Научная статья на тему 'Оздоровление микрорастений трех культурных видов картофеля (Solanum tuberosum L. , S. phureja Juz. & Buk. И S. stenotomum Juz. & Buk. ) от вирусов методом комбинированной термо-химиотерапии'

Оздоровление микрорастений трех культурных видов картофеля (Solanum tuberosum L. , S. phureja Juz. & Buk. И S. stenotomum Juz. & Buk. ) от вирусов методом комбинированной термо-химиотерапии Текст научной статьи по специальности «Сельское хозяйство, лесное хозяйство, рыбное хозяйство»

CC BY
518
112
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
КАРТОФЕЛЬ / SOLANUM TUBEROSUM / SOLANUM PHUREJA / SOLANUM STENOTOMUM / МИКРОРАСТЕНИЯ / ВИРУСЫ / PVY / PVX / PVS / PVM / PLRV / ОЗДОРОВЛЕНИЕ / ОТ-ПЦР / ТЕРМОТЕРАПИЯ / ХИМИОТЕРАПИЯ / POTATOES / MICROPLANTS / VIRUS ERADICATION / RT-PCR / THERMOTHERAPY / CHEMOTHERAPY

Аннотация научной статьи по сельскому хозяйству, лесному хозяйству, рыбному хозяйству, автор научной работы — Антонова О.Ю., Апаликова О.В., Ухатова Ю.В., Крылова Е.А., Шувалов О.Ю.

Коллекция картофеля, собранная во Всероссийском институте генетических ресурсов растений им. Н.И. Вавилова (ВИР), одна из крупнейших и старейших в мире. Коллекционные образцы, которые в процессе хранения длительно репродуцируют клубнями, могут накапливать вирусные инфекции, поэтому разработка эффективных методов оздоровления растений картофеля крайне актуальна. Взяв за основу протоколы термои химиотерапии, а также комплексной терапии, используемые в ведущих генбанках картофеля (Leibniz Institute of Plant Genetics and Crop Plant Research IPK, Германия; International Potato Centre CIP, Перу), мы разработали модифицированный метод комбинированной терапии, включающий три последовательных цикла выращивания in vitro растений на среде Мурасиге и Скуга (MS) с рибавирином (30 мг/л) при температуре 37 °С в течение 4 нед. В промежутках между этими циклами микрорастения в течение 2 сут выдерживались при температуре 26 °С на той же среде с рибавирином. В качестве материала исследований использовали 91 клон 85 образцов трех южно-американских культурных видов из полевой коллекции ВИР: Solanum phureja 18 образцов, S. stenotomum 26 образцов, S. tuberosum ( S. tuberosum ssp. andigenum и S. tuberosum ssp. tuberosum ) 41 образец. Согласно результатам иммуноферментного анализа (ИФА) исходных растений и тестирования микрорастений, полученных после введения в культуру in vitro тех же клонов, в ОТ-ПЦР (ПЦР с обратной транскрипцией), материал был в разной степени поражен вирусами (Y-, X-, S-, M-вирус картофеля и вирус скручивания листьев картофеля соответственно YВК, XВК, SВК, MВК и ВСЛК). При этом у 25,3 % клонов выявили простые инфекции, у остальных смешанные (растения были заражены несколькими вирусами одновременно в различных сочетаниях). При сравнении результатов ОТ-ПЦР-анализа до и после проведения разработанной процедуры комбинированной термо-химиотерапии по каждому клону эффективность оздоровления от ВСЛК в целом по выборке (91 клон) составила 72,7 %, от YВК 71,4 %, от MВК 63,9 % и от SВК 57,4 %. Всего 42 клона (46 %) оказались полностью свободными от тестируемых вирусов, у 44 % клонов произошла элиминация отдельных вирусов и 10 % клонов не удалось оздоровить. Различия в эффективности оздоровления растений от каждого из тестируемых вирусов не были значимыми (р > 0,05). Существенных различий между образцами изученных культурных видов картофеля по частоте элиминации вирусов мы также не обнаружили. Предложенная модификация отличается от протоколов IPK (Германия) одновременным воздействием повышенной температуры (37 °С) и рибавирина (вместо их последовательного применения), а от схемы, используемой в CIP (Перу), меньшим числом этапов.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по сельскому хозяйству, лесному хозяйству, рыбному хозяйству , автор научной работы — Антонова О.Ю., Апаликова О.В., Ухатова Ю.В., Крылова Е.А., Шувалов О.Ю.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

ERADICATION OF VIRUSES IN MICROPLANTS OF THREE CULTIVATED POTATO SPECIES (SOLANUM TUBEROSUM L., S. PHUREJA JUZ. & BUK., S. STENOTOMUM JUZ. & BUK.) USING COMBINED THERMO-CHEMOTHERAPY METHOD

A modified method of combined chemo-thermotherapy for eradication the most damaging viruses in potato plants is proposed. The materials for study included 91 clones of 85 accessions of three South-American cultivated species Solanum phureja (18 accessions), S. stenotomum (26 accessions), S. tuberosum ( S. tuberosum ssp. andigenum and S. tuberosum ssp. tuberosum ) (41 accessions) from the VIR field collection (N.I. Vavilov All-Russian Institute of Plant Genetic Resources). The results of ELISA for 91 clones from the field collection and RT-PCR analysis of the corresponding microplants, when introducing clones into in vitro culture, have shown that all material was infected by viruses (potato viruses Y, X, S, M and potato leafroll virus PVY, PVX, PVS, PVM and PLRV) to varying degrees. Single infections were detected in 25.3 % of the 91 clones, and the remaining clones were multi-infected and contained several viruses in various combinations. Based on the termoand chemotherapy protocols as well as complex therapy used in leading potato genebanks (Leibniz Institute of Plant Genetics and Crop Plant Research IPK, Germany; International Potato Centre CIP, Peru), we have developed a modified method of combined therapy comprising three successive cycles of in vitro plant cultivation on Murashige and Skoog basal medium (MS) supplemented with ribavirin (30 mg/l) at 37 °С during 4 weeks. Between the cycles, the microplants were incubated for 2 days at 26 °С on the same medium with ribavirin. Each clone was tested for the presence of viruses by RT (revers transcription) PCR before and after the combined thermo-chemotherapy. In RT-PCR, 42 clones (46 %) were completely free from tested viruses, 44 % were free from some viruses, and 10 % of the clones were unable to improve. On the whole of 91 clones, PLRV was eliminated from 72.7 %, PVY from 71.4 %, PVM from 63.9 % and PVS from 57.4 % of microplants. Differences in elimination frequency between the viruses were not significant (р > 0.05). Also, there were no significant differences in elimination of different viruses between the accessions of different cultivated species. The difference of this modification from IPK protocols (Germany) lays in simultaneous effect of high temperature (37 °C) and ribavirin (instead of sequential application), and, unlike the CIP (Peru) scheme, it comprises less steps.

Текст научной работы на тему «Оздоровление микрорастений трех культурных видов картофеля (Solanum tuberosum L. , S. phureja Juz. & Buk. И S. stenotomum Juz. & Buk. ) от вирусов методом комбинированной термо-химиотерапии»

СЕЛЬСКОХОЗЯЙСТВЕННАЯ БИОЛОГИЯ, 2017, том 52, № 1, с. 95-104

УДК 635.21:573.6.086.83:[632.935.11+632.934.3 doi: 10.15389/agrobiology.2017.1.95rus

ОЗДОРОВЛЕНИЕ МИКРОРАСТЕНИЙ ТРЕХ КУЛЬТУРНЫХ ВИДОВ КАРТОФЕЛЯ (Solanum tuberosum L., S. phureja Juz. & Buk. И S. stenotomum Juz. & Buk.) ОТ ВИРУСОВ МЕТОДОМ КОМБИНИРОВАННОЙ ТЕРМО-ХИМИОТЕРАПИИ*

О.Ю. АНТОНОВА, О.В. АПАЛИКОВА, Ю.В. УХАТОВА, Е.А. КРЫЛОВА, О.Ю. ШУВАЛОВ, А.Р. ШУВАЛОВА, Т.А. ГАВРИЛЕНКО

Коллекция картофеля, собранная во Всероссийском институте генетических ресурсов растений им. Н.И. Вавилова (ВИР), — одна из крупнейших и старейших в мире. Коллекционные образцы, которые в процессе хранения длительно репродуцируют клубнями, могут накапливать вирусные инфекции, поэтому разработка эффективных методов оздоровления растений картофеля крайне актуальна. Взяв за основу протоколы термо- и химиотерапии, а также комплексной терапии, используемые в ведущих генбанках картофеля (Leibniz Institute of Plant Genetics and Crop Plant Research — IPK, Германия; International Potato Centre — CIP, Перу), мы разработали модифицированный метод комбинированной терапии, включающий три последовательных цикла выращивания in vitro растений на среде Мурасиге и Скуга (MS) с рибавирином (30 мг/л) при температуре 37 °С в течение 4 нед. В промежутках между этими циклами микрорастения в течение 2 сут выдерживались при температуре 26 °С на той же среде с рибавирином. В качестве материала исследований использовали 91 клон 85 образцов трех южно-американских культурных видов из полевой коллекции ВИР: Solanum phureja — 18 образцов, S. stenotomum — 26 образцов, S. tuberosum (S. tuberosum ssp. andigenum и S. tuberosum ssp. tuberosum) — 41 образец. Согласно результатам иммуноферментного анализа (ИФА) исходных растений и тестирования микрорастений, полученных после введения в культуру in vitro тех же клонов, в ОТ-ПЦР (ПЦР с обратной транскрипцией), материал был в разной степени поражен вирусами (Y-, X-, S-, M-вирус картофеля и вирус скручивания листьев картофеля — соответственно YВК, ХВК, SВК, МВК и ВСЛК). При этом у 25,3 % клонов выявили простые инфекции, у остальных — смешанные (растения были заражены несколькими вирусами одновременно в различных сочетаниях). При сравнении результатов ОТ-ПЦР-анализа до и после проведения разработанной процедуры комбинированной термо-химиотерапии по каждому клону эффективность оздоровления от ВСЛК в целом по выборке (91 клон) составила 72,7 %, от YВК — 71,4 %, от МВК — 63,9 % и от SВК — 57,4 %. Всего 42 клона (46 %) оказались полностью свободными от тестируемых вирусов, у 44 % клонов произошла элиминация отдельных вирусов и 10 % клонов не удалось оздоровить. Различия в эффективности оздоровления растений от каждого из тестируемых вирусов не были значимыми (р > 0,05). Существенных различий между образцами изученных культурных видов картофеля по частоте элиминации вирусов мы также не обнаружили. Предложенная модификация отличается от протоколов IPK (Германия) одновременным воздействием повышенной температуры (37 °С) и рибавирина (вместо их последовательного применения), а от схемы, используемой в CIP (Перу), — меньшим числом этапов.

Ключевые слова: картофель, Solanum tuberosum, Solanum phureja, Solanum stenotomum, микрорастения, вирусы, PVY, PVX, PVS, PVM, PLRV, оздоровление, ОТ-ПЦР, термотерапия, химиотерапия.

Коллекция картофеля, собранная во Всероссийском институте генетических ресурсов растений им. Н.И. Вавилова (ВИР), — одна из крупнейших и старейших в мире. Она насчитывает около 8500 образцов селекционных сортов, диких и культурных видов, а также межвидовых гибридов (1). Образцы картофеля полевых коллекций, длительно репродуцируемые клубнями, могут накапливать вирусные инфекции. Известно около 40 вирусов, поражающих картофель, из них наиболее вредоносны Y-вирус картофеля ^ВК), вирус скручивания листьев картофеля (ВСЛК), M-вирус

* Статья подготовлена при поддержке Программы фундаментальных научных исследований государственных академий наук на 2013-2020 годы. Завершающий этап работы выполнен при частичной поддержке КЦП РФ «Научное обеспечение деятельности по созданию отечественного посевного фонда, средств защиты растений в целях производства российскими производителями конкурентоспособной сельскохозяйственной продукции, а также по созданию технологий производства (выращивания) и хранения такой продукции на 2016-2025 годы» (по приоритетному направлению «Картофелеводство»).

картофеля ^ВК), S-вирус картофеля (SВК), X-вирус картофеля (XВК), A-вирус картофеля ^ВК) (2-4). На территории России и стран СНГ чаще всего встречаются ТВК, ВСЛК, XВК, SВК, MВК, реже выявляются F-вирус картофеля и AВК (5). В полевых условиях вирусы передаются главным образом насекомыми-переносчиками (преимущественно тлей), а также контактным способом (3).

Для оздоровления растений используют культуру апикальных меристем, химио-, термо-, крио- и электротерапию, а также разные сочетания этих методов (комплексная, или комбинированная, терапия). Метод оздоровления в культуре апикальных меристем, который был разработан одним из первых (6, 7), относительно малозатратен и до сих пор широко применяется. Однако для оздоровления растений в больших коллекциях, насчитывающих тысячи образцов, он становится менее востребованным из-за трудоемкости и в связи с появлением более эффективных комбинированных подходов. При криотерапии в жидком азоте (-196 °С) только клетки меристем, потенциально свободные от вирусов, сохраняют жизнеспособность, а вне меристемной зоны гидратированные клетки гибнут (8). Метод электротерапии основан на пропускании электрического тока через растительные ткани, в результате чего происходит деградация вирусного нуклеопротеина и патоген утрачивает вирулентность (9, 10).

Термотерапия in vivo и in vitro растений основана на снижении титра вирусов в зараженных тканях вследствие нарушения синтеза вирусных РНК при повышенных температурах — 36-40 °С (12). Способ менее эффективен в отношении сферических вирусов (4), поэтому при смешанных инфекциях его рекомендуют сочетать с другими технологиями. Химиотерапия основана на обработке инфицированных растений веществами с противовирусной активностью. К ним относятся ингибиторы синтеза вирусных нуклеиновых кислот — тилофорин и его производные, аналоги пу-риновых и пиримидиновых оснований, в том числе рибавирин, и др. (1113), а также РНКаза (14), интерферон (15), стимуляторы роста (16) и феноль-ные соединения, в частности салициловая кислота (17). Наиболее часто для химиотерапии растений картофеля in vitro применяется рибавирин — синтетический аналог гуанозина (1-бета^-рибофуранозил-1Н-1,2,4-триазол-3-карбоксамид), но следует помнить, что низкие дозы препарата малоэффективны (11), а в высоких он угнетает развитие растений (8). Оптимальными считаются концентрации 30-50 мг/л (11-13).

В крупных центрах генетических ресурсов растений, таких как International Potato Centre (CIP, Перу) и Leibniz Institute of Plant Genetics and Crop Plant Research (IPK, Германия), для оздоровления коллекционных образцов картофеля используют схемы термо- и химиотерапии, различающиеся числом и продолжительностью этапов, а также комбинированную терапию, которая предусматривает разные сочетания этих методов (18-21). Частота элиминации вирусов может дополнительно повышаться при использовании культуры апикальной меристемы совместно с различными вариантами комбинированной терапии — термотерапией (22, 23), химиотерапией (25, 26) и термо-химиотерапией (12, 26, 27).

Отметим, что приемы антивирусной терапии неодинаковы по эффективности, а в ряде случаев одни и те же подходы в разных лабораториях дают противоречивые результаты. Кроме того, большинство исследований выполнены на единичных сортах или их ограниченном числе, поэтому не известно, насколько предлагаемые методики применимы для больших коллекций. Таким образом, разработка способов оздоровления расте-

ний картофеля от вирусных инфекций остается крайне актуальной.

Взяв за основу протоколы термо- и химиотерапии, а также комплексной терапии ведущих генбанков картофеля (CIP и IPK), мы модифицировали схему оздоровления для больших выборок генетически разнородных образцов картофеля, в растениях которых были выявлены смешанные вирусные инфекции в различных сочетаниях. От протоколов IPK предложенная нами модификация отличается одновременным, а не последовательным применением повышенной температуры (37 °С) и рибавири-на, а от схемы, используемой в CIP, — меньшим числом этапов (21).

Цель работы — сравнив известные протоколы, разработать и верифицировать схему комплексной антивирусной химио-термотерапии для оздоровления растений картофеля in vitro.

Методика. Материалом для исследований послужило 91 растение 85 образцов трех южно-американских культурных видов (аборигенных сортов) картофеля: Solanum phureja (18 образцов), S. stenotomum (26 образцов), S. tuberosum ssp. andigenum (= S. andigenum) (23 образца), S. tuberosum ssp. tuberosum (= S. tuberosum) (18 образцов) из коллекции ВИР. В статье указаны названия видов согласно таксономической системе J. Hawkes (1990) (28), которая в настоящее время используется наиболее широко; в скобках приведены обозначения, принятые в коллекции ВИР, которая структурирована по С.М. Букасову (1978) (29). Изучаемые образцы, которые представляют собой экспедиционные сборы разных лет, впоследствии длительное время репродуцировались в полевой коллекции.

Полевые растения анализировали на присутствие MВК, YВК, SВК, ВСЛК и XВК методом иммуноферментного анализа, применяя наборы и рабочий протокол фирмы «Agdia, Inc.», США) (https://orders.agdia.com) (данные не представлены). По результатам иммуноферментного анализа отбирали клоны среди растений полевой коллекции. Для сохранения вирусной инфекции эти клоны вводили в культуру in vitro с использованием апексов крупного (2-4 мм) размера (30). Полученные микрорастения сохраняли как клоновую коллекцию.

Препараты тотальной РНК (включает РНК вирусов) получали из нижних листьев развитых пробирочных растений согласно описанию (31), используя коммерческий набор для выделения на магнитных частицах, покрытых SiO2 («Силекс», Россия). Препараты хранили при -70 °С. Обратную транскрипцию проводили при помощи набора «Синтез первой цепи кДНК (рендом)» («Силекс», Россия) в соответствии с прилагаемым протоколом (32). В набор входит смесь случайных гексануклеотидных праймеров, позволяющих одновременно получить кДНК для всех вирусных РНК и для РНК гена тубулина (контроль успешного синтеза матрицы). Специфичные праймеры (синтезированы в компании «Евроген», Россия) и режимы амплификации при выявлении вирусов YBK, MBK, XBK, SBK и ВСЛК в ПЦР описаны в литературе (33-36). Эффективность матрицы в ПЦР контролировали с помощью праймеров, специфичных для гена белка тубулина (36). Отрицательным контролем служили пробы без РНК. ПЦР выполняли на амплификаторе Mastercycler nexus gradient («Eppendorf», Германия). Для повышения специфичности ПЦР используемые программы предусматривали функцию TOUCHDOWN: исходно температура отжига праймеров устанавливалась на 5 °С выше необходимой и затем в каждом из пяти циклов амплификации понижалась на 1 °С. ПЦР-продукты разделяли при помощи электрофореза в 2,5 % агарозных гелях, окрашивали бромистым этидием и визуализировали в УФ-свете.

Перед началом экспериментов по оздоровлению каждый клон был протестирован на присутствие вирусов методом ОТ-ПЦР. Оздоровление микрорастений проводили модифицированным нами методом комбинированной термо-химиотерапии. При этом использовали питательную среду Мурасиге-Скуга (MS) без гормонов (30), содержащую антивирусный препарат рибавирин (30 мг/л). Комбинированная терапия включала три этапа продолжительностью 4 нед каждый, на которых растения подвергались воздействию рибавирина при повышенных температурах (37 °С), после чего их выдерживали на среде с рибавирином при 26 °С в течение 1 мес.

Статистическую обработку данных проводили, используя ¿-критерий Стьюдента при уровне значимости р < 0,05.

Результаты. Мы проанализировали известные методы оздоровления растений от вирусов (табл. 1), на основании чего была предложена модифицированная схема антивирусной терапии in vitro (рис. 1) с применением ОТ-ПЦР для выявления инфицированности. Эффективность этой схемы в отношении наиболее распространенных вирусных патогенов картофеля контролировали на выборке из представителей нескольких видов Solanum, используя праймеры, специфичные к различным участкам геномов соответствующих вирусов (табл. 2).

1. Эффективность различных методов оздоровления растений культурных видов картофеля от вирусных инфекций

ХВК

YBK

ВСЛК

SBK

МВК

+б (22) ++а (23)

+а (14, 38) ++а (11)

+++а (39, 40)

++а (22, 23) +++а (41)

апикальных меристем ++ (8) ++а (23)

Культура +а (37) ++ (8)

Простая терапия Обработка рибавирином

-а(11) +а (14, 38) +в (12) ++а (8, 16)

-а(11) +а (40)

+а (16) ++а (8, 37)

(11)

Обработка РНКазой +а (39, 40)

Термотерапия ++а (8)

+а (11, 14) +++а (23, 38)

+а (39, 40)

+а (23)

+а (14) +в (12) ++а (23) ++++а (11)

+а (39, 40)

-а (8) +а (23)

Криотерапия ++++а (8) ++++а (8)

Комплексная терапия Химио- и термотерапия (11, 23) (11, 23) ++а (23) ++а (23)

++а (11, 17) ++а (17) ++++а (11, 38) +++а (11)

Термотерапия и культура меристем ++++а (8, 42) ++++а (8, 42) ++а (24)

++++а (23, 42) Химиотерапия и культура меристем ++а в (26) ++а в (26) +++а (25)

++++а, В (26) Термо-, химиотерапия и культура меристем +++а (27) +++а (27) +++а (27)

++++а (37)

Термо-, химио-, электротерапия и культура меристем +++а (10) ++++а в (26) _ ++++в (12)

Примечание. ХВК, YВК, SВК, МВК — соответственно X-, Y-, S- и М- вирусы картофеля, ВСКЛ — вирус скручивания листьев картофеля; «-» — отсутствие эффекта оздоровления; «+» — до 40 % безвирусных растений, «++» — от 41 до 60 % безвирусных растений, «+++» — от 61 до 89 % безвирусных растений, «++++» — от 90 до 98 % безвирусных растений. В скобках указаны цитируемые ссылки литературы. Тестирование методом иммуноферментного анализа (а), в ПЦР с обратной транскрипцией (б), с помощью растений-индикаторов или электронной микроскопии (в). Пропуски означают отсутствие данных.

++б (22)

++++а (11, 23, 28, 41)

++в (22) ++++а (23)

++++а (25)

++++а, в (26)

+++а (27)

+++а (9)

По результатам иммуноферментного анализа исходных растений из полевой коллекции (данные не приведены) и ОТ-ПЦР-анализа микрорастений, полученных после введения в культуру in vitro тех же клонов, весь

материал был в разной степени поражен вирусами (рис. 2, А). Простые инфекции выявили у 25,3 % растений, однако у большинства отобранных для оздоровления клонов наблюдали смешанные инфекции с одновременным присутствием нескольких видов вирусов в разных сочетаниях, причем максимальное число (пять вирусов) обнаружили у образцов S. tuberosum ssp. tuberosum (см. рис. 2, А).

1. Тестирование микрорастений методом ОТ-ПЦР на наличие вирусов

2. Микроразмножение инфицированных in vitro растений

3. Комплексная химио- и термотерапия:

3.1. черенкование микрорастений — для каждого генотипа на среду Мурасиге-Скуга (MS) без гормонов высаживают 10-20 безлиственных черенков (1-21 междоузлия), выдерживают при 26 °С в течение 1 сут и далее культивируют при 37 °С в течение 4 нед

3.2. получение безлиственных черенков от растений, прошедших этап 3.1, — микрорастения культивируют на среде MS с добавлением рибавирина (30 мг/л) при 20 °С в течение 2-3 сут, затем при 37 °С в течение 4 нед

3.3. получение безлиственных черенков от растений, прошедших этап 3.2, — микрорастения культивируют на среде MS с добавлением рибавирина (30 мг/л) при 20 °С в течение 2-3 сут, затем при 37 °С в течение 4 нед

3.4. получение безлиственных черенков от растений, прошедших этап 3.3, — черенки выдерживают при 26 °С в течение 1 сут, затем микрорастения культивируют на среде MS с добавлением рибавирина (30 мг/л) при 20 °С в течение 4 нед

3.5. перенос микрорастений на среду MS без гормонов, культивирование при 20 °С в течение 2 мес

4. Выделение РНК и тестирование микрорастений методом ОТ-ПЦР на наличие вирусов

5. Микроразмножение оздоровленного материала_

Рис. 1. Модифицированная схема оздоровления микрорастений культурных видов картофеля от вирусных инфекций на основе комплексной термо-химиотерапии. ОТ-ПЦР — ПЦР с обратной транскрипцией.

2. Праймеры, использованные в работе при тестировании на наличие вирусов

Амлифицируемая РНК | Пара паймеров | Последовательность 1 T, °С | Ссылка

Х-вирус картофеля (ХВК) PVX1-f AGGCCACAGGGTCGACTAC 57 (33)

PVX1-r TTGTTGTTCCAGTGATACGACC

Y-вирус картофеля ^ВК) PVY1-f ACGTCCAAAATGAGAATGCC 53 (33)

PVY1-r TGGTGTTCGTGATGTGACCT

Вирус скручивания листьев PLRV1-f CGCGCTAACAGAGTTCAGCC 58 (33)

картофеля (ВСЛК) PLRV1-r GCAATGGGGGTCCAACTCAT

S-вирус картофеля ^ВК) PVS-f TGGCGAACACCGAGCAAATG 57 (35)

PVS-r ATGATCGAGTCCAAGGGCACT

М-вирус картофеля (МВК) PVM4 ACATCTGAGGACATGATGCGC 59 (34)

PVM3 TGAGCTCGGGACCATTCAAC

Контроль обратной tubul-f ATGTTCAGGCGCAAGGCTT 54 (36)

транскрипции (ОТ) tubul-r TCTGCAACCGGGTCATTCAT

Проведенная комбинированная терапия в целом значительно снизила степень вирусного поражения микрорастений (см. рис. 2, Б, рис. 3). По результатам ОТ-ПЦР анализа 42 клона (46 %) от числа прошедших процедуру оздоровления оказались полностью свободными от тестируемых вирусов, у 44 % клонов произошла элиминация некоторых вирусов, и 10 % клонов оздоровить не удалось. Были полностью оздоровлены 16 клонов (69,6 %) с простой инфекцией и 26 клонов (38,2 %) со смешанными инфекциями. В остальных случаях после применения комбинированной терапии число клонов с множественной вирусной инфекцией снизилось. Так, не выявлялись клоны с четырьмя-пятью видами вирусов, значительно снизилось число микрорастений с двумя вирусами (см. рис. 2, Б). Эти результаты согласуются с данными других авторов (16, 27) по сравнительному изучению эффектов комбинированной терапии на растениях картофеля со смешанной (YBK, SBK, ВСЛК, ХВК) и простыми вирусными инфекциями. В то же время I.A. Nasir с соавт. (37) сообщают об оздоровлении растений картофеля со смешанной инфекцией от вирусов S, M, X и отмечают полное отсутствие эффекта оздоровления от YBK и ВСЛК.

Мы не обнаружили существенных различий в частоте оздоровления растений, инфицированных разными вирусами (см. рис. 2, табл. 3). В

целом по выборке (91 клон) ВСЛК был элиминирован у 72,7 % микрорастений, YВК — у 71,4 %, МВК — у 63,9 % и БВК — у 57,4 % клонов. При этом различия между изученными культурными видами картофеля по эффективности оздоровления от каждого из вирусов также не были значимыми (р > 0,05).

Рис. 2. Доля клонов (%) среди образцов культурных видов картофеля с различными вирусными инфекциями до (А) и после (Б) применения предложенной схемы комплексной термо-химио-терапии in vitro: Y, X, S, M и L — соответственно Y-, X-, S-, M-вирус картофеля и вирус скручивания листьев картофеля.

М 1 2 3 4 5 6 7 8 9 10 И 12 13 14 15 16 М М 1 2 3 4 5 6 7 8 9 10 И 12 13 14 15 16 М

б

Рис. 3. Пример ОТ-ПЦР-тестирования микрорастений культурных видов картофеля на наличие Y-вируса картофеля (а), вируса скручивания листьев картофеля (б), Х-вируса картофеля (в), S-вируса картофеля (г), М-вируса картофеля (д) при применении предложенной схемы комплексной термо-химиотерапии с контролем эффективности синтеза матрицы кДНК (е): 1 — полевое растение клона Solanum tuberosum ssp. tuberosum (номер в коллекции ВИР к-3414), которое по результатам ИФА-анализа поражено всеми пятью вирусами (положительный контроль), 2 — вода (отрицательный контроль); 3 и 4 — клон S. tuberosum ssp. andigenum (к-3172), 5 и 6 — клон S. tuberosum ssp. andigenum (к-3240), 7 и 8 — клон S. tuberosum ssp. andigenum (к-17961), 9 и 10 — клон S. phureja (к-12789), 11 и 12 — клон S. phureja (к-5642), 13 и 14 — клон S. stenoto-mum (к-8929), 15 и 16 — клон S. phureja (к-9835) (попарные сравнения результатов ОТ-ПЦР до и после проведения терапии); М — маркер молекулярных масс 100 b.p. + 1500 («СибЭн-зим», Россия). ОТ-ПЦР — ПЦР с обратной транскрипцией, ИФА — иммуноферментный анализ; ВИР — Всероссийский институт генетических ресурсов растений им. Н.И. Вавилова.

3. Частота (%) оздоровления микрорастений культурных видов картофеля от вирусов при применении предложенной схемы комплексной термо-химио-терапии (п = 91, X±x)

Вирус

Solanum phureja

S. stenotomum

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

S. tuberosum ssp. andigenum

S. tuberosum ssp. tuberosum

Всего по выборке

ХВК

YßK

SВK

МВК

ВСЛК

33,3±21,16, в 77^14,7^ 6 63,6±15,2а 6 66^33,3^ 6

50,0±18,9б 23,1±12,2в 66,7±9,8а б 100,0±0,0а

50^50,0^ б в 93,3±6,7а 57,1±13,7б 61,1± 11,8б 77^14,7^ б

100,0±0,0а 75,0±9,9а б 81^12,2^ б 63^11,4^ б 66,7±11,4б

80,0±20,0a, б 71,4±6,5а б 57,4±7,3б 63,9±5,7а б 72,7±7,9а, б

Примечание. ХВК, УВК, SВК, МВК — соответственно Х-, Y-, S- и М-вирус картофеля, ВСКЛ — вирус скручивания листьев картофеля. Значения, отмеченные одинаковыми буквами, достоверно не различаются (р < 0,05).

Полученные нами результаты определения эффективности оздоровления микрорастений от YВК, МВК и ВСЛК методом комбинированной термо-химиотерапии согласуются с данными литературы (9-11, 27, 38, 42) (см. табл. 1). Выход оздоровленных от SВК растений в нашем исследовании

составил 57,4 %, тогда как в других работах (11, 38) сообщается о почти полной (более 90 %) элиминации указанного вируса. Отметим, что в этих исследованиях для тестирования авторы использовали метод ИФА (11, 38), обладающий меньшей чувствительностью по сравнению с применяемым нами ОТ-ПЦР-анализом. Обобщение данных литературы показывает, что в большинстве исследований комплексной терапии подвергались единичные образцы картофеля (16, 17) или очень небольшое число образцов (38, 42), пораженных в основном простыми вирусными инфекциями (17).

Итак, нами предложена модифицированная схема комплексной термо-химиотерапии микрорастений картофеля с контролем вирусной инфекции методом ПЦР с обратной транскрипцией (ОТ-ПЦР). В настоящей работе, применив эту схему, мы получили сопоставимые по эффективности результаты элиминации пяти наиболее вредоносных вирусов на обширной выборке генетически разнообразного материала — 85 образцах (91 клон) трех культурных видов картофеля, что указывает на перспективность дальнейшего использования модифицированного метода термохимиотерапии в центрах генетических ресурсов растений. Предложенная модификация отличается от известных протоколов одновременным воздействием повышенной температуры и рибавирина, а также меньшим числом этапов обработки.

ФГБНУ ФИЦ Всероссийский институт Поступила в редакцию

генетических ресурсов растений им. Н.И. Вавилова, 17 октября 2016 года

190000 Россия, г. Санкт-Петербург, ул. Большая Морская, 42-44, e-mail: tatjana9972@yandex.ru

Sel'skokhozyaistvennaya biologiya [Agricultural Biology], 2017, V. 52, № 1, pp. 95-104

ERADICATION OF VIRUSES IN MICROPLANTS OF THREE CULTIVATED POTATO SPECIES (Solanum tuberosum L., S. phureja Juz. & Buk., S. stenotomum Juz. & Buk.) USING COMBINED THERMO-CHEMOTHERAPY METHOD

O. Yu. Antonova, O. V. Apalikova, Yu. V. Ukhatova, E.A. Krylova, O. Yu. Shuvalov, A.R. Shuvalova, T.A. Gavrilenko

Federal Research Center the N.I. Vavilov All-Russian Institute of Plant Genetic Resources, Federal Agency of Scientific Organizations, 42-44, ul. Bol'shaya Morskaya, St. Petersburg, 190000 Russia, e-mail tatjana9972@yandex.ru ORCID:

Antonova O.Yu. orcid.org/0000-0001-8334-8069 Ukhatova Yu.V. orcid.org/0000-0001-9366-0216

Apalikova O.V. orcid.org/0000-0002-1188-2446 Gavrilenko T.A. orcid.org/0000-0002-2605-6569

The authors declare no conflict of interests Acknowledgements:

The paper was prepared with the support from the Basic Research Program performed at state academies for 20132020. The final stage of the work was partially supported by the Special Complex Program of the Russian Federation (2016-2025) on improving the competitiveness of agricultural products (priority for potato research) Received October 17, 2016 doi: 10.15389/agrobiology.2017.1.95eng

Abstract

A modified method of combined chemo-thermotherapy for eradication the most damaging viruses in potato plants is proposed. The materials for study included 91 clones of 85 accessions of three South-American cultivated species Solanum phureja (18 accessions), S. stenotomum (26 accessions), S. tuberosum (S. tuberosum ssp. andigenum and S. tuberosum ssp. tuberosum) (41 accessions) from the VIR field collection (N.I. Vavilov All-Russian Institute of Plant Genetic Resources). The results of ELISA for 91 clones from the field collection and RT-PCR analysis of the corresponding microplants, when introducing clones into in vitro culture, have shown that all material was infected by viruses (potato viruses Y, X, S, M and potato leafroll virus — PVY, PVX, PVS, PVM and PLRV) to varying degrees. Single infections were detected in 25.3 % of the 91 clones, and the remaining clones were multi-infected and contained several viruses in various combinations. Based on the termo- and chemotherapy protocols as well as complex therapy used in leading potato

genebanks (Leibniz Institute of Plant Genetics and Crop Plant Research — IPK, Germany; International Potato Centre — CIP, Peru), we have developed a modified method of combined therapy comprising three successive cycles of in vitro plant cultivation on Murashige and Skoog basal medium (MS) supplemented with ribavirin (30 mg/l) at 37 °C during 4 weeks. Between the cycles, the microplants were incubated for 2 days at 26 °C on the same medium with ribavirin. Each clone was tested for the presence of viruses by RT (revers transcription) PCR before and after the combined thermo-chemotherapy. In RT-PCR, 42 clones (46 %) were completely free from tested viruses, 44 % were free from some viruses, and 10 % of the clones were unable to improve. On the whole of 91 clones, PLRV was eliminated from 72.7 %, PVY from 71.4 %, PVM from 63.9 % and PVS from 57.4 % of microplants. Differences in elimination frequency between the viruses were not significant (p > 0.05). Also, there were no significant differences in elimination of different viruses between the accessions of different cultivated species. The difference of this modification from IPK protocols (Germany) lays in simultaneous effect of high temperature (37 °C) and ribavirin (instead of sequential application), and, unlike the CIP (Peru) scheme, it comprises less steps.

Keywords: potatoes, Solanum tuberosum, Solanum phureja, Solanum stenotomum, microplants, PVY, PVX, PVS, PVM, PLRV, virus eradication, RT-PCR, thermotherapy, chemotherapy.

REFERENCES

1. Polevaya kollektsiya kartofelya VIR [VIR Potato field collection]. Available http://vir.nw.ru/otd_r.htm#tuber. Accessed Ocober 4, 2016 (in Russ.).

2. Jeffries C.J. Potato. FAO/IPGRI technical guidelines for the safe movement of germplasm. FAO and IPGRI, Rome, 1998.

3. Virus and virus-like diseases of potatoes and production of seed potatoes. G. Loenbenstein, P.H. Berger, A.A. Brunt, R.H. Lawson (eds.). Springer Netherlands, The Netherlands, 2001 (doi: 10.1007/978-94-007-0842-6).

4. Vlasov Yu.I., Larina E.I., Truskinov E.V. Sel'skokhozyaistvennaya fitovirusologiya [Agricultural phytovirology]. St. Petersburg, 2016 (in Russ.).

5. Anisimov B.V., Belov G.L., Varitsev Yu.A., Elanskii S.N., Zhurom-skii G.K., Zavriev S.K., Zeiruk V.N., Ivanyuk V.G., Kuznetsova M.A., Plyakhnevich M.P., Pshechenkov K.A., Simakov E.A., Sklyarova N.P., U s k o v A.I., Y a s h i n a I.M. Zashchita kartofelya ot boleznei, vreditelei i sornyakov [Poteto protection from diseases, pests and weeds]. Moscow, 2009 (in Russ.).

6. Morel G.T., Martin C. Guerison de dahlias atteints dune maladie a virus. Comptes Rendus de l'Académie des Sciences, Ser. III, 1952, 235: 1324-1325.

7. Truskinov E.V. Sel'skokhozyaistvennaya biologiya [Agricultural Biology], 1976, 11(2): 250255 (in Russ.).

8. Wang Q.C., Liu Y., Xie Y.H., You M. Cryotherapy of potato shoot tips for efficient elimination of Potato leaf roll virus (PLRV) and Potato virus Y (PVY). Potato Res., 2006, 49(2): 119-129 (doi: 10.1007/s11540-006-9011-4).

9. B â d â r â u C.L., C h i r u N. Effect of some therapies on potato plantlets infected with potato virus X (PVX). Journal of EcoAgriTourism, 2014, 10(1/28): 11-17.

10. Mahmoud S.Y.M., Hosseny M.H., Ab d e l - G h a f f a r M.H. Evaluation of some therapies to eliminate Potato Y potivirus from potato plants. Int. J. Virol., 2009, 5(2): 64-76 (doi: 10.3923/ijv.2009.64.76).

11. Griffiths H.M., Slack S.A., Dodds J.H. Effect of chemical and heat therapy on virus concentration in in vitro plantlets. Can. J. Bot., 1990, 68: 1515-1521.

12. Cassells A.C., Long R.D. The elimination of potato viruses X, Y, S and M in meristem and explant cultures of potato in the presence of Virazole. Potato Res., 1982, 25: 165-173.

13. Faccioli G., Colalongo M.C. Eradication of Potato virus Y and Potato leafroll virus by chemotherapy of infected potato stem cuttings. Phytopathol. Mediterr., 2002, 41: 76-78.

14. Truskinov E.V., Rogozina E.V. Fiziologiya rastenii, 1997, 43: 432-439 (in Russ.).

15. Atabekov I.G., Tal'yanskii M.E. V sbornike: Dostizheniya sel'skokhozyaistvennoi nauki [In: Progress in agricultural science]. Moscow, 1987: 121-136 (in Russ.).

16. Nascimento L.C., Pio-Ribeiro G., Willadino L., Andrade G.P. Stock indexing and potato virus Y elimination from potato plants cultivated in vitro. Scientia Agricola, 2003, 60(3): 525-530 (doi: 10.1590/S0103-90162003000300017).

17. Dhital S.P., Sakha B.M., Li m H.T. Utilization of shoot cuttings for elimination of PLRV and PVY by thermotherapy and chemotherapy from potato (Solanum tuberosum L.). Nepal Journal of Science and Technology, 2006, 7: 1-6.

18. Techniques in plant virology. Section 4.2. Virus eradication: tissue culture of meristems, thermotherapy, and chemotherapy. L. Salazar, U. Jayasinghe (eds.). International Potato Center, Lima, Peru, 1999.

19. Panta A., Tay D., Gomez R., Zea B., Rojas E., Simon R., Roca W. Status and

impact of the in vitro conservation of root and tubers at the International Potato Centre (CIP). Proc. 15th Triennial Symposium of the International Society for Tropical Root Crops. Lima, Peru, 2009: 15-24.

20. Operational Genebank manual of IPK. Gatersleben, 2011.

21. Lizarraga R., Panta A., Jayasinghe U., Dodds J. Tissue culture for elimination of pathogens. CIP Research Guide 3. International Potato Center, Lima, Peru, 1991.

22. Jianming B., Xiaoling C., Xinxiong L., Huachun G., Xia X., Zhie Z. Can cryopreservation eliminate the Potato virus X (PVX) and Potato spindle tuber viroid (PSTVd)? Bioscience Methods, 2012, 3(5): 34-40 (doi: 10.5376/bm.2012.03.0005).

23. Faccioli G. Control of potato viruses using meristem and stem-cutting cultures, thermo-therapy and chemotherapy. In: Virus and virus-like diseases of potatoes and production of seed-potatoes. G. Loebenstein, P.H. Berger, A.A Brunt, R.H. Lawson (eds.). Springer Netherlands, 2001: 365-390 (doi: 10.1007/978-94-007-0842-6_28).

24. Heldak J. Detection of potato virus S by RT-PCR in potato regenerants derived from in vitro heat-treated shoot tips. Acta fytotechnica et zootechnica, 2001, 4: 275-277.

25. Klein R.E., Livingston C.H. Eradication of potato viruses X and S from potato shoot-tip cultures with ribavirin. Phytopathology, 1983, 73(7): 1049-1050 (doi: 10.1094/Phyto-73-1049).

26. Yang L., Nie B., Liu J., Song B. A reexamination of the effectiveness of ribavirin on eradication of viruses in potato plantlets in vitro using ELISA and quantitative RT-PCR. Am. J. Potato Res., 2014, 91(3): 304-311 (doi: 10.1007/s12230-013-9350-z).

27. Sanchez G.E., Slack S.A., Dodds J.H. Response of selected Solanum species to virus eradication therapy. Am. Potato J., 1991, 68: 299-315 (doi: 10.1007/BF02853668).

28. Hawkes J.G. The potato. Evolution, biodiversity, genetic resources. Belhaven Press, London, 1990.

29. Bukasov S.M. Trudy po prikladnoi botanike, genetike i selektsii (Leningrad), 1978, 62(1): 335 (in Russ.).

30. Dunaeva S.E., Pendinen G.I., Antonova O.Yu., Shvachko N.A., Volko-va N.N., Gavrilenko T.A. Sokhranenie vegetativno razmnozhaemykh kul'tur v in vitro i kri-okollektsiyakh /Pod redaktsiei T.A. Gavrilenko [Preservation of vegetatively propagated crops in vitro and in cryo collections. T.A. Gavrilenko (ed.)]. St. Petersburg, 2011 (in Russ.).

31. Nabor «Vydelenie total'noi RNK na magnitnykh chastitsakh, pokrytykh SiO2» [Kit for total RNA isolation on magnetic particles coated with SiO2]. Aailable http://www.sileks.com/ru/production.php?folder=189. Accessed September 25, 2016 (in Russ.).

32. Nabor «Sintez pervoi tsepi kDNK (rendom)» firmy Sileks [Kit for first cDNA shain random synthesis. Sileks company]. Available http://www.sileks.com/ru/production.php?folder=65. Accessed September 25, 2016 (in Russ.).

33. S i n g h R.P. Development of the molecular methods for potato virus and viroid detection and prevention. Genome, 1999, 42: 592-604.

34. Xu H., D'Aubin J., Nie J. Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes. Virol. J., 2010, 7: 25 (doi: 10.1186/1743-422X-7-25).

35. B o s t a n H., P e k e r P.K. The feasibility of tetraplex RT-PCR in the determination of PVS, PLRV, PVX and PVY from dormant potato tubers. Afr. J. Biotechnol., 2009, 8(17): 4043-4047.

36. Nicot N., Hausman J.-F., Hoffmann L., Evers D. Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J. Exp. Bot., 2005, 56(421): 2907-2914 (doi: 10.1093/jxb/eri285).

37. Nasir I.A., Tabassum B., Latif Z., Javed M.A., Haider M.S., Javed M.A., Husnain T. Strategies to control potato virus y under in vitro conditions. Pak. J. Phyto-pathol., 2010, 22(1): 63-70.

38. Zapata C., Miller J.C., Jr., Smith R.H. An in vitro procedure to eradicate potato viruses X, Y, and S from Russet Norkotah and two of its strains. In Vitro Cellular & Developmental Biology - Plant, 1995, 31(3): 153-159 (doi: 10.1007/BF02632012).

39. Morozova Z.R. Biologicheskie nauki, 1992, 338(2): 128-134 (in Russ.).

40. Leo nova N.S., Salganik N.I. Sibirskii vestnik sel'skokhozyaistvennoi nauki, 1991, 5: 2528 (in Russ.).

41. Lo p e z - D e l g a d o H., Mora-Herrera M.E., Z a v a l e t a - M a n c e r a H.A., Ca-dena-Hinojosa M., Scott I.M. Salicylic acid enhances heat tolerance and potato virus X (PVX) elimination during thermotherapy of potato microplants. Am. J. Potato Res., 2004, 81(3): 171-176 (doi: 10.1007/BF02871746).

42. Paet C.N., Z a mora A.B. Efficacy of thermotherapy and group culture of isolated potato meristems for the elimination of single and mixed infections of Potato Virus Y, Potato Virus S and Potato Leaf Roll Virus. Philipp. J. Crop. Sci., 1990, 15(2): 113-118.

i Надоели баннеры? Вы всегда можете отключить рекламу.