CC BY
20
UDC 577.112:616 https://doi.org/10.15407/biotech10.04.034
IRE1 KNOCKDOWN MODIFIES THE EFFECT OF GLUTAMINE DEPRIVATION ON THE EXPRESSION OF A SUBSET OF PROTEASES IN U87 GLIOMA CELLS
O. V. Halkin1 1Palladin Institute of Biochemistry
O. O. Riabovol1 of the National Academy of Sciences of Ukraine, Kyiv
D. O. Minchenko1, 2
A. Y. Kuznetsova1 2Bohomolets National Medical University, Kyiv, Ukraine
O. O. Ratushna1 O. H. Minchenko1
E-mail: [email protected]
Received 09.06.2017
The aim of this research was to study the effect of glutamine deprivation on the expression of genes encoding for HTRA1/PRSS11, LONP1/PRSS15, and some cathepsins in U87 glioma cells in relation to inhibition of IRE1 (inositol requiring enzyme-1). It was shown that in control glioma cells (transfected by empty vector) glutamine deprivation up-regulated the expression of LONP1, CTSD, CTSF, CTSO, and CTSS genes, down-regulated HTRA1, CTSC, and CTSK gene expressions, and did not significantly change the expression of CTSA, CTSB, and CTSL genes. Inhibition of IRE1 signaling enzyme function in U87 glioma cells modified the effect of glutamine deprivation on the expression of HTRA1, LONP1, CTSD, CTSL, CTSO, and CTSS genes: removed the effect of glutamine deprivation on HTRA1 and CTSO genes, introduces on CTSL gene, reduced — on CTSD gene, and enhanced — on LONP1 and CTSS genes. Therefore, glutamine deprivation affect the expression level of most studied genes in relation to the functional activity of IRE1 enzyme, a central mediator of endoplasmic reticulum stress, which responsible for control of cell proliferation and tumor growth.
Key words: mRNA expression, HTRA1/PRSS11, LONP1/PRSS15, cathepsins, IRE1 knockdown, glutamine deprivation, U87 glioma cells.
The HtrA serine peptidase 1 (HTRA1) is a secreted enzyme that regulate the availability of insulin-like growth factors (IGFs) by cleaving IGF-binding proteins, inhibits signaling mediated by TGF-beta family members and thus has been suggested to be a regulator of cell proliferation [1-3]. HTRA1 overexpression exerts anti-tumor effect by blocking the NF- B signaling pathway [4]. The mitochondrial Lon peptidase 1 (LONP1), also known as serine protease 15 (PRSS15), is a mitochondrial matrix protein that belongs to the Lon family of ATP-dependent proteases and mediates the selective degradation of misfolded, unassembled or oxidatively damaged polypeptides as well as certain short-lived regulatory proteins in the mitochondrial matrix, but not aggregated proteins [5, 6]. It may also have a chaperone function in the assembly of protein complexes into inner membrane, and participate in the regulation of gene expression in mitochondria
and maintenance of the integrity of the mitochondrial genome [7]. Lon peptidase 1 is not responsible for oncogenic transformation, but that is essential for proliferation and survival of cancer cells, because it is a key enzyme controlling mitochondrial bioenergetics in cancer [7, 8]. Therefore, this peptidase is an essential protein for life and that it also performs a critical function in tumorigenesis by regulating the bioenergetics of cancer cells as a central regulator of mitochondrial activity in oncogenesis [6]. Recently was shown that inhibition of Lon peptidase 1 by the triterpenoid, anticancer molecule, alters mitochondrial function and is associated to cell death in RKO human colon cancer cells [9]. Moreover, LONP1 expression is induced by various stimuli, including reactive oxygen species and hypoxia, and provides protection against cell stress [10]. Down-regulation of this enzyme is associated with organism ageing
and with cell senescence, while up-regulation is observed in cancer cells, and is correlated with a more aggressive phenotype of tumors [6]. Consequently, the mitochondrial Lon peptidase 1 is at the crossroads of oxidative stress, ageing and cancer. It was also shown that mitochondrial proteins, LONP1 and prohibitin, are over-expressed in HTRA2(-/-) mouse embryonic fibroblast cells and HTRA2 knock-down HEK293T cells, indicating that mitochondrial HTRA2 might be an upstream regulator of mitochondrial homeostasis [11].
A key role in cellular protein turnover has a group of lysosomal proteases, cathepsins, which play multiple roles in cancer and autophagy [12, 13]. Cathepsin A (CTSA), also known as chaperone protective protein and protective protein for beta-galactosidase, is a carboxypeptidase, which present at the cell surface, endoplasmic reticulum, nucleus and also secreted outside the cell. CTSA associates with these enzymes and exerts a protective function necessary for their stability and activity as well as involved in tumor progression and metastasis by degrading the extracellular matrix [13, 14]. It plays a significant role in the processing of endogenous bioactive peptides and is also involved in inhibition of chaperon-mediated autophagy [12]. In was recently shown that over-expression of CTSA associates with the cellular oxidative stress response [15].
Cysteine proteinase CTSB is also present at the cell surface, nucleus and mitochondrion, implicated in tumor invasion and metastasis as well as toll-like receptor (TLR) signaling pathway [16]. It was also shown that inhibition of cathepsin B activity by clioquinol-ruthenium complex impairs tumor cell invasion [17]. It is interesting to note that extracellular matrix remodeling by cell adhesion-related processes is critical for proliferation and tissue homeostasis [18]. Moreover, Huber et al. [19] shown that the UPAR (urokinase plasminogen activator receptor) interacts with CYR61 (cysteine-rich angiogenic inducer 61) and the YB-1 (Y-box-binding protein 1) in the triple-negative breast cancer and that both interactors significantly correlated with expression levels of cathepsin B and c-MET as well as the tumor grade. The expression level of CYR61 strongly correlated with cathepsin D level [19]. Cathepsin B also participates in autophagy, which mediates tumor suppression via cellular senescence [20].
Cysteine proteinase CTSC is associated with an enhanced degradation of glycosamino-glycans, proteoglycans, and glycoproteins, and results in their decreased tissue content. Its
increased tissue activity is observed in many pathological conditions [11]. This cathepsin releases the glycosidases from complexes formed with cathepsin A, and reinstates their activity [11]. Furthermore, CTSB, CTSC, CTSD, and are increased in numerous tumors [21, 22]. It is interesting to note that matrix-metalloproteinase-9 is cleaved and activated by cathepsin K [23]. Moreover, almost identical substrate specificities were determined for cysteine cathepsins K, L and S [24].
The unfolded protein response/ endoplasmic reticulum stress is responsible for enhanced cancer cell proliferation and knockdown of IRE1, a major signaling pathway of endoplasmic reticulum stress, by a dominant-negative construct of IRE1 (dnIRE) resulted in a significant antiproliferative effect on glioma growth [25-27]. The rapid growth of solid tumors generates micro-environmental changes in association to nutrient deprivation, hypoxia, and acidosis, which promote neovascularisation, cell survival and proliferation [28-30]. IRE1 (inositol requiring enzyme-1) is a key regulator of cell life and death processes [28, 31]. Recently, we have shown that glutamine deprivation affects the expression of proliferation related genes in U87 glioma cells and that IRE1 knockdown modifies glutamine deprivation effects on these genes expression possibly contributing to suppression of glioma cells proliferation [32]. Previously, we have shown that most cathepsins as well as LONP1 are regulated by IRE1 signaling and hypoxia [33], but the precise mechanism of the exhibited by IRE1 knockdown is not clear yet.
Malignant gliomas are highly aggressive tumors with very poor prognosis and glutamine is important to development and a more agressive behaviour of these tumors [30, 34, 35]. However, mechanisms whereby cancer cells regulate glutamine catabolism remain largely unknown [32, 35, 36]. A better knowledge of tumor responses to glutamine deprivation condition is required to elaborate new therapeutical strategies of cell sensibilization, based on the blockade of survival mechanisms.
The aim of this study was investigation the effect of glutamine deprivation condition on the expression of HTRA1/PRSS11, LONP1/ PRSS15, and a subset of cathepsins in glioma cells in relation to inhibition of IRE1, a major signaling enzyme of endoplasmic reticulum stress, with hopes of elucidating its mechanistic part in the development and progression of glioma and the contribution to unfolding protein response.
Materials and Methods
Cell Lines and Culture Conditions. In this study we used two sublines of U87 glioma cells, which are growing in high glutamine (4.5 g/l) Dulbecco's modified Eagle's minimum essential medium (DMEM; Gibco, Invitrogen, USA) supplemented with glutamine (2 mM), 10% fetal bovine serum (Equitech-Bio, Inc., USA), streptomycin (0.1 mg/ml; Gibco) and penicillin (100 units/ml; Gibco) at 37 °C in a 5% CO2 incubator. One subline was obtained by selection of stable transfected clones with overexpression of vector (pcDNA3.1), which was used for creation of dominant-negative constructs (dnIRE1). This untreated subline of glioma cells (control glioma cells) was used as control 1 in the study of effects of glutamine deprivation on the expression level of PRSS15 and a subset of cathepsins mRNA. Second subline was obtained by selection of stable transfected clones with overexpression of dnIRE1 and has suppressed both protein kinase and endoribonuclease activities of this bifunctional sensing and signaling enzyme of endoplasmic reticulum stress. The expression level of all studied genes in these cells was compared with cells, transfected by vector (control 1). The subline, which overexpress dnIRE1, was also used as control 2 for investigation the effect of glutamine deprivation condition on the expression level of studied in cells with inhibited function of signaling enzyme IRE1. Clones were received by selection at 0.8 mg/ml geneticin (G418) and grown in the presence of this antibiotic at lower concentration (0.4 mg/ml). Glutamine deprivation condition were created by changing the complete DMEM medium into culture plates on the medium without glutamine (from Gibco) and plates were exposed to this condition for 16 h.
The suppression level of IRE1 both enzymatic activity in glioma cells that overexpress a dominant-negative construct of inositol requiring enzyme-1 was estimated previously [37] by determining the expression level of XBP1 alternative splice variant (XBP1s), a key transcription factor in IRE1 signaling, using cells treated by tunicamycin (0.01 mg/ml during 2 hrs). Efficiency of XBP1s inhibition was 95%. Moreover, the proliferation rate of glioma cells with mutated IRE1 is decreased in 2 fold [38]. Thus, the blockade of both kinase and endoribonuclease activity of signaling enzyme IRE1 has significant effect on proliferation rate of glioma cells.
RNA isolation. Total RNA was extracted from glioma cells using Trisol reagent (Invitrogen, USA) and chloroform as previously described [38]. The RNA was precipitated by equal volume of 2-propanol. The RNA pellets were washed with 75% ethanol and dissolved in nuclease-free water. For additional purification RNA samples were re-precipitated with 95% ethanol and re-dissolved again in nuclease-free water. RNA concentration as well as spectral characteristics was measured using NanoDrop Spectrophotometer.
Reverse transcription and quantitative PCR analysis. QuaniTect Reverse Transcription Kit (QIAGEN, Hilden, Germany) was used for cDNA synthesis as described previously [38]. The expression level of HTRA1, LONP1, CTSA, CTSB, CTSC, CTSD, CTSF, CTSK, CTSL, CTSO, and CTSS mRNA were measured in glioma cell line U87 and its subline (clone 1C5) by real-time quantitative polymerase chain reaction using "QuantStudio 5 Real-Time PCR System" (Applied Biosystems) and „RotorGene RG-3000" qPCR (Corbett Research, Germany) and Absolute qPCR SYBRGreen Mix (Thermo Fisher Scientific, ABgene House, Epsom, Surrey, UK). For amplification 40 cycles (94 °C — 20 s, 55 °C — 20 s and 72 °C — 20 s) were used. Polymerase chain reaction was performed in triplicate.
For quantitative polymerase chain reaction were used the pair of primers specific for each studied gene (Table). The primers were received from "Sigma-Aldrich" (St. Louis, MO, USA). The quality of amplification products was analyzed by melting curves and by electrophoresis using 2% agarose gel. An analysis of quantitative PCR was performed using special computer program "Differential Expression Calculator". The values of LONP1, CTSA, CTSB, CTSC, CTSD, CTSF, CTSK, CTSL, CTSO, and CTSS mRNA expressions were normalized to the expression of beta-actin mRNA and represented as percent of control 1 (100%).
Statistical analysis. All values are expressed as mean ± SEM from triplicate measurements performed in 4 independent experiments. Statistical analysis was performed according to Student's t-test using Excel program as described previously [39].
Results and Discussion
To determine if glutamine deprivation regulates the genes of interest through the IRE1 branch of endoplasmic reticulum stress response, we investigated the effect
of glutamine deprivation condition on the expression of genes encoding HTRA1/PRSS11, LONP1/PRSS15, and a subset of cathepsins in U87 glioma cells in relation to knockdown of IRE1 signaling enzyme, which is a major component of the unfolded protein response/ endoplasmic reticulum stress. As shown in Fig. 1, the exposure of control glioma cells (transfected by empty vector) upon glutamine deprivation condition leads to up-regulation of LONP1 mRNA expression (+39%) as compared to cells growing with glutamine. The expression level of CTSD, CTSF, CTSO, and CTSS genes is also up-regulated at this experimental condition: +64, +34, +18, and +27%, correspondingly, as compared to control cells. At the same time, the exposure of control glioma cells to glutamine deprivation condition leads to down-regulation of HTRA1, CTSC, and CTSK gene expressions: -19, -26, and -15%, correspondingly (Fig. 1). Furthermore, the expression of CTSA, CTSB, and CTSL genes in control glioma cells was resistant to glutamine deprivation.
As shown in Fig. 2, inhibition of IRE1 signaling enzyme function in U87 glioma cells leads to significant up-regulation of LONP1,
CTSD, CTSF, and CTSS gene expressions (+59, +38, +40, and +55%, correspondingly), as compared to control dnIRE1 expressed glioma cells. At the same time, the expression of HTRA1 and CTSO genes does not change significantly upon glutamine deprivation in glioma cells without functional activity of signaling enzyme IRE1. Results, presented in Fig. 2, also demonstrate that exposure of glioma cells (transfected by dnIRE1) upon glutamine deprivation condition leads to down-regulation of CTSC and CTSK mRNA expression (-31 and -19%, correspondingly) as compared to cells growing with glutamine. Therefore, inhibition of IRE1 signaling enzyme function in U87 glioma cells by dnIRE1 introduces the sensitivity of CTSL gene expression to glutamine deprivation (+35%).
As shown in Fig. 3 and 4, inhibition of IRE1 signaling enzyme function in U87 glioma cells modifies the effect of glutamine deprivation on the expression of HTRA1, LONP1, CTSD, CTSL, CTSO, and CTSS genes and does not change significantly the sensitivity of CTSA, CTSB, CTSF, and CTSK gene expressions to glutamine deprivation condition. Thus, IRE1 knockdown in U87 glioma cells significantly
Fig. 1. Effect of glutamine deprivations on the expression level of mitochondrial lon peptidase 1 (LONP1), also known as PRSS15 (serine protease 15), mRNA in control U87 glioma cells stable transfected with vector (Vector) and cells with inhibited function of signaling enzyme IRE1 (dnIRE1) measured by qPCR:
values of LONP1/PRSS15 mRNA expressions were normalized to beta-actin mRNA and represented as percent of control 1 (100%); mean ± SEM; hereinafter: * — P < 0.05, ** —P < 0.01 compare to control
Fig. 2. Effect of glutamine deprivation on the expression level of cathepsin A (CTSA) mRNA in control U87 glioma cells stable transfected with vector (Vector) and cells with inhibited function of signaling enzyme
IRE1 (dnIRE1) measured by qPCR:
values of this mRNA expressions were normalized to beta-actin mRNA and represented as percent of control 1 (100%)
enhances effect of glutamine deprivation on the expression of LONP1 and CTSS genes, but removes the sensitivity of HTRA1 and CTSO genes to glutamine deprivation. The expression of CTSL mRNA was resistant to glutamine deprivation in control glioma cells with functionally active IRE1, but glutamine deprivation introduces sensitivity of this gene expression to glutamine deprivation (Fig. 4), indicating IREl-dependent up-regulation of this gene expression by glutamine. At the same time, as shown in Fig. 3, the sensitivity of CTSD gene expression to glutamine deprivation is IREl-dependent, because IRE1 knockdown significantly reduces the effect of glutamine deprivation on the expression of CTSD gene. Additionally, we found that the expression of genes encoding for cathepsin A and B are resistant to glutamine deprivation condition both in glioma cells containing dnIREl and cells with IRE1 knockdown.
Thus, this study has demonstrated that glutamine deprivation affects the expression of the majority of the genes encoding cathepsins as well as HTRA1/PRSS11 and LONP1/PRSS15 preferentially in the IRE1-dependent manner and that these genes potentially contribute to regulation of cell proliferation, apoptosis, and metastasis.
The endoplasmic reticulum stress is responsible for enhanced cancer cell proliferation and knockdown of IRE1, a major signaling pathway of endoplasmic reticulum stress, resulted in a significant anti-proliferative effect on glioma cell proliferation and tumor growth [35, 37, 38]. Our results demonstrate that IRE1 knockdown eliminates the suppressive effect of glutamine deprivation on the expression of HTRA1 gene. The HTRA1 gene overexpression exerts anti-tumor effect by blocking the NF-kB signaling pathway and regulates the availability of insulin-like growth factors (IGFs) by cleaving IGF-binding proteins, and thus has been suggested to be a regulator of cell proliferation [1-4]. Thus, our data correlates well with these results. It is known that LONP1 have variable functions [5, 6] and increased level of this gene transcript both in control and IRE1 knockdown glioma cells upon glutamine deprivation can be responsible for selective degradation of misfolded and certain short-lived regulatory proteins in the mitochondrial matrix, which should be induced by glutamine deprivation [26]. It is possible that the regulation of this gene expression by glutamine deprivation is mediated by IRE1 and blockade of this signaling enzyme function enhances the sensitivity of
Fig. 3. Relative effect of glutamine deprivation on the expression level of CTSA, CTSB, CTSC, CTSD,
and CTSF genes in two types of glioma cells:
hereinafter: control cells transfected by vector (Vector) and cells with a deficiency of the signaling enzyme IRE1 (dnIREl) measured by quantitative PCR. values of these gene expressions were normalized to beta-actin and represented as percent of corresponding control (control for both cell types is accepted as 100%); NS — no significant changes
ISO
•5 в
g 160
V
ъ
ïû g
140
ï «E
В loo e
S 80
GO
20
MS
"h
P < 0.05
I I
il
Control
Vector ctnlREl U87 U87
CTSK
Vector U87
_
№
ill
P < 0 05 p < 0.05
if
л
dnIREl Vector dnIREl Vector U 37 U 87 U 87 U87
dnIREl U 87
CTSL
CTSO
STS5
Vector U87
P i 0.05
dnIREl Vector dnIREl U87 U87 U87
LONP1
HTRA1
Fig. 4. Relative effect of glutamine deprivation on the expression level of CTSK, CTSL, CTSO, CTSS, and LONP1/PRSS15 genes in two types of glioma cells
Characteristics of the primers used for quantitative real-time polymerase chain reaction
Gene symbol Gene name and EC number (Enzyme Commission number) Primer's sequence Nucleotide numbers in sequence GenBank accession number
HTRA1 HtrA serine peptidase 1 F: 5' - tggaatctcctttgcaatcc 1175- -1194 NM_ 002775
(PRSS11) (serine protease 11, IGF R: 5' - acgctcctgagatcacgtct 1365- -1346
binding)
EC number=»3.4.21.-»
LONP1 mitochondrial lon pepti- F: 5'- atctacctgagcgacatggg 1111- 1130 NM_ 004793
(PRSS15) dase 1 (hLON ATP- R: 5' - ttacggtgggtctgcttgat 1304- 1285
dependent protease;
serine protease 15)
EC number=»3.4.21.-»
NM_ 000308
CTSA cathepsin A F: 5' - cagctgcttccacctacctc 1432- 1451
(chaperone protective R: 5' cttctggttgagggaatcca 1682- 1663
protein; carboxypeptidase
C) C) EC number=»3.4.16.5»
CTSB cathepsin B F: 5'- caagccaccccagagagtta 360- 379 NM_ 001908
EC number=»3.4.22.1» R: 5'- tagaggccaccagaaaccag 680- -661
cathepsin C F: 5' tcagaccccaatcctaagcc 949- 968 NM_ 001814
CTSC EC number=»3.4.14.1» R: 5'- gcatggagaatcagtgcctg 1108- 1089
CTSD cathepsin D F: 5'- caagttcgatggcatcctgg 712- -731 NM_ 001909
EC number=»3.4.23.5» R: 5'- cgggtgacattcaggtagga 930- 911
CTSF cathepsin F F: 5'- aggagctcttggactgtgac 1052- 1071 NM_ 003793
EC number=»3.4.22.41» R: 5' - tagaccttggccttctctgc 1217- 1198
CTSK cathepsin K F: 5' gctcaaggttctgctgctac 238- 257 NM_ 000396
EC number=»3.4.22.38» R: 5' - tcttcactggtcatgtcccc 483- 464
CTSL cathepsin L F: 5'- acagcttcacaatggccatg 562- -581 NM_ 001912
EC number=»3.4.22.15» R: 5'- aagcccaacaagaaccacac 717- 698
CTSO cathepsin O F: 5'- attatggctgcaatggaggc 549- 568 NM_ 001334
EC number=»3.4.22.42» R: 5'- gggccaaaggtaagaagtgc 768- -749
CTSS cathepsin S F: 5'- aacaagggcatcgactcaga 272- 291 NM_ 004079
EC number=»3.4.22.27» R: 5'- aagaaagaaggatgacgcgc 468- 449
ACTB beta-actin F: 5'- ggacttcgagcaagagatgg 747- 766 NM_ 001101
R: 5'- agcactgtgttggcgtacag 980- -961
the expression of LONP1 gene to glutamine deprivation. Thus, the increased expression of the LONP1 gene upon glutamine deprivation is agreed well with functional role of this protease [7, 8]. It is possible that the regulation of this gene expression by glutamine deprivation is mediated by other signaling pathways of endoplasmic reticulum stress like ATF3, HOXC6, and FOXF1 genes [40]. Therefore, LONP1 protease is an essential enzyme for life and plays a critical function in tumorigenesis by regulating the bioenergetics of cancer cells as a central regulator of mitochondrial activity in oncogenesis. Furthermore, the expression of this mitochondrial protease is induced
by various stimuli, including hypoxia and reactive oxygen species, and possibly provides protection against cell stress [6].
Glutamine deprivation is reduced the expression level of CTSC gene, which is a tissue-specific regulator of carcinogenesis [21], in glioma cells independently of IRE1 activity and possibly contributes in suppression of tumor growth. We have also shown that the expression of cathepsin D, which has multiple roles in cancer [19, 22], is also increased both in control and IRE1 knockdown glioma cells upon glutamine deprivation, but inhibition of IRE1 signaling enzyme in glioma cells decreases the sensitivity of this gene expression to glutamine
deprivation. It is possible that this decrease of sensitivity of CTSD gene expression to glutamine deprivation upon IRE1 inhibition can contribute to the suppression of proliferation of glioma cell without IRE1 function [37, 38]. Moreover, almost all cathepsins have specific functions and consequently diverse changes upon glutamine deprivation [41, 42].
In conclusion, our results demonstrate that the majority of the genes studied are both responsive to glutamine deprivation in IRE1 dependent manner and potentially contribute to regulation of cell proliferation, metastasis, and apoptosis through various signaling pathways and stress related transcription, but
the mechanisms and functional significance of activation of their expression through IRE1 inhibition as well as glutamine deprivation are different and warrant further investigation. Thus, the changes observed in the studied genes expression partially agree with slower proliferation rate of glioma cells harboring dnIRE1, attesting to the fact that targeting the unfolded protein response is viable, perspective approach in the development of cancer therapeutics, because glutamine starvation by glutaminase inhibitor, transporter inhibitor, or glutamine depletion has shown to have significant anti-cancer effect in pre-clinical studies [28, 37, 43, 44].
REFERENCES
1. Nigro A., Menon R., Bergamaschi A., Clovis Y. M, Baldi A., Ehrmann M., Comi G., De Pietri To-nelli D., Farina C., Martino G., Muzio L. MiR-30e and miR-181d control Radial Glia cell proliferation via HtrAl modulation. Cell Death Disease. 2012, V. 3, P. e360.
2. Lehner A., Magdolen V., Schuster T., Kotzsch M., Kiechle M., Meindl A., Sweep F. C., Span P. N., Gross E. Downregulation of serine protease HTRA1 is associated with poor survival in breast cancer. PLoS One. 2013, V. 8, P.e60359.
3. Singh H., Li Y., Fuller P. J., Harrison C., Rao J., Stephens A. N. , Nie G. HtrA3 is downregulated in cancer cell lines and significantly reduced in primary serous and granulosa cell ovarian tumors. J. Cancer. 2013, V. 4, P, 152-164.
4. Xia J., Wang F., Wang L., Fan Q. Elevated serine protease HtrA1 inhibits cell proliferation, reduces invasion, and induces apoptosis in esophageal squamous cell carcinoma by blocking the nuclear factor-KB signaling pathway. Tumour Biol. 2013, V. 34, P. 317-328.
5. Quirós P. M., Español Y., Acín-Pérez R., Rodríguez F., Bárcena C., Watanabe K., Calvo E., Loureiro M., Fernández-García M. S., Fueyo A., Vázquez J., Enríquez J. A., López-Otín C. ATP-dependent Lon protease controls tumor bioenergetics by reprogramming mitochondrial activity. Cell Rep. 2014, V. 8, P. 542-556.
6. Bezawork-Geleta A., Brodie E. J., Dougan D. A., Truscott K.N. LON is the master protease that protects against protein aggregation in human mitochondria through direct degradation of misfolded proteins. Sci. Rep. 2015, V. 5, P. 17397.
7. Pinti M., Gibellini L., Nasi M., De Biasi S., Bortolotti C. A., Iannone A., Cossarizza A. Emerging role of Lon protease as a master regulator of mitochondrial functions. Biochim. Biophys. Acta. 2016, V. 1857, P. 1300-1306.
8. Quirös P. M., Bärcena C., Löpez-Otin C. Lon protease: A key enzyme controlling mitochondrial bioenergetics in cancer. Mol. Cell. Oncol. 2014, V. 1, P. e968505.
9. Gibellini L., Pinti M., Bartolomeo R., De Biasi S., Cormio A., Musicco C., Carnevale G., Pecorini S., Nasi M., De Pol A., Cossarizza A. Inhibition of Lon protease by triterpenoids alters mitochondria and is associated to cell death in human cancer cells. Oncotarget. 2015, V. 6, P.25466-25483.
10. Pinti M., Gibellini L., Liu Y., Xu S., Lu B., Cossarizza A. Mitochondrial Lon protease at the crossroads of oxidative stress, ageing and cancer. Cell. Mol. Life Sci. 2015, V. 72, P. 4807-4824.
11. Goo H. G, Rhim H., Kang S. HtrA2/Omi influences the stability of LON protease 1 and prohibitin, proteins involved in mitochondrial homeostasis. Exp. Cell Res. 2014, V. 328, P. 456-465.
12. Timur Z. K., Akyildiz Demir S., Seyrantepe V. Lysosomal cathepsin A plays a significant role in the processing of endogenous bioactive peptides. Front. Mol. Biosci. 2016, V. 3, P. 68.
13. Haznedaroglu I. C., Malkan U. Y. Local bone marrow renin-angiotensin system in the genesis of leukemia and other malignancies. Eur. Rev. Med. Pharmacol. Sci. 2016, V. 20, P. 4089-4111.
14. Minarowska A., Minarowski L., Karwows-ka A., Milewska A. J., Gacko M. Role of cathepsin A and cathepsin C in the regulation of glycosidase activity. Folia Histochem. Cytobiol. 2012, V. 50, P. 20-24.
15. Petrera A., Kern U., Linz D., Gomez-Auli A., Hohl M., Gassenhuber J., Sadowski T., Schilling O. Proteomic Profiling of Cardiomyocyte-Specific Cathepsin A Overexpression Links Cathepsin A to the Oxidative Stress Response. J. Proteome Res. 2016, V. 15, P. 3188-3195.
16.Aggarwal N., Sloane B. F. Cathepsin B: multiple roles in cancer. Proteomics Clin. Appl. 2014, V. 8, P. 427-437.
17. Mitrovic A., Kljun J., Sosic I., Gobec S., Turel I., Kos J. Clioquinol-ruthenium complex impairs tumour cell invasion by inhibiting cathepsin B activity. Dalton Trans. 2016, V. 45, P.16913-16921.
18. Mezawa M., Pinto V. I., Kazembe M. P., Lee W. S., McCulloch C. A. Filamin A regulates the organization and remodeling of the pericellular collagen matrix. FASEB J. 2016, V. 30, P. 3613-3627.
19. Huber M. C., Falkenberg N., Hauck S. M., Priller M., Braselmann H., Feuchtinger A., Walch A., Schmitt M., Aubele M. Cyr61 and YB-1 are novel interacting partners of uPAR and elevate the malignancy of triple-negative breast cancer. Oncotarget. 2016, V. 7, P. 44062-44075.
20. Jiang Y., Woosley A. N., Sivalingam N., Natarajan S., Howe P. H. Cathepsin-B-mediated cleavage of Disabled-2 regulates TGF-ß-induced autophagy. Nat. Cell Biol. 2016, V. 18, P. 851-863.
21. Ruffell B., Affara N. I., Cottone L., Junan-kar S., Johansson M., DeNardo D. G., Korets L., Reinheckel T., Sloane B. F., Bogyo M., Coussens L. M. Cathepsin C is a tissue-specific regulator of squamous carcinogenesis. Genes Dev. 2013, V. 2, P. 2086-2098.
22. Park Y. J., KimE.K., Bae J. Y., Moon S., Kim J. Human telomerase reverse transcriptase (hTERT) promotes cancer invasion by modulating cathepsin D via early growth response (EGR)-1. Cancer Lett. 2016, V. 370, P. 222-231.
23. Christensen J., Shastri V. P. Matrix-metallo-proteinase-9 is cleaved and activated by cathepsin K. BMC Res. Notes. 2015, V. 8, P. 322.
24. Vizovisek M., Vidmar R., Van Quickelberghe E., Impens F., Andjelkovic U., Sobotic B., Stoka V., Gevaert K., Turk B., Fonovic M. Fast profiling of protease specificity reveals similar substrate specificities for cathepsins K, L and S. Proteomics. 2015, V. 15, P. 2479-2490.
25. Auf G., Jabouille A., Guerit S., Pineau R., Delugin M., Bouchecareilh M., Magnin N., Favereaux A., Maitre M., Gaiser T., von Deimling A., Czabanka M., Vajkoczy P., Chevet E., Bikfalvi A., Moenner M. Inositol-requiring enzyme 1alpha is a key regulator of angiogenesis and invasion in malignant glioma. Proc. Natl. Acad. Sci. USA. 2010, V. 107, P. 15553-15558.
26. Malhotra J. D., Kaufman R. J. ER stress and its functional link to mitochondria: role in cell survival and death. Cold Spring Harb. Perspect. Biol. 2011, V. 3, P. a004424.
27. Pluquet O., Dejeans N., Chevet E. Watching the clock: endoplasmic reticulum-mediated control of circadian rhythms in cancer. Ann. Med. 2014, V. 46, P. 233-243.
28. Hetz C, Chevet E., Harding H. P. Targeting the unfolded protein response in disease. Nat. Rev. Drug Discov. 2013, V. 12, P. 703-719.
29. Lenihan C. R., Taylor C. T. The impact of hypoxia on cell death pathways. Biochem. Soc. Trans. 2013, V. 41, P. 657-663.
30. Colombo S. L, Palacios-Callender M, Frakich N, Carcamo S, Kovacs I., Tudzarova S, Moncada S. Molecular basis for the differential use of glutamine and glutamine in cell proliferation as revealed by synchronized HeLa cells. Proc. Natl. Acad. Sci. USA. 2011, V. 108, P. 21069-21074.
31. Manié S. N., Lebeau J., Chevet E. Cellular mechanisms of endoplasmic reticulum stress signaling in health and disease. 3. Orchestrating the unfolded protein response in oncogenesis: an update. Am. J. Physiol. Cell Physiol. 2014, V. 307, P. C901-C907.
32. Tsymbal D. O, Minchenko D. O, Riabovol O. O, Ratushna O. O., Minchenko O. H. IRE1 knockdown modifies glucose and glutamine deprivation effects on the expression of proliferation related genes in U87 glioma cells. Biotechnol. acta. 2016, 9 (1), 26-37.
33. Minchenko O. H, Riabovol O. O, Halkin O. V., Minchenko D. O, Ratushna O. O. ERN1-knockdown modifies hypoxic regulation of cathepsins and LONP1 genes expression in U87 glioma cells. Ukr. Biochem. J. 2017, 89 (2), 55-69.
34. Li Y, Erickson J. W., Stalnecker C. A., Katt W. P., Huang Q., Cerione R. A., Rama-chand ran S. Mechanistic basis of glutaminase activation: a key enzyme that promotes glutamine metabolism in cancer cells. J. Biol. Chem. 2016, V. 291, P. 20900-20910.
35. Daye D., Wellen K. E. Metabolic reprogramming in cancer: Unraveling the role of glutamine in tumorigenesis. Semin Cell Dev Biol. 2012, V. 23, P. 362-369.
36. Hensley C. T., Wasti A. T., DeBerardinis R. J. Glutamine and cancer: cell biology, physiology, and clinical opportunities. J. Clin. Invest. 2013, V. 123, P. 3678-3684.
37. Auf G., Jabouille A., Delugin M., Guérit S., Pineau R., North S., Platonova N., Maitre M., Favereaux A., Vajkoczy P., Seno M., Bikfalvi A, Minchenko D., Minchenko O., Moenner M. High epiregulin expression in human U87 glioma cells relies on IRE1alpha and promotes autocrine growth through EGF receptor. BMC Cancer. 2013, V. 13, P. 597.
38. Minchenko D. O., Danilovskyi S. V., Kryvdiuk I. V., Bakalets T. V., Lypova N. M,, Karbovsky L. L, Minchenko O. H. Inhibition of ERN1 modifies the hypoxic regulation of the expression of TP53-related genes in U87 glioma cells. Endoplasm. Reticul. Stress Dis. 2014, V. 1, P. 18-26.
39. Minchenko O. H., Tsymbal D. O., Minchen-ko D. O., Kubaichuk O. O. Hypoxic regulation
of MYBL1, ME ST, TCF3, TCF8, GTF2B, GTF2F2 and SNAI2 genes expression in U87 glioma cells upon IRE1 inhibition. Ukr. Biochem. J. 2016, V. 88, P. 52-62.
40. Minchenko O. H., Tsymbal D. O, Moenner M., Minchenko D.O.,Kovalevska O. V., Lypova N.M. Inhibition of the endoribonuclease of ERN1 signaling enzyme affects the expression of proliferation-related genes in U87 glioma cells. Endoplasm. Reticul. Stress Dis. 2015, V. 2, P. 18-29.
41. Mori J., Tanikawa C., Funauchi Y., Lo P. H., Nakamura Y., Matsuda K. Cystatin C as a p53-inducible apoptotic mediator that
ПРИГН1ЧЕННЯ IRE1 ЗМ1НЮ€ ЕФЕКТ ДЕФ1ЦИТУ ГЛУТАМ1НУ НА ЕКСПРЕС1Ю ГРУПИ ПРОТЕАЗ У КЛ1ТИНАХ ГЛ1ОМИ ЛШП U87
О. В. Галтн1, О. О. Рябовол1, Д. O. Мтченко1, 2, А. Ю. Кузнецова1' О. О. Ратушна1, O. Г. Мтченко1
Институт 6ioxiMii iM. О.В. Палладша
НАН Украши, Кшв 2Нащональний медичний ушверситет iM. О. О. Богомольця, Кшв, Украша
E-mail: [email protected]
Метою роботи було вивчити вплив дефщи-ту глутамшу на експремю гешв, що кодують HTRA1/PRSS11, LONP1/PRSS15 та деяк ка-тепсини у клiтинах глiоми лши U87 за умов пригнiчення IRE1 (inositol requiring enzyme-1). Показано, що у контрольних (трансфшованих пустим вектором) клггинах глiоми дефiцит глутамшу посилював експресiю генiв LONP1, CTSD, CTSF, CTSO та CTSS, пригшчував експреаю ге-нiв HTRA1, CTSC i CTSK, але ктотно не впливав на експресiю гешв CTSCA, CTSB та CTSL. При-гшчення функцii сигнального ензиму IRE1 у кль тинах глiоми лши U87 змшювало ефект дефщи-ту глутамшу на експреию генiв HTRA1, LONP1, CTSD, CTSL, CTSO та CTSS: зшмало ефект дефь циту глутамшу на гени HTRA1 та CTSO, шдуку-вало — на ген CTSL, зменшувало — на ген CTSD i посилювало — на гени LONP1 та CTSL. Таким чином, дефщит глутамшу змшював рiвень екс-пресii бiльшостi дослщжених генiв залежно вiд функцiональноi активноси ензиму IRE1, центрального медiатора стресу ендоплазматичного ретикулума, який вщповвдае за контроль проль ферацii клиин та росту пухлин.
Ключовi слова: експремя мРНК, HTRA1/ PRSS11, LONP1 /PRSS15, катепсини, пригнь чення IRE1, дефщит глутамшу, клггини глк-ми лши U87.
regulates cathepsin L activity. Cancer Sci. 2016, V. 107, P. 298-306.
42. Sudhan D. R., Rabaglino M. B., Wood C. E., Siemann D. W. Cathepsin L in tumor angiogenesis and its therapeutic intervention by the small molecule inhibitor KGP94. Clin. Exp. Metastasis. 2016, V. 33, P. 461-473.
43. Johnson G. G., White M. C., Grimaldi M. Stressed to death: targeting endoplasmic reticulum stress response induced apoptosis in gliomas. Curr. Pharm. Des. 2011, V. 17, P. 284-292.
44. Fung M. K. L., Chan G. C. Drug-induced amino acid deprivation as strategy for cancer therapy. Hematol. Oncol. 2017, V. 10, P. 144.
УГНЕТЕНИЕ IRE1 ИЗМЕНЯЕТ ЭФФЕКТ
ДЕФИЦИТА ГЛУТАМИНА НА ЭКСПРЕССИЮ ГРУППЫ ПРОТЕАЗ В КЛЕТКАХ ГЛИОМЫ ЛИНИИ U87
О. В. Галкин1, О. О. Рябовол1, Д. О. Минченко1' 2, А.Ю. Кузнецова1, О. О. Ратушна1, О. Г. Минченко1
1Институт биохимии им. А.В. Палладина
НАН Украины, Киев 2Национальный медицинский университет им. А.А. Богомольца, Киев, Украина
E-mail: [email protected]
Целью работы было изучить влияние дефицита глутамина на экспрессию генов, кодирующих HTRA1/PRSS11, LONP1/PRSS15 и некоторые катепсины в клетках глиомы линии U87 при угнетении IRE1 (inositol requiring enzyme-1). Показано, что в контрольных (трансфецирован-ных пустым вектором) клетках глиомы дефицит глутамина усиливал экспрессию генов LONP1, CTSD, CTSF, CTSO и CTSS, угнетал экспрессию генов HTRA1, CTSC и CTSK, но существенно не влиял на экспрессию генов CTSA, CTSB и CTSL. Угнетение функции сигнального энзима IRE1 в клетках глиомы линии U87 изменяло эффект дефицита глутамина на экспрессию генов HTRA1, LONP1, CTSD, CTSL, CTSO и CTSS: снимало эффект дефицита глутамина на гены HTRA1 и CTSO, индуцировало — на ген CTSL, уменьшало — на ген CTSD и усиливало — на гены LONP1 и CTSL. Таким образом, дефицит глутамина изменял уровень экспрессии большинства изученных генов в зависимости от функциональной активности энзима IRE1, центрального медиатора стресса эндоплазматического ретикулума, отвечающего за контроль пролиферации клеток и роста опухолей.
Ключевые слова: экспрессия мРНК, HTRA1/ PRSS11, LONP1/PRSS15, катепсини, угнетение IRE1, дефицит глутамина, клетки глиомы линии U87.
