CC BY
19
Ukrainian Journal of Ecology
Ukrainian Journal of Ecology, 2020, 10 (2), 177-183, doi: 10.15421/2020_82
ORIGINAL ARTICLE UDC582.394.72
Phylogeny of the North Asian Cystopteridaceae (Polypodiopsida) based on trnG-R intergenic spacer
I.I. Gureyeva1'2*, D.O. Ulko1**, R.S. Romanets1, A.A. Kuznetsov1
1 Tomsk State University, Lenina ave. 36, 634050, Tomsk, Russia 2Tomsk Oil and Gas Design and Research Institute, Mira ave. 72, 634027, Tomsk, Russia Corresponding author E-mail: gureyeva@yandex.ru*, ulko.den@gmail.com**
Received: 10.03.2020. Accepted: 26.04.2020
The molecular phylogenetic analysis of the Cystopteridaceae family based on sequencing of the plastid DNA intergenic spacer trnG-R is carried out. The dataset includes sequences mainly of North Asian samples of both widerspread species and species described from the former USSR and modern Russia. The use of trnG-R intergenic spacer showed more comprehensive results for Gymnocarpium, than for Cystopteris. Gymnocarpium phylogeny includes four well-supported clades: the dryopterisclade, the robertianum clade, the continentale clade, and the jessoense clade. Data from trnG-R support the divergence between species with glabrous fronds (G. dryopteris) and species with glandular-pubescent fronds. Among species having glandular-pubescent fronds, the robertianum clade is a sister to the remaining ones. Gymnocarpium fedtschenkoanum is more related to G. robertianum, than other glandular species. Our data confirmed the recognition of Gymnocarpium continentale and G. jessoense as distinct species. The topology of G. tenuipes has remained uncertain. Among Cystopteris species three highly supported clades are indicated: the montana clade, the sudetica clade and the Cystopteris fragliis complex. C. montana and C. sudetica occupy the clearest position in the phylogenetic tree. The topology of C. montana as sister to the remainder of the genus, and then the placement of C. sudetica as sister to the C. fraglis complex does not allow C. montana to be included together with C. sudetica in the same supraspecific taxon but allows to accept the genus Rhizomatopteris as distinct monotypic genus containing a single species - Rh. montana. Relationships among the taxa of C. fraglis complex including the species described from North Asia remain uncertain.
Key words: Cystopteris, Gymnocarpium, Cystopteridaceae; Plastid DNA; trnG-R intergenic spacer; Phylogeny
Introduction
Cystopteris Bernh. and Gymnocarpium Newman are both the members of the fern family Cystopteridaceae (Payer) Shmakov, which was first treated as a separate family by A. I. Shmakov (2001), who included in it about 60 species. The family status was accepted and circumscription by M. J. M. Christenhusz et al. (2011), and they recognize 30 species in the family. Subsequent molecular phylogenetic studies provided by C. Rothfels et al. (2012, 2013, 2014) have yielded a clear understanding of this family, which led to the recircumscription of the Cystopteridaceae. In the modern sense, Cystopteridaceae includes of four genera and about 38 species: Acystopteris Nakai - 3 species, Cystoathyrium Ching - 1 species, Gymnocarpium (including Currania Copel.) - 7 species, and Cystopteris (including Rhizomatopteris A. P. Khokhr.) - about 27 species (Rothfels et al., 2013).
Thus, the genera Cystopteris and Gymnocarpium are the largest genera in this family. Many taxonomists have expressed the complexity of the intrageneric taxonomy of Cystopteris and Gymnocarpium. As noted by V. N. Siplivinsky (1973: 353), "Difficulties in recognizing of Siberian Gymnocarpium are inversely related to their species diversity". Opinion regarding Cystopteris is that the Cystopteris fraglis complex represents "perhaps the most formidable biosystematics problem in the ferns" (Lovis, 1978: 356). The molecular phylogenetic study of Cystopteridaceae by C. Rothfels et al. (2013) based on a three-locus plastid dataset (matK, rbcL, trnG-R) included multiple accessions of the most species from across their geographic ranges. Authors of that study have established, that all represented genera are supported as monophyletic, the Gymnocarpium is deeply divided into three major clades labeled the disjunctum clade, the robertianum clade, and core Gymnocarpium. Cystopteris features four deeply diverged clades: C. montana, the sudetica clade, the buibffera clade, and the C. fraglis complex. Only two accessions in the dataset by C. Rothfels et al. (2013) originate from Russia. These accessions represent two species - Cystopteris sudetica A. Braun et Milde and Gymnocarpium jessoense (Koidz.) Koidz. subsp. parvuium Sarvela. C. Rothfels et al. (2013) did not involve several species of Cystopteridaceae described from the territory of the former USSR as well as accessions of widespread species from Russia in their study. Six species of Cystopteridaceae were described from the territory of the former USSR; these are Gymnocarpium continentale (Petrov) Pojark., G. fedtschenkoanum Pojark., G. tenuipes Pojark. ex Shmakov, Cystopteris aimaatensis Kotukh., C. altajensis Gureeva, and C. gureevae Stepanov. V. A. Petrov (1930) described Gymnocarpium continentale from Yakutia (Russia) as Dryopteris pulchella (Salisb.) Hayek var. continentals Petrov, and later A. V. Pojarkova (1950) included it in the genus Gymnocarpium. A. V. Pojarkova (1950) described Gymnocarpium fedtschenkoanum and G. tenuipes from different parts of Central Asia. Protolog of G. fedtschenkoanum was published by A. V. Pojarkova (1950) in Latin in compliance with the rules of the botanical nomenclature, the description of G. tenuipes was represented in the same publication only in Russian. A. I. Shmakov validated it in 1995 (Shmakov, 1995). Gymnocarpium fedtschenkoanum was described from the Hissar Ridge, Tajikistan and considered as endemic for Central Asia (Pamir-Alay, Tianshan, northwest Himalayas). Gymnocarpium tenuipes mentioned by A. V. Pojarkova (1950) as an endemic of the Kazakh Uplands, Central Kazakhstan. Afterwards, A. I. Shmakov (1995) indicated it for the Russian Altai. Cystopteris aimaatensis was described from Zailiisky Alatau, Kazakhstan (Kotukhov, 1966). Latter, this species were found in the Russian Altai (Gureyeva et al., 2015), furthermore, as the authors know on the herbarium collections from LE, MW, and TK, it
occurs also in the mountains of Northern Kyrgyzstan and Tajik Pamir. Cystopteris altajensis was described from the Russian Altai (Gureyeva, 1985); its geographic range covers the Altai-Sayan mountain system. And finally, Cystopteris gureevae is described recently from Western Sayan (South Siberia, Russia) and is still known only from locations indicated in protolog (Stepanov, 2015). The aim of this study is the molecular phylogenetic analysis of plastid DNA locus trnG-R of the most species of the Cystopteridaceae occurred in North Asia, including species, described from the territory of the former USSR.
Materials and Methods
Phylogenetic analysis was provided on the base of the sequencing of the intergenic spacer of plastid DNA trnG-R which was used in the study by C. Rothfels et al. (2013). The most of the fern samples were collected in natural populations mainly in South Siberia on the Western Sayan (2015, I. I. Gureyeva, A. A. Kuznetsov, N. V. Stepanov) and Kuznetsk Alatau (2016, I. I. Gureyeva, D. O. Ulko, R. S. Romanets), samples outside Russia were collected by I. I. Gureyeva (Fig. 1). Vouchers are stored in the Herbarium of Tomsk State University (TK). Plastid DNA was extracted from silica-dried material or herbarium specimens using the protocol of the manufacturer of DNA isolation kits or by the standard CTAB method (Rogers & Bendich, 1989). The quality and quantity of DNA were checked on the Implen P330 spectrophotometer. To obtain comparable results, the amplification of chloroplast DNA locus trnG-R was carried out with the same primers used by C. Rothfels et al. (2013) (Table 1 and Figure 1).
Figure 1. Some species of the family Cystopteridaceae. A - Cystopteris aitajensis (Russia, Kuznetsk Alatau, near Tunguzhul village); B - Cystopteris gureevae (Russia, Western Sayan, Malyi Kebezh River); C - Cystopteris aipina (Austria, Arlberg, Formarinsee); D - Gymnocarpium continentale (Russia, basin of Podkamennaya Tunguska River, mouth of Lakura River). Photos by I. I. Gureyeva (A-C) and Yu. G. Raiskaya (D).
Table 1. Primers used for trnG-R amplifications of the Cystopteridaceae members.
Locus Direction Sequence (5'-3') References
trnG-R F GCGGGIAIAGI IIAGIGGIAA Nagalingum et al. (2007)
trnG-R F GCTAYACGACCAARACGTAAGC Rothfels et al. (2013)
trnG-R R GTGGCATCCATAAAATCYATGTCAG Rothfels et al. (2013)
trnG-R R CTATCCATTAGACGATGGACG Nagalingum et al. (2007)
Loci were amplified in 15 ^l reactions consisting of 2 ^l of DNA, 1 ^l of each primer (10 ^M), 1.5 PCR buffer, 1.6 ^l of MgCl2, 0.12 ^l of dNTP, 0.2 ^l of taq polymerase and 7.58 ^l of DI water. The PCR reaction was carried out using S1000 Thermal CyclerTM (BIO-RAD) and the thermal cycling program consisted of an initial denaturation step (94°C for 3 min), 35 denaturation, annealing, and elongation cycles (94°C for 45 sec, 50°C for 30 sec, 72°C for 1.5 min), and a final elongation step (72°C for 10 min). The obtained amplification was checked for the presence of the target fragment by electrophoresis in 1.5% agarose gel stained with ethidium bromide. After confirming the target fragment for all samples, the purification procedure was carried out: PCR product was treated with a mixture of exonuclease I (to remove dNTP) and shrimp alkaline phosphatase (to inactivate residual primer molecules) at a rate of 1 ea. activity of one and 1 e.a. another activity (15 ^l).
The samples treated with the mixture were placed in the thermocycler for 40 min at 37°C and 20 min at 80°C. Further, the sequencing reaction was carried out, the mixture of which included: 1 ^l of BigDye Sequencing kit v3.1, 1.5 ^l of sequencing buffer, 2 ^l of one of the primers (forward or reverse), 2 ^l of purified PCR product and 3.5 ^l of DI water. The amplification program included 25 cycles: 25 sec at 96°C, 15 sec at 50°C and 2 min at 60°C. The resulting product was treated with 2 ^l of a mixture of shrimp alkaline phosphatase and DI water at a ratio of 1:1 and placed in the thermocycler for 40 min at 37°C and 20 min at 80°C and subsequently precipitated with alcohol and sodium acetate. 2 ^l of sodium acetate with blue dextran and 30 ^l of chilled 96% ethanol were added to 10 ^l of the reaction mixture, whereupon the solution was placed for 10 min at 20°C. After precipitation on
Phylogeny of the North Asian Cystopteridaceae 12,000 rpm, the supernatant was collected and 50 pl of 70% ethanol was added to the precipitate, followed by centrifugation for 5 min. After the last supernatant removal, open tubes were dried in an oven at 62°C for 5 min. The DNA of all samples was prepared for sequencing in the laboratory of structural and molecular analysis of plants at Tomsk State University; sequencing was carried out at Syntol Company (Moscow). All sequences were checked manually. For the phylogram construction, 56 samples collected by authors in the natural populations of 12 species mostly in Siberia were used. In addition, samples collected in some places of Europa (Austria), North America (USA), Central Asia (Tajikistan) were used. The obtained dataset on the sequences of the studied plastid DNA locus was aligned in the Geneiouse program using the MUSCULE algorithm, the phylogram has been constructed using the MEGA X software (Kumar et al., 2018) on the Maximum likelihood (ML) and Mister Bayes (MrB) methods. The consensus tree (phylogram) was constructed as a result of producing of 600,000 generations (25% of the trees are discarded).
Results
Phylograms based on the dataset of the sequencing of plastid DNA intergenic spacer trnG-R with using methods Maximum likelihood (ML) and Mister Byes (MrB) demonstrate the relationship within the Cystopteridaceae and within its constituent genera Gymnocarpium and Cystopteris, as well as placement of species described from the former USSR territory. In our phylogram, the family includes two strongly supported superclades corresponding to the genera Gymnocarpium and Cystopteris (including Rhizomatopteris) (Figure 2). Superclade of Cystopteris genus includes three strongly supported clades, that we following C. Rothfels et al. (2013) called the montana clade, the sudetica clade, and the Cystopteris fragiiis complex. The montana clade is strongly supported as sister to the remainder of the genus (100% ML bootstrap support/1.0 Bayesian posterior probability); sudetica clade is sister to the Cystopteris fragiiis complex and this topology is also strongly supported (100%/1.0). The feature of the montana and sudetica clades are their genetic homogeneity. The clade of the C. fragilis complex is strongly supported (100%/1.0) and is characterized by a basal dichotomy. One part of the split is quite highly supported (82%/1.0), another part of the split have low support (28%/0.57). Both parts of the dichotomy remain unresolved and are characterized by the unspecific set of species. All accessions of Altai-Sayan C. aitajensis, accessions C dickieana Sim of transplanted from a locus ciassicus of this species on the Atlantic coast of Scotland and grown in a private garden in Edinburgh, as well as from the Western Sayan (Siberia, Russia), and C. fragllis (L.) Bernh. from distant places - Pamir (Tajikistan) and Kuznetsk Alatau (Siberia, Russia) are included in the quite well-supported part. Three low supported part of the C. fragilis complex includes C. fragilis from different areas (the Altai, the Sayans, the Caucasus, and the Alps), C. alpina Desv. from the highlands of Arlberg (the Alps), all accessions of C. gureevae and two accessions of C. dickieana from the Western Sayan and the Russian Altai, C. protrusa (Weath.) Blasdell from Virginia (USA), one accession of C aitajensis from Kuznetsk Alatau (Russia), and all accessions of С. aimaatensis from Pamir (Tajikistan). The highly supported relationship in the trnG-R locus is shown by two accessions of species identified as C. aimaatensis from different locations in Tajikistan (90%/1.0), and two of four accessions of C. gureevae (86%/1.0). In general, none of the species of the C fragiiis complex included in our study is supported as monophyletic.
In the superclade of Gymnocarpium, data from trnG-R strongly support four clades: the dryopteris clade, the robertianum clade, the continentale clade, and the jessoense clade. The dryopteris clade is sister to the remainder of the genus (100% bootstrap support and 1.0 posterior probability). This clade includes G. dryopteris (L.) Newman having non-glandular (glabrous) fronds, and taxon with unclear identification (Gymnocarpium sp.), which is morphologically similar with G. dryopteris, but has scattered glandular pubescence. Another highly supported clade (86%/1.0) contains all accessions of species with glandular-pubescent fronds. Within this clade, the divergence of the robertianum-clade with remaining Gymnocarpium is strongly supported (100%/1.0). The robertianum-clade includes all accessions of G. robertianum (Hoffm.) Newman and the single accession of G. fedtschenkoanum from Pamir (Tajikistan). The latter merged with G. robertianum from the Altai with fairly high support (80%/1.0). The remaining glandular Gymnocarpium diverges into the strongly supported subclades (100%/1.0), which we called the continentale clade and the jessoense clade. The first clade includes all accessions of G. continentale and accessions of taxon identified as G. tenuipes, the second one contains all accessions of G. jessoense (Koidz.) Koidz. The accessions within both subclades demonstrate a great genetic uniformity.
Discussion
Cystopteris phylogeny
The most significant characteristics of the Cystopteris phylogeny based on plastid DNA locus trnG-R are the divergence of C (Rhizomatopteris) montana as the earliest lineage, which is sister to the remainder of the genus, and then the placement of C. sudetica as sister to the C. fragiiis complex (formally subgenus Cystopteris). C. Rothfels et al. (2013) have obtained the same topology of C. montana and C sudetica in their phylogram based on the combined dataset (rbcL, matK, and trnG-R). Most of the taxonomists separated C. montana and C. sudetica from remaining Cystopteris based on such morphological features as a long-creeping rhizome and widely-spaced triangular-to-deltoid fronds. R. F. Blasdell (1963) combined these species in the section Emarginatae Blasdell. A. P. Khokhryakov (1985) described for these species the distinct genus Rhizomatopteris A.P. Khokhr. N. N. Tzvelev (2005), recognizing the Khokhryakov's genus Rhizomatopteris, divided it into two sections: the type section Rhizomatopteris typified by C montana and the section Khokhrjakovia Tzvel. typified by C. sudetica. A. I. Shmakov at al. (2018) consider these species to different sections of the subgenus Emarginatae (Blasdell) Shmakov of the genus Cystopteris: C. montana to the section Emarginatae, C sudetica to the section Khokhrjakovia (Tzvel.) Shmakov. According to molecular phylogenetic studies conducted by C. Rothfels et al. (2013), topology of C. montana in the phylogenetic tree would permit the recognition of the genus Rhizomatopteris A. P. Khokhr. However, since A. P. Khokhryakov (1985) included in this genus also C. sudetica, "this assemblage is not monophyletic, and there seems little value in recognizing a monotypic Rhizomatopteris (containing only C. montana)" (Rothfels, 2013: 302). As shown by us earlier (Gureyeva, 2001; Gureyeva, Kuznetsov, 2015; Ulko et al., 2017; Gureyeva et al., 2018), С montana and C sudetica have more differences than similarities in morphological and biomorphological characteristics of sporophytes and ultrastructural characteristics of spores. Their long-creeping rhizomes have a different way of branching and growth: phylogenous branching with monopodial growth in C montana and acrogenic branching with monopodial-dichotomous growth in C. sudetica. Fronds are widely spaced and have the different forms: pentagonal with basal basiscopic pinnula on the lowermost pinna longer than adjacent basiscopic pinnula in C montana and deltate with basal basiscopic pinnula on the lowermost pinna shorter than adjacent basiscopic pinnula in C. sudetica. Spores in C montana have a perispore with broadly-conical reticulate elements of sculpture, C. sudetica has spores with spiny perispore. In general, morphological and molecular features do not allow C. sudetica to be include together with C. montana in the same supraspecific taxon - a section, subgenus, or genus, since in this case, the supraspecific taxon will be paraphyletic. Based on both molecular and phenetic differences, we consider it is possible to
Ukrainian Journal of Ecology, 10 (2), 2020
recognize C. montana as belonging to the distinct genus Rhzzomatopteris, especially since the genus was typified by its author A. P. Khokhryakov (1985) by this species.
Plastid locus trnG-R has not resolved the Cystopteris fragllis complex, including the topology of the species described from Russia and Kazakhstan - C. altajenses, C. gureevae, and C. a/maatensis. Cystopteris altajensis and C. gureevae are morphologically similar to each other and both differ from C. fragilis in form pinnulets (narrow, almost linear, with parallel margins) and presence of scattered, capitate glandular hairs, especially clear visible on the pinnulet margins. Both species produce large spores with length 43-53 (61) ^m in C. altajensis and 40-61 ^m in C. gureevae (Gureyeva, Kuznetsov, 2015; Ulko et al., 2017). Cystopteris altajensis is hexaploid n=126 (Gureyeva et al., 2017). Judging by the similarity in the size of the spores, C. gureevae is also hexaploid. Surprisingly, despite the morphological similarity, accessions of C. altajensis and C. gureevae do not cluster with each other, and mostly enter into different splits of the dichotomy of the Cystopteris fragilis complex, although weakly supported (Figure 2). This supports the view that these species are distinct. The single accession of taxon identified as Cystopteris sp. from Kuztetsk Alatau (Siberia, Russia) takes an uncertain position in the weakly supported unresolved subclade containing C. altajensis from Kuznetsk Alatau, C. a/maatensis from Pamir (Tajikistan) and C. protrusa (USA). Cystopteris sp., which is hexaploid (n=126, according to our data) differs from C. fragilis by unusual large fronds and by form of pinnae and pinnules. Perhaps it is one of the allopolyploid taxa from the Cystopteris fragilis complex. Another problem is the separation of species with rugose spores, traditionally called C. dickieana, from species with spiny spores, defined as C. fragilis. One of the questions to be resolved is to reveal the relationship between C. dickieana from Scotland where this species was described from (Sim, 1848), and mainly the alpine taxon that is characteristic to the mountainous regions of continental Eurasia identified also as C. dickieana. Our study was not able to answer this question definitely, although one of the accessions of C. dickieana from Siberia (Western Sayan) fell in the same part of the C. fragiiis complex with the accession C. dickieana from Scotland. However, two other Siberian accessions of C. dickieana from the Altai and Western Sayan clustered in another part of the C. fragilis complex with accessions of another species with rugose spores -C. a/maatensis from Pamir.
In general, the relationship within C. fragiiis complex remains uncertain, as well as in the study by C. Rothfels et al. (2013). This would be explained by the wide development of hybridization processes within the complex and reticular evolution via alloploidy that cannot be detected using plastid DNA loci but was proved using the low copy gene gapCp of nuclear DNA (Rothfels, 2014).
Gymnocarpium phylogeny
The most significant characteristic of the Gymnocarpium phylogeny based on plastid DNA locus trnG-R is the deep divergence of the genus into four highly supported clades: the dryopteris clade, the robertianum clade, the continental clade, and the jessoense clade. The placement of non-glandular Gynmocarpium as sister to the glandular species is similar to results obtained by C. Rothfels et al. (2013) on the base of three plastid loci dataset. Their disjunctum-clade includes all accessions of non-glandular species: G. dryopteris and G. disjunctum; the latter is one of the progenitors of allotetraploid G. dryopteris (Pryer, Haufler, 1993; Rothfels et al., 2013, 2014). One of our accessions designated as Gymnocarpium sp. is probably a hybrid between G. dryopteris and one of the species having glandular-pubescent fronds, most likely G. continentale.
Among glangular species of Gymnocarpium the robertianum-clade is a sister to the continental + jessoense clades. Our single accession of G. fedtschenkoanum falls in this clade that indicates its greater genetic proximity to G. robertianum than to other glandular species. The second feature of this clade is the genetic uniformity of European accessions of G. robertianum and highly supported (80%/1.0) association of Altaian G. robertianum with Pamirian G. fedtschenkoanum. A. V. Pojarkova, an author of G. fedtschenkoanum, indicated it as Pamir-Himalayan endemic (Pojarkova, 1950). C. Fraser-Jenkins (2008) also assigns the most of Himalayan Gymnocarpium to G. fedtschenkoanum. We expected the placement of G. fedtschenkoanum into the robertianum-clade, because of the morphological similarity of these species. G. fedtschenkoanum distinguishes from G. robertianum in the form and dissection of frond lamina, especially in the form of pinnules and pinnulets but is similar in the morphology of the rhizome and spores. The long-creeping rhizome in both species is relatively thick, brown (Gureyeva et al., 2018); their spores have a perispore sculpture consisting mostly of wide, sinuate, anastomosing relatively dense folds, which are perforated or pitted (Gureyeva, Kuznetsov, 2015).
Gymnocarpium continental and G. jessoense are very similar in morphological features. Even the complex of different morphological features is not always able to split up these species (Gureyeva et al., 2018). At the same time, these species are both in different strongly supported (100%/1.0) clades, which we named the continentale clade and the jessoense clade (Figure 2). Despite the fact that the G. continentale was described in 1930 (Petrov, 1930) and recognized in 1950 (Pojarkova, 1950), it was widely recognized by Russian taxonomists only since the 80s of the 20th century; at the same years G. jessoense was accepted in Russian literature (Gureyeva, 1984; 2001; Shmakov, 1995, 2005, 2009, 2011). Outside of Russia, these taxa are considered as subspecies: G. jessoense subsp. parvu/um and G. jessoense subsp. jessoense. Gymnocarpium jessoense subsp. parvu/um was described by J. Sarvela (1978) in return of G. continentale, because he did not find the type specimens of Petrov's Dryopteris pulchella var. continentale in LE (Saint-Petersburg, at that date Leningrad). In 1978, he included G. continentale as a synonym in his widespread G. jessoense subsp. parvu/um. Later, J. Sarvela changed his mind about subspecific status of taxa, mainly because the East Asian G. jessoense subsp. jessoense is diploid with n=40 and G. jessoense subsp. parvu/um is tetraploid with n=80 (Sarvela et al. 1981). Afterward, G. jessoense subsp. parvu/um was mentioned as G. continental in the work with Sarvela's participation (Pelinen et al., 1999). C. Rothfels et al. (2013) based on the results of molecular phylogenetic study have concluded, the "placement of G. jessoense subsp. jessoense (diploid) and G. jessoense subsp. parvu/um (tetraploid) in different well-supported clades suggests that these taxa should be treated as distinct species" (Rothfels et al., 2013: 302). In their next phylogenetic study based on the nuclear locus, C. Rothfels et al. (2014) proved that these taxa should be considered as different species; G. jessoense subsp. parvu/um has an allopolyploid origin and the most appropriate name for it is G. continentale (Petrov) Pojark. C. Rothfels's investigations (Rothfels et al., 2013) included two accessions of taxon identified as G. jessoense subsp. parvu/um from Canada and from Sakhalin (Russia). Our three accessions originate from the different places of Siberia, from where was described G. continentale. These accessions form clade deeply split from clade included all accessions of G. jessoense. Thus, this result is the additional evidence of the independence of these two taxa and their species status. All the more so, those type specimens, the absence of which was an obstacle to the recognition of G. continentale, were found, the name was typified, and the lectotype was designated by I. I. Gureyeva (2010). Two accessions of Gymnocarpium tenuipes fell in the continentale clade. As mentioned above, Gymnocarpium tenuipes was indicated by A. I. Shmakov (1995) for the Russian Altai, but not for other Siberian territories. Our accessions of taxon identified as G. tenuipes collected in the Altai and northwestern part of the Eastern Sayan Mountains (State reserve "Stolby") show the plastid locus trnG-R uniformity with accessions of G. continental. This may be
Phylogeny oof the North Asian Cystopteridaceae
evidence that specific identification of the herbarium specimens was wrong and in fact, they belong to G. continentale. For the definition of the species status of G. tenuipes and its relationship with other Gymnocarpium species, the samples from the locus classlcus of G. tenuipes in the Kazakh Upland is required.
28/0.57
90/0.97
86Л I Cystopteris_gureevae_Russia_Westem_Sayan_Matyi_Keb€Zh_(TK-004076) lcystopteris_gureevae_Russia_Westem_Sayan_Malyi_Keb€Zh_(TK-004074) Cystoper is_alpina_Austria_Ar lberg_Formannsee_(TK-004139) CystopterisJragilis_Austria_Tyrol_Achensee_(TK-004068) Cystop€ris_fragilis_Austria_Forarlb€rg_Ho€rbran2_(TK-004134) Cystop€ris_fragilis_Austria_Arlberg_Fonnarinsee_(TK-004138) I Cystopteris_gureevae_Russia_Westem_Sayan_Zok)toi_Us_(TK-004077) Cystopteris_gureevae_Russia_Westem_Sayan_Taigish_(TK-004055) |Cystopteris_diclaeana_Russia_Westem_Sayan_Yergaki_(TK-004050)
I-Cystopteris_dickieana_Russia_Altai_Ortolyk_(TK-004067)
-Cystopteris_protrusa_USA_Virginia_Potomac_fTK-003634)
Cystoptens_altajensis_Russia_KuznetsK_AlatauTunguzhul_(TK-004048) Cystopteris_almaatensis_Russia_Altai_Tutugoi_(TK-004063)
-Cystopteris_sp._Russîa_Kuznetsk_AJatau_Syia_(TK-004047)
_I-Cystoperis_almaatensisJTajikistan_Pamir_Sist_(TK-004127)
90/11 Cystopens_almaatensis_Ta|ikistan_Pamir_Rovmes_(TK-004132) CystoperisJragilis_Russia_Dagestan_(TK-004130) Cystoperis_fragilis_Russia_Stolby_(TK-004129) Cystoperis_fragilis_Russia_Altai_Chemal_(TK-004122)
— Cystopteris_dickieana_Russia_Western_Sayan_Yergaki_N._Buiba_(TK-004123)
— Cystoptens_a(ta|ensis_Rassia_Westefn_Sayan_Taigish_(TK-004[)66)
-Cystopteris_dickjeana_UK_Scotland_Edinburgh_cult.
Cystopteris_fragilis_Russia_Western_Sayan_Yergaki
Cystopteris_altajensis_Russia_Western_Sayan_Bagazyijl_(TK-004075)
Cystoperis_fragilis_Tajikistan_Pamir_Bizhon-Dora_(TK-004133)
- Cystopteris_altajersis_Russia_Western_Sayan_Bagazyul_(TK-004052) Cystopteris_fragilis_Russia_Kuznetsk_Alatau_Moskovka_(TK-004060)
i9l_r
74/0.99 L Cystoptens_fragilis_Russia_Kuznetsk_Alatau_Efrefnkino_fTK-004070) Cystopteris_sudetica_Russia_Westem_Sayan_Taigish_(TK-004049) - Cystopteris_sudetica_Russia_Western_Sayan_Malyi_Kebezh_(TK-004078)
58/1
100/1
dryopteris dad*
Cystopteris_sudetica_Russia_Westem_Sayan_Kirimzyul_n'K-004046) Rhizomatopteris_montana_Russia_Westem_Sayan_Yergald_Bujba_(TK-004073) Rhizomatopteris_montana_Russia_Westem_Sayan_Yergaki_Bujba_(TK-004053) Rhizomatopteris_montana_Russia_Kuznetsk_Alatau_Malaya_Sya_(TK-004128)
Gymnocarpium_dryopteris_Russia_Ural_Zyuratkul_(TK-004131) Gymnocarpium_dryopteris_Austria_Eichenberg_(TK-004137) — Сутпосаф1ит^гуор1еп5^из51а^ейет_5ауап^еЬегЬ^К-004057) Gymnocarpium_sp._Russia_Westem_Sayan_Us_(TK-004045) Gyrnnocarpium_dryoptens_Russia_Westem_Sayan_Kinmzyul_(TK-004054)
Сутпосаф1ит_гоЬеП1апит_Аи5(па_С1апа1ре_СЬготте(1(_(ТК-004140) Gymnoc arpium_robertianum_Austria_Eichenberg_stream_(TK-004136) 6утпосаф1ит_гоЬегИапит_Аийпа_Туго1_АсЬеп5ее_(ТК-004069) I Сутпосаф1ит_гоЬегйапит_Ри5аа_АИа1_ОгоИи1_(ТК-004051 ) 80/11 Gymnocarpium_fedtschenkoanum_Tajikistan_Jeprob
Су1лпосаф1ит_соШ1пеп1а1е_Ри551а_Ри1огапа_(ТК-004121)
100/1
86/1
robertiûnum clade
Сутт1П(каф1игп_сопйг>еп(а1е_Ризз1а_Ки2пе15к_А1а(аи_Мо5коука_(ТК-()(М()64) GymnocaфiumJeпu¡pes_Russia_Altai_Kyrsai_(TK-004062) Gymnocaфium_tenuipes_Russja_Eastem_Sayan_Stolby_(TK-004061) 6утпосаф1ит_согйг>еп1а1е_Ри55ш_Тиг>ди5ка_1акига_(ТК-004141)
GymnocaфiumJessoeпse_Russia_Westem_Sayan_Zolotoi_Us_(Ж-004072) GymrюcaфiumJ€ssoense_Russia_Westem_Sayan_Zoloto¡_Us_(TK-004056) Gymnoc arpiumJessoense_Russia_Western_Sayan_Bagazyul_(TK-004058) Gymnoc aфiumJessoense_Russia_Far_East_Brat_(TK-004126) Gymnocaфium_j€SSoense_Russia_Westem_Sayan_Yergaki_(TK-004043) - Сутпосафштjessoense_Russia_Westem_Sayan_BagazyuL(TK-004058; Gymnoc aфium_jessoense_Russia_Westem_Sayan_Kirimzyul_(TK-004044)
Figure 2. Maximum likelihood phylogram based on the sequences of the plastid trnG-R intergenic spacer. Support values (maximum likelihood bootstrap support/Bayesian posterior probability) are below the branches. Thickened branches are highly supported (>70% maximum likelihood bootstrap support and >0.95 posterior probability). Numbers in brackets indicate the vouchers stored in the Herbarium of Tomsk State University (TK) (See Appendix).
Conclusion
The molecular phylogenetic analysis of the North Asian members of the family Cystopteridaceae based on the sequencing of trnG-R intergenic spacer of plastid DNA showed more comprehensive results for Gymnocarpium, than for Cystopteris. Gymnocarpium phylogeny includes four well-supported clades: the dryopteris clade, the robertianum clade, the continentale clade, and the jessoense clade. Data from trnG-R support the divergence between species with glabrous fronds and species with glandular-pubescent fronds. Among glangular species of Gymnocarpium, the robertianum clade is a sister to other species having glandular-pubescent fronds. Gymnocarpium fedtschenkoanum is more related to G. robertianum, than other glandular species. Our data confirmed the recognition of Gymnocarpium continentale and G. jessoense as distinct species. The topology of G. tenuipes has
remained uncertain. Among Cystopteris species, C. montana and C. sudetica occupy the clearest position in the phylogenetic tree. The topology of C montana as sister to the remainder of the genus, and then the placement of C. sudetica as sister to the C fragiiis complex does not allow C. montana to be included together with C. sudetica in the same supraspecific taxon but allows to accept the genus Rhizomatopteris as a distinct monotypic genus containing a single species - Rh. montana. Relationships among the taxa of C. fragHiscomplex including the species described from the former USSR and modern Russia remain uncertain.
Acknowledgments
This study was supported by the Russian Foundation for Basic Research, grant No 18-34-00781. The authors are grateful to the curators of Herbaria LE, MW, and TK for the possibility to work with herbarium collections and would like to thank Marcin Nobis, doctor habilitatus of Jagiellonian University (Poland) for providing the material on Gymnocarpium fedtschenkoanum from Pamir, Heather McHaffie (Edinburgh, United Kingdom) for sending the fronds of cultivated Cystopteris dickieana, M. V. Olonova (Tomsk State University) for collecting of Cystopteris a/maatensis in Pamir, and Yu. G. Raiskaya for colleting of Gymnocarpium continentale in the basin of Podkamennaya Tunguska River. We are grateful also to Britain pteridologist C. N. Page (United Kingdom) for his valuable comments.
References
Blasdell, R. F. (1963). A monographic study of the fern genus Cystopteris. Mem. Torrey Bot. Club., 21 (1)-102.
Christenhusz, M. J. M., Zhang, X.-C. & Schneider, H. (2011). A linear sequence of extant families and genera of lycophytes and
ferns. Phytotaxa, 1 (19), 7-54.
Fraser-Jenkins, C. R. (2008). Taxonomic revision of three hundred Indian subcontinental pteridophytes with a revised census-list: A new picture of fern-taxonomy and nomenclature in the Indian subcontinent. Dehra Dun: Bishen Singh Mahendra Pal Singh. Gureyeva, I. I. (1984). Paporotniki vo flore Yuzhnoi Sibiri [Ferns in the flora of South Siberia]. Thesis of candidate of biological science. Tomsk [In Russian].
Gureyeva, I. I. (1985). A new species of the genus Cystopteris Bernh. from South Siberia. Sistematicheskiye zametki po materialam Gerbariya im. P.N. Krylova Tomskogo gosudarstvennogo universiteta [Systematic notes on the materials of P.N. Krylov Herbarium of Tomsk State University], 87: 5-8. [In Russian & Latin].
Gureyeva, I. I. (2001). Homosporous ferns of South Siberia. Taxonomy, origin, biomorphology, population biology. Tomsk: Tomsk University Publ. [In Russian].
Gureyeva, I. I. (2010). On the type of Gymnocarpium continentale. Botanicheskiy Zhurnal [Botanical Journal], 95 (6): 853-857. [In Russian].
Gureyeva, I. I. & Kuznetsov, A. A. (2015). Spore morphology of the north Asian members of Cystopteridaceae. Grana, 54 (3): 213235. doi: 10.1080/00173134.2015.1048824
Gureyeva, I. I., Kuznetsov, A. A. & Ulko, D. O. (2015). Findings of Cystopteris almaatensis Kotukhov (Cystopteridaceae) in the Altai. Sistematicheskiye zametki po materialam Gerbariya im. P.N. Krylova Tomskogo gosudarstvennogo universiteta [Systematic notes on the materials of P.N. Krylov Herbarium of Tomsk State University], 112: 62-65. doi: 10.17223/20764103.112.7 [In Russian].
Gureeva, I. I., Mitrenina, E. Yu. & Ulko, D. O. (2017). Cystopteridaceae. In: K. Marhold & J. Kucera (eds) IAPT/IOPB chromosome data 26. Taxon, 66 (6): 1489-1490 [print version]; P. E9-E10 [online version]. https://doi.org/10.12705/666.30 Gureyeva, I. I., Ulko, D. O. & Kuznetsov, A. A. (2018). Biomorphological and morphometric features of sporophytes in the systematic of Cystopteridaceae. Bulleten Botanicheskogo sada-instituta DVO RAN [Bulletin of the Botanical Garden-Institute of the Far East Branch of RAS], 19: 1-12. doi: 10.17581/bbgi1901 [In Russian].
Khokhrjakov, A. P. (1985). Supplement (Descriptions of novel plants). In: Flora Magadanskoi Oblasti [Flora of the Magadan Oblast]. Moscow: Nauka [In Russian].
Kotuhov, Yu. A. (1966). A new species of the genus Cystopteris Bernh. from South-East Kazakhstan. Botanicheskie Materialy Gerbariya Instituta Botaniki Akademii nauk Kazakhskoi SSR [Botanical Materials of the Herbarium of the Botanical Institute, Academy of Sciences of Kazakh SSR], 4: 27-29. [In Russian].
Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. (2018). MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution, 35: 1547-1549.
Lovis, J. (1978). Evolutionary patterns and processes in ferns. Advances in Botanical Research, 4: 229-415.
Nagalingum, N. S., Schneider, H. & Pryer, K. M. (2007). Molecular phylogenetic relationships and morphological evolution in the
heterosporous fern genus Marsilea. Systematic Botany, 32: 16-25.
Pellinen, K., Sarvela, J. & Uotila, P. (1999). Chromosome counts on the fern genus Gymnocarpium (Dryopteridaceae) from Finland. Annales Botanici Fennici, 35: 265-266.
Petrov, V. A. (1930). Divisio Pteridophyta. In: Komarov, V. L., ed. Flora Yakutii. Paporotniki - Zlaki [Flora of Yakutia. Ferns -Grasses]. Leningrad: Academy of Sciences of the USSR Publ., 1: 1-23. [In Russian].
Pojarkova, A. I. (1950). A new fern species and a question about Himalayan elements in the forest relic flora of Middle Asia. Soobshchenija Tadzhikskogo Filiala AN SSSR [Reports of the Tajik Branch of the Academy of Sciences of the USSR], 22: 9-13. [In Russian].
Pryer, K. M. & Haufler, C. H. (1993). Isozymic and chromosomal evidence for the allotetraploid origin of Gymnocarpium dryopteris (Dryopteridaceae). Systematic Botany, 18: 150-172.
Rogers, S. O. & Bendich, A. J. (1989). Extraction of DNA from plant tissues. In: Plant Molecular Biollogy Manual, 73-83. Rothfels, C. J., Johnson, A. K., Windham, M. D. & Pryer, K. M. (2014). Low-copy nuclear data confirm rampant allopolyploidy in the Cystopteridaceae (Polypodiales). Taxon, 63 (5), 1026-1036. http://dx.doi.org/10.12705/635.32
Rothfels, C. J., Sundue, M. A., Kuo, L.-Y., Larsson, A., Kato, M., Schuettpelz, E., & Pryer, K. M. (2012). A revised family-level
classification for eupolypod II ferns (Polypodiidae: Polypodiales). Taxon, 61 (3), 515-533. doi: 10.1002/tax.613003
Rothfels, C. J., Windham, M. D. & Pryer, K. M. (2013). A plastid phylogeny of the cosmopolitan fern family Cystopteridaceae
(Polypodiopsida). Systematic Botany, 38 (2), 295-306. doi 10.1600/036364413X666787
Sarvela, J. (1978). A synopsis of the fern genus Gymnocarpium. Annales Botanici Fennici, 15: 101-106.
Sarvela, J., Britton, D. M. & Pryer, K. M. (1981). Studies on the Gymnocarpium robertianum complex in North America. Rhodora, 83: 421-431.
Phytogeny of the North Asian Cystopteridaceae Shmakov, A. I. (1995). Sinopsis of ferns of the Altai, Tian-Shan and Semirechiye. Flora i rastitelnost Altaya [Flora and vegetation of the Altai], 1: 35-53. [In Russian].
Shmakov, A. I. (2001). Synopsis of the ferns of Russia. Turczaninowia, 4, 36-72. (In Russian).
Shmakov, A. I. (2005). Cystopteridaceae. (pp. 205-220). In: Flora Altaya [Flora of the Altai]. Barnaul: Azbuka Publ. [In Russian]. Shmakov, A. I. (2009). Opredelitel Paporotnikov Rossii [Key to the ferns of Russia]. Barnaul: Altai State University Publ. [In Russian].
Shmakov, A. I. (2011). Paporotniki Severnoi Asii [Ferns of North Asia]. Barnaul: ARTIKA Publ. [In Russian].
Shmakov, A. I., Batkin, A. A. & Vaganov, A. V. (2018). Synopsis of the genus Cystopteris Bernh. (Cystopteridaceae). Ukrainian
Journal of Ecology, 8 (4): 290-297.
Sim, R. (1848). Cystopteris dickieana. The Gardeners & Farmers, 2 (20): 2.
Siplivinskiy, V. N. (1973). Notes on the Baikal flora, 1. Novosti sistematiki vysshykh rastenij [Novitatis Systematicae Plantarum Vascularum]. Leningrad: Nauka. [In Russian].
Stepanov, N. V. (2015). About three new species of vascular plants of Western Sayan. Sistematicheskiye zametki po materialam Gerbariya im. P.N. Krylova Tomskogo gosudarstvennogo universiteta [Systematic notes on the materials of P.N. Krylov Herbarium of Tomsk State University], 111: 3-15. doi: 10.17223/20764103.111.1 [In Russian & English].
Tzvelev, N. N. (2005). Conspectus abbreviatus plantarum Cryptogamicum vascularium Europae orientalis. Novosti Sistematiki Vysshikh Rastenii [Novitatis Systematicae Plantarum Vascularum], 37: 7-32.
Ulko, D. O., Gureyeva, I. I., Shmakov, A. I. & Romanets, R. S. (2017). Spore morphology of subgenus Cystopteris species (Cystopteris Bernh., Cystopteridaceae). Turczaninowia, 20 (2): 5-15. doi: 10.14258/turczaninowia.20.2.1 [In Russian].
Appendix
List of accessions sampled in this study, presented in the following format: Species, Voucher: locality, date of collection, collector's name (Herbarium acronym and number of specimen).
Studied specimens
Cystopteris almaatensis. Russia, the Altai, Tutugoi, 15.07.2000. A. Ebel (TK-004063); Tajikistan, Pamir, Sist, 11.08.2017, M. Olonova (TK-004127); Tajikistan, Pamir, Rovmes 17.08.2017, M. Olonova (TK-004132);
C. altajensis: Russia, Western Sayan, Taigish, 15.07.2015, I. Gureyeva et al. (TK-004066); Russia, Western Sayan, Bagazyul, 13.07.2015, I. Gureyeva et al. (TK-004052, TK-004075); Russia, Kuznetsk Alatau,Tunguzhul, 26.06.2016, I. Gureyeva et al. (Tk-004048);
C. dickieana: Russia, Western Sayan, Yergaki, 17.07.2015, I. Gureyeva et al. (TK-004050); Russia, Western Sayan, N. Buiba, 14.07.2015, I. Gureyeva et al. (TK-004123); Russia, Altai, Ortolyk, 27.07.2014, A. Revushkin et al., (TK-004067); UK, Scotland, Edinburgh, H. McHaffie, cult.;
C. fragilis: Austria, Forarlberg, Hoerbranz, 25.08.2019. I. Gureyeva (TK-004134); Austria, Tyrol, Achensee, 11.08.2013. I. Gureyeva (TK-004068); Austria, Arlberg, Formarinsee, 25.08.2019. I. Gureyeva (Tk-004138); Tajikistan, Pamir, Bizhon-Dora, 08.08.2017. M. Olonova (TK-004133); Russia, Dagestan, 24.06.2018, I. Gureyeva (TK-004130); Russia, Stolby, 29.07.2016, V. Kurbatskiy (TK-004129); Russia, Altai, Chemal, 03.07.2006, I. Gureyeva (TK-004122); Russia, Kuznetsk Alatau, Efremkino, 08.08.2015, A. Ebel (TK-004070); Russia, Kuznetsk Alatau, Moskovka, 20.07.2015, A. Ebel (TK-004060), Russia, Western Sayan, Yergaki, 14.07.2015, I. Gureyeva et al.;
C. gureevae: Russia, Western Sayan, Taigish, 15.07.2015, I. Gureyeva et al. (TK-004055); Russia, Western Sayan, Malyi Kebezh, 16.07.2015, I. Gureyeva et al. (TK-004074; TK-004076); Russia, Western Sayan, Zolotoi Us, 17.07.2015, I. Gureyeva et al. (TK-004077);
C. alpina: Austria, Arlberg, Formarinsee, 25.08.2019. I. Gureyeva (TK-004139);
C. sudetica. Russia, Western Sayan, Taigish, 15.07.2015, I. Gureyeva et al. (TK-004049); Russia, Western Sayan, Kirimzyul, 13.07.2015, I. Gureyeva et al. (Tk-004046); Russia, Western Sayan, Malyi Kebezh, 16.07.2015, I. Gureyeva et al. (TK-004078); Cystopteris sp.: Russia, Kuznetsk Alatau, Syia, 24.06.2016, I. Gureyeva et al. (TK-004047);
Rhizomatopteris montana: Russia, Western Sayan, Yergaki, Bujba, 14.07.2015, I. Gureyeva et al. (TK-004053, TK-004073); Russia, Kuznetsk Alatau, Syia, 25.06.2016, I. Gureyeva et al. (TK-004128);
Gymnocarpium continentale: Russia, Putorana, 21.07.2014, I. Volkova et al. (TK-004121); Russia, Tunguska, Lakura, 6.07.2014, Yu. Raiskaya (TK-004141); Russia, Kuznetsk Alatau, Moskovka, 19.07.2015, A. Ebel (TK-004064); G. dryopteris. Russia, Western Sayan, Kebezh 13.07.2015, I. Gureyeva et al. (TK-004057); Russia, Western Sayan, Kirimzyul, 13.07.2015,
I. Gureyeva et al. (TK-004054);
G. fedtschenkoanum: Tajikistan, Jeprob, M. Nobis;
G. jessoense: Russia, Western Sayan, Yergaki, 14.07.2015, I. Gureyeva et al. (TK-004043); Russia, Western Sayan, Kirimzyul, 13.07.2015, I. Gureyeva et al. (TK-004044); Russia, Western Sayan, Zolotoi Us, 17.07.2015, I. Gureyeva et al. (TK-004072, TK-004056); Russia, Western Sayan, Bagazyul, 13.07.2015, I. Gureyeva et al. (TK-004058); Russia, Far East, Brat, 01.09.2013, A. Kuznetsov et al., (TK-004126);
G. robertianum: Russia, Altai, Oroktui, 03.0702005, A. Pyak (TK-004051); Austria, Gleinalpe, Chrommerk, 11.07.2009, A. Shmakov et al. (TK-004140); Austria, Eichenberg, stream, 24.08.2019, I. Gureyeva (TK-004136); Austria, Tyrol, Achensee,
II.08.2013, I. Gureyeva (TK-004069);
G. tenuipes. Russia, Altai, Kyrsai, 07.2006. I. Gureyeva et al. (TK-004062); Russia, Eastern Sayan, Stolby, 28.07.2016, V. Kurbatskiy (TK-004061);
Gymnocarpium sp.: Russia, Western Sayan, Us, 17.07.2015, I. Gureyeva et al. (TK-004045).
Citation:
Gureyeva, I.I., Ulko, D.O., Romanets, R.S., Kuznetsov, A.A. (2020). Phylogeny of the North Asian Cystopteridaceae (Polypodiopsida) based on trnG-R intergenic spacer. Ukrainian Journal of Ecology, 10(2), 177-183. | («QE^^^MI jhis work is licensed under a Creative Commons Attribution 4.0. License
