because of increased population, trading (tires, room coolers, etc.), and peoples suffered from the heat mostly use room coolers and there is sanitation problems as well in the city and hence environment is suitable for vector breeding. Dengue cases also continue to be reported from many neighboring areas like Charsadda, Mardan, Sawabi, and Khyber agencies where data collected from dengue-positive patients shows that dengue is spreading from Peshawar. The affected areas also has problems with sanitation, resulting in the accumulation of water from sewages, rain, etc., and continuous use of room coolers.
Conclusion
DENV2 was responsible for the Dengue outbreak in Peshawar. According to the questionnaire and Patients History, all the samples were taken from the patients in Peshawar district affected regions. The result shows that the dominant serotype was DENV2 and also primarily associated with DHF in Dengue epidemics in Peshawar. The research is funded by the University of Peshawar, Pakistan.
Acknowledgment. This study was conducted by a University of Peshawar researcher. We thank all the doctors and nursing staff of the concerned hospital for providing access to the patients and helping us with data collection. The results organized during this research are the private views of the author. The research is funded by the University of Peshawar, Pakistan.
Statement of novelty. The study is based on a new idea and its main goal is to find out which serotype is primarily responsible for "dengue hemorrhagic fever" (DHF) among dengue patients. Similarly, Peshawar (area of study) has also experienced many dengue epidemics in the past, but there is no evidence of which dengue serotypes cause the severity of dengue infections. In the present manuscript, some serotypes will be associated with severe dengue infection such as DHF.
Statement of Human Rights. Studies have been approved by the University of Peshawar research ethics committee and have been performed in accordance with the ethical standards as laid down in the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards.
Ethical approval. All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.
Рехман Фаиз Ур (Faiz Ur Rehman) - кафедра зоологии Высшего государственного научного колледжа Пешавара, Хайбер-Пахтунхва, Исламская Республика Пакистан E-mail: faiz02140@gmail.com https://orcid.org/0000-0001-5970-9346
CORRESPONDING AUTHOR
Faiz Ur Rehman - Department of Zoology, Government Superior Science College Peshawar, Khyber Pakhtunkhwa, Pakistan
E-mail: faiz02140@gmail.com
https://orcid.org/0000-0001-5970-9346
ЛИТЕРАТУРА/REFERENCES
1. Suleman M., Faryal R., Aamir U.B., Alam M.M., Nisar N., Sharif S., et al. Dengue outbreak in Swat and Mansehra, Pakistan 2013: An epidemiological and diagnostic perspective. Asian Pac J Trop Med. 2016; 9 (4): 380-4. DOI: https://doi. org/10.1016/j.apjtm.2016.03.010
2. Qamash T., Jamil J., Khan F.A., Sultan A., Begum N., Din S.U. Epidemiological study of dengue fever in District Swabi, Khyber Pakhtunkhwa, Pakistan. Braz J Biol. 2020; 81: 237-40. DOI: https://doi.org/10.1590/1519-6984.216284
3. Khan M.M., Khan H. Dengue fever in Pakistan: what to do now? Gomal J Med Sci. 2015; 13 (4): 197-8.
4. Tahir Z., Hafeez S., Chaudhry A.S. Spatial and seasonal variation of dengue fever in Lahore 2008. Biomedica. 2010; 26: 166-72.
5. URL: https://pesquisa.bvsalud.org/portal/resource/pt/emr-104029
6. Khan E., Kisat M., Khan N., Nasir A., Ayub S., Hasan R. Demographic and clinical features of dengue fever in Pakistan from 2003-2007: A retrospective cross-sectional study. PLoS One. 2010; 5 (9): e12505. DOI: https://doi.org/10.1371/ journal.pone.0012505
7. Messina J.P., Brady O.J., Scott T.W., Zou C., Pigott D.M., Duda K.A., et al. Global spread of dengue virus types: mapping the 70 year history. Trends Microbiol. 2014; 22 (3): 138-46. DOI: https://doi.org/10.1016/j.tim.2013.12.011
8. Jelinek T., Mühlberger N., Harms G., Corachan M., Grobusch M.P., Knobloch J., et al. Epidemiology and clinical features of imported dengue fever in Europe: Sentinel surveillance data from TropNetEurop. Clin Infect Dis. 2002; 35 (9): 1047-52. DOI: https://doi.org/10.1086/342906
9. Harapan H., Michie A., Mudatsir M., Sasmono R.T., Imrie A. Epidemiology of dengue hemorrhagic fever in Indonesia: Analysis of five decades data from the National Disease Surveillance. BMC Res Notes. 2019; 12 (1): 1-6.
10. Shahid M., Amin I., Afzal S., Fatima Z., Zahid S., Ashraf U., et al. Prevalence and molecular detection of dengue virus in 2013 outbreak in KPK and Punjab, Pakistan. Pak J Zool. 2017; 49 (3): 1119-22. DOI: https://doi.org/10.17582/journal. pjz/2017.49.3.sc4
11. Ali A., Ur Rehman H., Nisar M., Rafique S., Ali S., Hussain A., et al. Seroepi-demiology of dengue fever in Khyber Pakhtunkhawa, Pakistan. Int J Infect Di. 2013; 17 (7): e518-23. DOI: https://doi.org/10.1016/j.ijid.2013.01.007
12. Halstead S.B., Suaya J.A., Shepard D.S. The burden of dengue infection. Lancet. 2007; 369 (9571): 1410-1. DOI: https://doi.org/10.1016/ S0140-6736(07)60645-X
13. Mehmood A., Khan F.K., Chaudhry A., Hussain Z., Laghari M.A., Shah I., et al. Risk factors associated with a dengue fever outbreak in Islamabad, Pakistan: Case-control study. JMIR Public Health and Surveillance. 2021; 7 (12): e27266.
14. Atif M., Raheel U., Alam F., Arshad H.U., Baloch F., Imran M., et al. Serotyping of dengue virus from deadly outbreaks of Pakistan. J Hum Virol Retrovirol. 2016; 3 (3): e00092.
15. Mahmood N., Rana M.Y., Qureshi Z., Mujtaba G., Shaukat U. Prevalence and molecular characterization of dengue viruses serotypes in 2010 epidemic. Am J Med Sci. 2012; 343 (1): 61-4. DOI: 10.1097/MAJ.0b013e3182217001
16. Khan M.A., Ellis E.M., Tissera H.A., Alvi M.Y., Rahman F.F., Masud F., et al. Emergence and diversification of dengue 2 cosmopolitan genotype in Pakistan, 2011. PLoS One. 2013; 8 (3): e56391. DOI: https://doi.org/10.1371/journal. pone.0056391
17. World Health Organization. Dengue and Severe Dengue - Fact Sheet Updated on April 2017.
18. Khalid B., Ghaffar A. Dengue transmission based on urban environmental gradients in different cities of Pakistan. Int J Biometeorol. 2015; 59 (3): 267-83. DOI: https://doi.org/10.1007/s00484-014-0840-6
19. Gebhard L.G., Filomatori C.V., Gamarnik A.V. Functional RNA elements in the dengue virus genome. Viruses. 2011; 3 (9): 1739-56. DOI: https://doi.org/10.3390/ v3091739
20. Ali L., Gul Z., Ijaz A., Khalid N., Zeb F., Afzal S., et al. An overview of dengue viral infection circulating in Pakistan. J Vector Borne Dis. 2022; 59 (2): 109-14. DOI: https://doi.org/10.4103/0972-9062.331412
