Научная статья на тему 'Overexpression of dominant-negative Ire1 enzyme in H1299-shE6AP cells increases heat shock element-dependent transcription'

Overexpression of dominant-negative Ire1 enzyme in H1299-shE6AP cells increases heat shock element-dependent transcription Текст научной статьи по специальности «Биологические науки»

CC BY
170
24
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Biotechnologia Acta
CAS
Область наук
Ключевые слова
ENDOPLASMIC RETICULUM STRESS / IRE1 ENZYME / RECOMBINANT PROTEIN EXPRESSION / HEAT SHOCK ELEMENT / LUCIFERASE REPORTER ASSAY / СТРЕС ЕНДОПЛАЗМАТИЧНОГО РЕТИКУЛУМУ / ЕНЗИМ IRE1 / ЕКСПРЕСіЯ РЕКОМ БіНАНТНИХ ПРОТЕїНіВ / ЕЛЕМЕНТ ТЕПЛОВОГО ШОКУ / МЕТОД ЛЮЦИФЕРАЗНОГО РЕПОРТЕРА / СТРЕСС ЭНДОПЛАЗМАТИЧЕСКОГО РЕТИКУЛУМА / ЭНЗИМ IRE1 / ЭКСПРЕССИЯ РЕКОМБИНАНТНЫХ ПРОТЕИНОВ / ЭЛЕМЕНТ ТЕПЛОВОГО ШОКА

Аннотация научной статьи по биологическим наукам, автор научной работы — Tsymbal D.O., Minchenko О. H.

To investigate IRE1-dependent branch of endoplasmic reticulum stress pathway in various cancer cells we created cDNA-constructs for expression of dominant-negative inositol-requiring enzyme 1 IRE1 and cytosolic domain of IRE1 fused on a C-terminus with c-Myc and 6xHis tags. The non-small-cell lung carcinoma cells H1299-shE6AP were transfected with these constructs. Using anti-c-Myc antibodies we demonstrated effective, dose-dependent expression of dominant-negative and cytosolic IRE1 proteins. In order to investigate IRE1-mediated, heat shock element-dependent transcription, the cells were further transfected with a reporter construct containing heat shock element. We observed that overexpression of dnIRE1 in H1299-shE6AP cells led to significant induction of heat shock element-dependent transcription. This observation may reflect the induction of heat shock genes, which contribute to cellular adaptation to inhibition of native IRE1, a key sensory-signaling enzyme of endoplasmic reticulum stress pathway, which suppresses cancer cell proliferative capacities and alternates the expression of numerous genes, including many transcription factors.

i Надоели баннеры? Вы всегда можете отключить рекламу.
iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Текст научной работы на тему «Overexpression of dominant-negative Ire1 enzyme in H1299-shE6AP cells increases heat shock element-dependent transcription»

EXPERIMENTAL ARTICLES

UDK 577.112:616

doi: 10.15407/biotech8.06.009

OVEREXPRESSION OF DOMINANT-NEGATIVE IRE1 ENZYME IN H1299-shE6AP CELLS INCREASES HEAT SHOCK ELEMENT-DEPENDENT TRANSCRIPTION

D. O. Tsymbal Palladin Institute of Biochemistry

О. H. Minchenko of the National Academy of Sciences of Ukraine, Kyiv

E-mail: [email protected]

Received 12.10.2015

To investigate IRE1-dependent branch of endoplasmic reticulum stress pathway in various cancer cells we created cDNA-constructs for expression of dominant-negative inositol-requiring enzyme 1 IRE1 and cytosolic domain of IRE1 fused on a C-terminus with c-Myc and 6xHis tags. The non-small-cell lung carcinoma cells H1299-shE6AP were transfected with these constructs. Using anti-c-Myc antibodies we demonstrated effective, dose-dependent expression of dominant-negative and cytosolic IRE1 proteins. In order to investigate IRE1-mediated, heat shock element-dependent transcription, the cells were further transfected with a reporter construct containing heat shock element. We observed that overexpression of dnIRE1 in H1299-shE6AP cells led to significant induction of heat shock element-dependent transcription. This observation may reflect the induction of heat shock genes, which contribute to cellular adaptation to inhibition of native IRE1, a key sensory-signaling enzyme of endoplasmic reticulum stress pathway, which suppresses cancer cell proliferative capacities and alternates the expression of numerous genes, including many transcription factors.

Key words: endoplasmic reticulum stress, IRE1 element, luciferase reporter assay.

Endoplasmic reticulum (ER) stress signaling pathway is activated as an adaptive response to accumulation of misfolded proteins in its lumen, which might be caused by a handful of factors including increase in protein synthesis, oxidative stress, perturbations of calcium homeostasis, etc. [1, 2]. In mammals three transmembrane stress sensors, namely PERK (double stranded RNA activated protein kinase, PRK-like ER kinase, IRE1/ERN1 (inositol-requiring enzyme 1, endoplasmic reticulum to nucleus signaling 1) and ATF6 (activating transcription factor 6) are responsible for downstream signaling during endoplasmic reticulum stress [3, 4]. Among those IRE1 is a dominant sensory-signaling enzyme, conserved through different groups of organisms including green plants and yeast [5]. IRE1 protein consists of a sensory domain, which is localized in the lumen, a transmembrane part and a cytoplasmic domain with two distinct enzymatic activities: kinase

enzyme, recombinant protein expression, heat shock

and endoribonuclease [4]. The main function of a kinase domain is IRE1 autophosphorylation, which in turn leads to its dimerization and subsequent activation of endoribonuclease. Activated IRE1 endoribonuclease performs a unique cytosolic splicing of transcription factor XBP1 (X-box binding protein 1) mRNA, as well as specific degradation of a subset of mRNAs [6-8]. Taken together these enzymatic activities contribute to stress alleviation and restoration of cellular homeostasis [5, 8, 9].

For glioma and lung adenocarcinoma it was shown that IRE1 knockdown results in suppression of tumor growth due to alterations in expression of numerous pro- and antiangiogenic genes, tumor suppressors, cyclins and transcription factors [10-16]. IRE1 is considered to be a promising target for new chemotherapeutic agents, especially in case of aggressive cancers, such as glioma, where surgery still remains a poor therapeutic option [17].

9

BIOTECHNOLOGIA ACTA, V. 8, No 6, 2015

One of the approaches used to inhibit IRE1 function in living cell is a dominantnegative cDNA-constructs strategy, based on the mammalian expression vector systems, such as pcDNA3.1 [4, 10, 11]. In this case, a plasmid DNA, used for transfection, includes a modified cDNA sequence of IRE1 gene, which codes a protein lacking one of or both enzymatic activities [11, 18]. In U87 glioma cells, which express dominant-negative IRE1 (dnIRE1), the downregulation of its phosphorylated form was demonstrated along with an absence of transcription factor XBP1 (X-box binding protein 1) splicing, confirming the inhibition of both kinase and endoribonuclease activities of this bifunctional enzyme [18, 19]. Advantages of this method include the possibility of selection of clones with stable IRE1 knockdown and, in comparison to RNA interference, exclusion of possible off-target effects [11, 18, 20]. Still the detection of modified IRE1 forms, as well as purification of recombinant proteins depends on specific antibodies, which increases the complexity and cost of experimental procedures.

One of the most intriguing aspects of cancer cell biology is the cross-talk between different signaling pathways. For instance, a number of heat shock proteins are known to be involved in the ER stress response. When ER folding capacity is exceeded, molecules of chaperone BiP/GRP78 dissociate from sensory domains of IRE1, PERK and ATF6, which leads to their activation [21]. It was shown, that stressful conditions result in increased BiP/GRP78 expression in glioma cells regardless of IRE1-XBP1 branch of ER stress [14]. Activation of transcription factor ATF6 results in increased expression of ER chaperones GRP78 and GRP94 [21]. In contrast, induction of two HSP40 (heat shock protein-40)-like proteins Erdj4 and p58IPK upon ER stress seems to be mostly XBP1-dependent [22]. Along with other regulatory elements, such as XBP1 of ATF6 binding sites, promoters of HSP genes contain the so-called heat shock elements (HSE), various arrays of inverted repeats of the pentameric sequence nGAAn which are responsible for binding of heat shock transcription factors under conditions of thermal stress [23]. Up to date, it was largely unknown for mammalian cells whether disruption of certain branches of ER stress pathway results in compensatory induction of heat shock response.

The aim of this work was creation of improved cDNA-constructs of IRE1 with C-terminal c-Myc and 6xHis tags for

investigation of the IRE1-dependent branch of endoplasmic reticulum stress pathway. Using original dnIRE1 expression construct in combination with HSE-containing luciferase reporter we studied the effect of dnIRE1 overexpression on the HSE-dependent transcription in a subline of non-small cell lung carcinoma H1299-shE6AP [24]. It was shown, that overexpression of dominantnegative IRE1 led to significant induction of HSE-dependent transcription.

Materials and Methods

Creation of genetic constructs pcDNA4+dnIREl andpcDNA4+cytIREl

Genetic constructs pcDNA4+dnIRE1 and pcDNA4+cytIRE1 were based on the vector pcDNA4-Myc/His-A (Invitrogen, USA). The vector was linearized simultaneously with two restriction enzymes HindIII and XbaI (NEB, USA). Coding sequence of dominant-negative IRE1 (dnIRE1) was obtained via PCR with forward 5'-GAGAAGCTTCCTCGCCATGCCGG-3' and reverse 5'-GACTCTAGAGTCTTG-TTCCAGGGAG-3'primers, which include recognition sites for HindIII and XbaI restriction enzymes, respectively. Coding sequence of cytoplasmic domain of IRE1 (cytIRE1) was obtained via PCR with forward 5'-CATAAGCTTTCCCCTGAGCATGCAT-3' primer with HindIII recognition site and reverse 5'-CTTCTAGAGAGGGCGTCTGGAG-3' primer with XbaI recognition site. Introduction of restriction enzyme recognition sites into primer sequences was done in order to enable sticky end directional cloning. As a PCR template we used a construct with a full length IRE1 cDNA sequence in pcDNA3.1 vector (kindly provided by prof. M. Moenner, University of Bordeaux-1, France). Obtained fragments were ligated into a linearized vector using T4 DNA ligase (NEB, USA) according to manufacturer’s instructions. DH5a E. coli cells were heat-shock transformed with pcDNA4+dnIRE1 and pcDNA4+cytIRE1 constructs and subsequently plated on a solid LB medium with 100 pg/mL ampicillin. Nucleotide sequence of created constructs was determined by GATC Biotech (Germany) using T7 and BGH standard sequencing primers.

Cell culture

H1299-shE6AP cells (kindly provided by prof. Martin Scheffner, University of Konstanz, Germany, described in [24]) were cultured in DMEM (Gibco, USA) with 10% FBS at 37 °C, 5% СО2.

10

Experimental articles

Transfection

For transient expression of dnIREl and cytIREl H1299-shE6AP cells that reached > 90% confluence were transfected with different combinations of plasmid DNA by lipofection using Lipofectamine 2000 (Invitrogen, USA) according to manufacturer’s instructions. Transfection was performed in 6-well polystyrene plates (Greiner bio-one, Germany). For analytical expression of dnIREl cells were transfected with plasmid DNA in following combinations: 100 ng pcDNA4+dnIRE1, 300 ng P-galactosidase expression construct [24] 400 ng pcDNA4-Myc/His-A vector (Invitrogen, USA); 500 ng pcDNA4+dnIRE1, 300 ng P-galac-tosidase expression construct. For analytical expression of cytIRE1 cells were transfected with plasmid DNA in following combinations: 500 ng pcDNA4+cytIRE1, 300 ng P-galactosidase expression construct, 1 500 ng pcDNA4-Myc/His-A vector, 1 000 ng pcDNA4+cytIRE1, 300 ng P-galactosidase expression construct, 1 000 ng pcDNA4-Myc/ His-A vector, 2 000 ng pcDNA4+cytIRE1, 300 ng P-galactosidase expression construct.

As a control cells were transfected with 500 ng vector pcDNA4-Myc/His-A together with 300 ng P-galactosidase expression construct.

For luciferase reporter assay cells were transfected with 500 ng pcDNA4+dnIRE1, 1 000 ng 3xHSE-luc construct (kindly provided by prof. Martin Scheffner, University of Konstanz, Germany), 300 ng P-galactosidase expression construct. Control cells were transfected with 500 ng pcDNA4-Myc/His-A vector, 1 000 ng 3xHSE-luc-construct, 300 ng P-galactosidase expression construct.

Cell lysis and P-galactosidase assay

Cell lysis was performed 24 hours after transfection in TnN buffer (100 mM Tris-HCl, 100 mM NaCl, 1% NP-40, 1 mM Pefabloc, 1 pg/mL Aprotinin/Leupeptin, 1 mM DTT, pH 8.0). In order to determine the P-galactosidase activity 5 pl of lysate was mixed with 5 pl ortho-nitrophenyl-P-galactoside (4 mg/ml in 100mM Na2HPO4, pH 7.0 ) and 120 pl buffer Z (100 mM Na2HPO4, 10 mM KCl, 1 mM MgSO4, 50 mM P-mercaptoethanol, pH 7.0) and incubated at 37 °C for 10 min. Measurements were performed at Wallac 1420 multilabel counter (PerkinElmer, USA) at wave length of 405 nm. Obtained values were used for calculation of relative transfection efficiency.

Western blot

Cell lysates were normalized with regard to relative transfection efficiency. Protein transfer to PVDF membrane (Millipore, Germany) was performed with wet electroblotter (Bio-Rad, USA) for 90 min at 60 V. After the transfer membrane was incubated in 5% milk powder for 48 hours at 4 °С. Anti-c-Myc mouse monoclonal antibodies (Abcam, UK) in 1:1 000 dilutions were used for detection of recombinant proteins. Blots were developed using WesternBright ECL (Advansta, USA) Signal detection was performed in the imaging system LAS-3000 (Fujifilm, Japan).

Luciferase reporter assay

Luciferase activity in lysates was measured using Luciferase Assay system kit (Promega, USA) on Wallac 1420 multilabel counter (PerkinElmer, USA). Measurement results were normalized according to relative transfection efficiency. For statistical analysis of obtained data we performed one sample T-test.

Results and Discussion

Genetic constructs pcDNA4+dnIRE1 and pcDNA4+cytIRE1

Creation of an appropriate dominantnegative form of IRE1 requires a construction of its truncated cDNA sequence, which would code intact N-terminal signal peptide (residues 1-18), sensory (residues 18-443) and transmembrane (residues 444-464) domains, but would lack the full sequences of kinase (residues 571-831) and endoribonuclease (residues 837-963) parts (Fig. 1, А). To the contrary, for expression of cytosolic domain of IRE1 protein must be truncated from N-terminus for at least 464 residues. At the same time, for expression of C-terminally tagged proteins it is necessary to maintain the open reading frame and avoid formation of stop codons during the cloning. A 1690 bp long fragment coding a dominant-negative IRE1, which corresponds to amino acid residues 1 to 537 of native IRE1, was obtained via PCR and subsequently digested with restriction enzymes HindIII and XbaI (Fig. 1, B). Respective fragment was ligated into pcDNA4-Myc/His-A vector. Similar approach was used to obtain a coding sequence of cytosolic domain of IRE1. A 1557 long PCR product, which corresponds to amino acid residues 488 to 977 of a full length IRE1 was restriction digested and ligated into vector (Fig. 1, C).

11

BIOTECHNOLOGIA ACTA, V. 8, No 6, 2015

A

B

C

Fig. 1. Schematic representation of expected protein products:

A — domain structure of native IRE1;

B — dominant-negative form of IRE1 (dnIRE1) with С-terminal c-Myc and 6xHis tags;

C — cytosolic domain of IRE1 (cytIRE1) with С-terminal c-Myc and 6xHis tags.

S — N-terminal signal peptide, TM — transmembrane region, RNase — endoribonuclease

Sequencing results have shown that the sequences of the fragments were as expected and open reading frames remained intact, thus fusing the desired IRE1 parts with C-terminal tags.

Analytical expression of IRE1 cytosolic domain and dominant-negative IRE1 in H1299-shE6AP cells

In order to determine, whether the created constructs are suitable for expression of desired protein products, we transfected H1299-shE6AP cells with different amounts of pcDNA4+dnIRE1 and pcDNA4+cytIRE1 plasmids and performed the Western blot analysis with anti-c-Myc antibody. Our data show, that dominant-negative IRE1 is expressed as a protein product of expected size (Fig. 2). For both dnIRE1 and cytIRE1 the amount of protein depends on the quantity of plasmid, used for transfection (Fig. 2, Fig. 3). Surprisingly, in case of cytIRE1 two fragments of similar size were detected (Fig. 3).

Interestingly, a similar picture was earlier observed by different authors, who also utilized different cloning strategies. For instance, two bands were detected by Wang and co-authors after expressing a cytoplasmic domain of murine IRE1, fused N-terminally with GAL4 and C-terminally tagged with c-Myc epitope [25]. However, they did not attempt to explain their observation. Uemura and co-authors expressed a C-terminally HA-tagged cytoplasmic domain of IRE1 (residues 469-977) and observed two distinct

protein products on the blot [26]. The authors suggest that the bands represent an autophosphorylated and non-phosphorylated forms of IRE1 cytoplasmic domain, supporting their suggestion by the fact, that a kinase-dead cytoplasmic part of IRE1 forms a single band on the blot. Moreover, they demonstrate that the resulting recombinant protein is able to catalyze the XBP1 mRNA splicing [26]. Thus, we can assume that pcDNA4+cytIRE1 construct is suitable for expression of a catalytically active cytoplasmic domain of IRE1. Notably, no second band was observed in case of dnIRE1, providing additional evidence for its dominant-negative character (Fig. 2).

Overexpression of dominant-negative IRE1 influences HSE-mediated transcription in H1299-shE6AP cells

Previously, it was shown that in yeast a constitutive activation of heat shock response (HSR) by overexpression of Hsf1 (heat shock factor 1) is able to rescue growth in IRE1 knockout cells [27]. Moreover, it was demonstrated that in IRE1-deficient yeast cells heat shock response is activated by ER stress, while in wild-type IRE1 cells no ER stress-mediated activation of HSR was observed [27]. In this study we aimed to test, whether overexpression of dnIRE1 alone, with no additional stress induction is sufficient for activation of HSE-dependent transcription in mammalian cells. For this we used an HSE-containing luciferase reporter construct

12

Experimental articles

V 100 500

70 kDa 55 kDa

Fig. 2. Western blot analysis of dnIREl expression in H1299-shE6AP cells:

V — cells transfected with empty vector pcDNA-4mycHis4; 100 — cells transfected with 100 ng pcDNA4+dnIRE1; 500 — cells transfected with 500 ng pcDNA4+dnIRE1

(3xHSE-luc) (Fig. 4). H1299-shE6AP cells were co-transfected with pcDNA4+dnIRE1, 3хHSE-luc and P-galactosidase expression construct. Luciferase activity was measured in cell lysates and normalized according to relative transfection efficiency. We found that overexpression of dominant-negative IRE1 led to more than two-fold increase in HSE-mediated transcription (Fig. 5). These results suggest that inhibition of IRE1 function may lead to heat-shock independent activation of HSR pathway in mammalian cells, which in turn may contribute to restoration of cellular homeostasis.

Overall, as a result of this study we created original expressing constructs for dominantnegative IRE1 and cytoplasmic part of IRE1.

2000 1000 500

70 kDa______________

55 kDa---- ~-

Fig. 3. Western blot analysis of cytIRE1 expression in H1299-shE6AP cells:

2000 — cells transfected with 2000 ng pcDNA4+cytIRE1; 1000 — cells transfected with 1000 ng pcDNA4+cytIRE1; 500 — cells transfected with 500 ng pcDNA4+cytIRE1

The respective recombinant proteins possess C-terminal c-Myc and 6xHis tags, which make their detection easier, and also provide an option for effective affinity purification. Despite promising indirect evidence, the enzymatic activity of cytIRE1 is still to be tested. We were first to demonstrate that overexpression of dominant-negative IRE1 alone with no additional thermal or ER stress leads to activation of HSE-dependent transcription in H1299-shE6AP cells. This might reflect a cellular adaptive response to inhibition of IRE1 activity. An interaction between two pathways: endoplasmic reticulum stress and heat shock response in cancer cells is an interesting and therapeutically relevant topic, which requires further attention.

Synthetic poly-A signal 3xHSE Adenovirus major late promotor Luciferase

B TAGAACATTCTAGCTAGAATGTTCTAGATCTAGAACATTCTA

Fig. 4. Schematic representations of 3xHSE-luc reporter construct:

A — general scheme; B — nucleotide sequence of the region containing heat shock response elements (3xHSE — single elements underlined, inverted repeats marked in red)

Fig. 5. Effect of dominant-negative IRE1 overexpression on HSE-mediated transcription in H1299-shE6AP cells:

A — relative luciferase activity, * — P < 0.05; n = 4; B — Western blot analysis of dnIRE1 expression:

V — cells transfected with empty vector pcDNA4-Myc/His-A; dn — cells transfected with pcDNA4+dnIRE1

13

BIOTECHNOLOGIA ACTA, V. 8, No 6, 2015

REFERENCES

1. Moenner M., Pluquet O., Bouchecareilh M., Chevet E. Integrated endoplasmic reticulum stress responses in cancer. Cancer Res. 2007, 67 (22), 10631-10634.

2. Wang S., Kaufman R. J. The impact of the unfolded protein response on human disease. J. Cell Biol. 2012, 197 (7), 857-867.

3. Marciniak S. J., Ron D. Endoplasmic reticulum stress signaling in disease. Physiol. Rev. 2006, 86 (4), 1133-1149.

4. Minchenko O. H., Kharkova A. P., Baka-lets T. V., Kryvdiuk I. V. Endoplasmic reticulum stress, its sensor and signalling systems and the role in regulation of gene expression at malignant tumor growth and hypoxia. Ukr. Biokhim. Zh. 2013, 85 (5), 5-16. (In Ukrainian).

5. Chen Y., Brandizzi F. IRE1: ER stress sensor and cell fate executor. Trends in Cell Biol. 2013, 23 (11), 547-555.

6. Korennykh A. V., Egea P. F., Korostelev A. A., Finer-Moore J., Zhang C., Shokat K. M., Stroud R. M., Walter P. The unfolded protein response signals through high-order assembly of Ire1. Nature. 2009, 457 (7230), 687-693.

7. Oikawa D., Tokuda M., Hosoda A., Iwawaki T. Identification of a consensus element recognized and cleaved by IRE1a. Nucl. Acids Res. 2010, 38 (18), 6265-6273.

8. Maurel M., Chevet E., Tavernier J., Gerlo S. Getting RIDD of RNA: IRE1 in cell fate aregulation. Trends Biochem. Sci. 2014, 39 (5), 245-254.

9. Acosta-Alvear D., Zhou Y., Blais A., Tsikitis M., Lents N. H., Arias C., Lennon C. J., Kluger Y., Dynlacht B. D. XBP1 controls diverse cell type- and condition-specific transcriptional regulatory networks. Mol. Cell. 2014, 27 (1), 53-66.

10. Auf G., Jabouille A., Guerit S., Pineau R., Delugin M., Bouchecareilh M., Magnin N., Favereaux A., Maitre M., Gaiser T., von Deimling A., Czabanka M., Vajkoczy P., Chevet E., Bikfalvi A., Moenner M. Inositol-requiring enzyme 1alpha is a key regulator of angiogenesis and invasion in malignant glioma. Proc. Natl. Acad. Sci. USA. 2010, 107 (35), 15553-15558.

11. Drogat B., Auguste P., Nguyen D. T., Bouchecareilh M., Pineau R., Nalbantoglu J., Kaufman R. J., Chevet E., Bikfalvi A., Moenner M. IRE1 signaling is essential for ischemia-induced vascular endothelial growth factor-A expression and contributes to angiogenesis and tumor growth in vivo. Cancer Res. 2007, 67 (14), 6700-6707.

12. Drogat B., Bouchecareilh M., North S., Petibois C., Deleris G., Chevet E., Bikfalvi A., Moenner M. Acute L-glutamine deprivation compromises VEGF-A up-regulation in

A549/8 human carcinoma cells. J. Cell. Physiol. 2007, 212 (2), 463-472.

13. Minchenko D. O., Karbovskyi L. L., Danilovs-kyi S. V., Moenner M., Minchenko O. H. Effect of hypoxia and glutamine or glucose deprivation on the expression of retinoblastoma and retinoblastoma-related genes in IRE1 knockdown glioma U87 cell line. Am. J. Mol. Biol. 2012, 2 (1), 142-152.

14. Minchenko O. H., Tsymbal D. O., Minchen-ko D. O., Moenner M., Kovalevska O. V., Lypova N. M. Inhibition of kinase and endoribonuclease activity of IRE1/IRE1a affects expression of proliferation-related genes in U87 glioma cells. Endoplasm. Reticul. Stress Dis. 2015, 2 (1), 18-29.

15. Minchenko O. H., Tsymbal D. O., Minchen-ko D. O., Kovalevska O. V., Karbovskyi L. L. Bikfalvi A. Inhibition of IRE1 signaling enzyme affects hypoxic regulation of the expression of E2F8, EPAS1, HOXC6, ATF3, TBX3 and FOXF1 genes in U87 glioma cells. Ukr. Biochem. J. 2015, 87 (2), 76-87.

16. Minchenko O. H., Tsymbal D. O., Minchenko D. O. IRE-1alpha signaling as a key target for suppression of tumor growth. Single Cell Biol. 2015, 4(3), 118.

17. Jiang D., Niwa M., Koong A. C. Targeting the IRE1-XBP1 branch of the unfolded protein response in human diseases. Semin. Cancer Biol. 2015, V. 33, P. 48-56.

18. Auf G., Jabouille A., Delugin M., Guerit S., Pineau R., North S., Platonova N., Maitre M., Favereaux A., Vajkoczy P., Seno M., Bikfalvi A., Minchenko D., Minchenko O., Moenner M. High epiregulin expression in human U87 glioma cells relies on IRE1a and promotes autocrine growth through EGF receptor. BMC Cancer. 2013, 13(1), 597.

19. Minchenko D. О., Kubajchuk К. I., Ratush-na O. O., Komisarenko S. V., Minchenko O. H. The vascular endothelial growth factor genes expression in glioma U87 cells is dependent from IRE1 signaling enzyme function. Adv. Biol. Chem. 2012, 2 (2), 198-206.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

20. Jackson A., Linsley P. S. Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application. Nat. Rev. Drug Discov. 2010, 9 (1), 57-67.

21. J ger R., Bertrand M. J. M., Gorman A. M., Vandenabeele P., Samali A. The unfolded protein response at the crossroads of cellular life and death during endoplasmic reticulum stress. Biol. Cell. 2012, 104 (5), 259-270.

22. Lee A-H., Iwakoshi N. N., Glimcher L. H. XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol. Cell. Biol. 2003, 23 (21), 7448-7459.

23. Morimoto R. I., Sarge K. D., Abravaya K. Transcriptional regulation of heat shock

14

Experimental articles

genes. A paradigm for inducible genomic responses. J. Biol. Chem. 1992, 267 (31), 21987-21990.

24. K hnle S., Mothes B., Matentzoglu K., Scheffner M. Role of the ubiquitin ligase E6AP/UBE3A in controlling levels of the synaptic protein Arc. Proc. Natl. Acad. Sci. USA. 2013, 110 (22), 8888-8893.

25. Wang X., Harding H. P., Zhang Y., Joli-coeur E. M., Kuroda M., Ron D. Cloning of

mammalian Ire1 reveals diversity in the ER stress response. EMBO J. 1998, 17 (19), 5708-5717.

26. Uemura A., Oku M., Mori K., Yoshida H. Unconventional splicing of XBP1 mRNA occurs in the cytoplasm during the mammalian unfolded protein response. J. Cell Sci. 2009, 122 (16), 2877-2886.

27. Liu Y., Chang A. Heat shock response relieves ER stress. EMBO J. 2008, 27 (7), 1049-1059.

НАДЕКСПРЕС1Я ДОМ1НАНТ-НЕГАТИВНО1 ФОРМИ ЕНЗИМУ IRE1 У СУБЛ1НП КЛ1ТИН H1299-shE6AP ПОСИЛЮ6 ТРАНСКРИПЦ1Ю, ЩО ЗАЛЕЖИТЬ В1Д ЕЛЕМЕНТУ ТЕПЛОВОГО ШОКУ

Д. О. Цимбал, О. Г. Мшченко

1нститут 6ioxiMii iM. О. В. Палладша НАН Укра!ни, Ки!в

E-mail: [email protected]

Метою роботи було дослщження функцп ГОЕ1-залежно1 гглки сигнального шляху стре-су ендоплазматичного ретикулуму в рiзних пухлинних клНинах. Для цього було створено кДНК-конструкцп для експресп домшант-не-гативно! форми ензиму IRE1 — dnIRE1 та цитозольного домену IRE1, злитих на С-кш-щ i3 c-Myc ештопом та 6xHis. Цими кон-струкцiями було трансфiковано клiтини не-дрiбноклiтинноi карциноми легень сублiнii H1299-shE6AP i за допомогою анти-с-Myc антитип показано ефективну дозозалежну експретю протеiнiв домiнант-негативноi форми та цитозольного домену IRE1. Для дослщження опосе-редковано! IRE1-транскрипцii, залежно! ввд еле-менту теплового шоку, клггини були повторно трансфiкованi люциферазним репортером, який включав елемент теплового шоку. Встановлено, що надекспресiя dnIRE1 у клггинах сублiнi! H1299-shE6AP призводить до вираженого шду-кування транскрипцi!, залежно! вщ елементу теплового шоку. Це може свщчити про поси-лення експресп гешв теплового шоку, яш вщь грають важливу роль в адаптацн цих клiтин до пригшчення активностi нативного IRE1, ключо-вого сенсорно-сигнального ензиму стресу ендоп-лазматичного ретикулуму, що знижуе здатнiсть пухлинних клНин до пролiферацi! та модифшуе експресiю численних генiв, включаючи велику ктьктть транскрипцiйних факторiв.

Ключовi слова: стрес ендоплазматичного ретикулуму, ензим IRE1, експретя рекомбь нантних проте!шв, елемент теплового шоку, метод люциферазного репортера.

СВЕРХЭКСПРЕССИЯ ДОМИНАНТ-НЕГАТИВНОЙ ФОРМЫ ЭНЗИМА IRE1 В СУБЛИНИИ КЛЕТОК H1299-shE6AP УСИЛИВАЕТ ТРАНСКРИПЦИЮ, ЗАВИСЯЩУЮ ОТ ЭЛЕМЕНТА ТЕПЛОВОГО ШОКА

Д. А. Цымбал, А. Г. Минченко

Институт биохимии им. О. В. Палладина НАН Украины, Киев

E-mail: [email protected]

Целью работы было исследование функции IRE1-зависимой ветви сигнального пути стресса эндоплазматического ретикулума в разных опухолевых клетках. Для этого были созданы кДНК-конструкции для экспрессии доминант-негативной формы энзима IRE1 и цитозольного домена IRE1, сшитых на С-конце с c-Myc эпитопом и 6xHis. Этими конструкциями были трансфицированы клетки немелкоклеточной карциномы легких сублинии H1299-shE6AP и с помощью анти-с-Myc антител показана эффективная дозозависимая экспрессия протеинов доминант-негатив-ной формы и цитозольного домена IRE1. Для исследования опосредованной IRE1-транскрипции, зависимой от элемента теплового шока, клетки были повторно трансфицированы люцифераз-ным репортером, включающим элемент теплового шока. Установлено, что сверхэкспрессия dnIRE1 в клетках сублинии H1299-shE6AP приводит к выраженной индукции транскрипции, зависимой от элемента теплового шока. Это может свидетельствовать об усилении экспрессии генов теплового шока, играющих важную роль в адаптации клеток к подавлению активности нативного IRE1, ключевого сенсорно-сигнального энзима стресса эндоплазматического ретикулума, который снижает способность опухолевых клеток к пролиферации и модифицирует экспрессию многочисленных генов, включая большое количество транскрипционных факторов.

Ключевые слова: стресс эндоплазматического ретикулума, энзим IRE1, экспрессия рекомбинантных протеинов, элемент теплового шока, метод люциферазного репортера.

15

i Надоели баннеры? Вы всегда можете отключить рекламу.