Научная статья на тему 'Оценка аллельного и генотипического разнообразия крупного рогатого скота Якутии по генам молочности'

Оценка аллельного и генотипического разнообразия крупного рогатого скота Якутии по генам молочности Текст научной статьи по специальности «Животноводство и молочное дело»

CC BY
107
30
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
ГЕН / КАППА-КАЗЕИН / БЕТА-ЛАКТОГЛОБУЛИН / ПРОЛАКТИН / АЛЛЕЛЬ / ГЕНОТИПЫ / ПОЛИМОРФИЗМ / КРУПНЫЙ РОГАТЫЙ СКОТ / МОЛОЧНАЯ ПРОДУКТИВНОСТЬ / GENE / KAPPA-CASEIN / BETA-LACTOGLOBULIN / PROLACTIN / ALLELE / GENOTYPE / POLYMORPHISM / CATTLE / MILK PRODUCTION

Аннотация научной статьи по животноводству и молочному делу, автор научной работы — Павлова Надежда Ивановна, Филиппова Наталья Павловна, Куртанов Харитон Алексеевич, Корякина Лена Прокопьевна

В изученных популяциях крупного рогатого скота Якутии выявлено два аллеля гена каппа-казеина А и В и три генотипа АА, АВ и ВВ. Частота встречаемости аллеля А была выше по сравнению с аллелем В и варьировала в зависимости от породы от 0,50 до 0,73. Среди исследованных пород животных с генотипом АА больше всего выявлено в симментальской австрийской селекции (55%) и холмогорской (50%). Желательный для производства сыра генотип ВВ имели 25% коров калмыцкой породы и 10% симментальской австрийской селекции. По гену бета-лактоглобулину установлено, что частота аллеля В преобладает у коров холмогорской (0,60), симментальской местной селекции (0,65) и особенно у коров калмыцкой породы (0,83). У коров симментальской породы австрийской селекции по гену бета-лактоглобулину преимущественно встречались животные с генотипом АВ (55%) и АА (30%). В калмыцкой породе преобладали животные с генотипом ВВ (67%) и не обнаружено коров с генотипом АА. В отношении гена пролактина было установлено, что у всех исследованных пород крупного рогатого скота частота аллеля А (0,79…0,98) преобладает над частотой аллеля В (0,02…0,21). В изученной выборке коров холмогорской породы выявлено 10 различных сочетаний генотипов CSN/LGB/PRL. Чаще встречаются животные с генотипом CSNAB/LGBBB/PRLAA(26,7%). Предварительные исследования молочной продуктивности показали, что животные с генотипом CSNAB/LGBBB/PRLAA имели наибольшие удои (3578 кг), а животные с генотипом CSNAА/LGBАB/PRLAA наименьшие (2170 кг). Большее количество молочного жира отмечалось у коров с генотипом CSNAB/LGBBB/PRLAA (123,8 кг).

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по животноводству и молочному делу , автор научной работы — Павлова Надежда Ивановна, Филиппова Наталья Павловна, Куртанов Харитон Алексеевич, Корякина Лена Прокопьевна

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Evaluation of Allelic and Genotypic Diversity of Cattle of Yakutia on Milk Productivity Gene

In the studied populations of cattle of Yakutia we revealed two alleles of kappa-casein genes A and B, and three genotypes AA, AB and BB. Frequency of the A allele was higher in comparison with the B allele and varied depending on the breed from 0.50 to 0.73. Among the studied breeds cattle with genotype AA found mostly in Austrian Simmental breeding (55%) and Kholmogory (50%). Required for the production of cheese genotype BB 25% of Kalmyk breed cows had and 10% of the Austrian Simmental breed. According to the beta-lactoglobulin gene, the frequency of allele B is prevalent in Kholmogory cows (0.60), Simmental local selection (0.65), and especially in cows Kalmyk breed (0.83). Cows of Simmental Austrian selection have gene of beta-lactoglobulin predominantly with genotype AB (55%) and AA (30 %). The Kalmyk breed prevailed with BB genotype (67 %) and not found the cows with genotype AA. In respect of prolactin gene it has been found that all investigated cattle breeds, the frequency of allele A (0.79... 0.98) dominates the frequency of allele B (0.02... 0.21). In the studied group of Kholmogory breed cows we revealed 10 different combinations of genotypes CSN/LGB/PRL. More frequent there are cows with genotype CSNAB/LGBBB/PRLAA (26.7%). Preliminary studies of milk production showed that animals with genotype CSNAB/LGBBB/PRLAA had the highest milk yield (3578 kg), and the animals with genotype CSNAА/LGBАB/PRLAA the lowest (2170 kg). More milk fatness was observed for cows with genotype CSNAB/LGBBB/PRLAA (123.8 kg).

Текст научной работы на тему «Оценка аллельного и генотипического разнообразия крупного рогатого скота Якутии по генам молочности»

УДК 591.133.11:636.2034(571.56)

Оценка аллельного и генотипического разнообразия крупного рогатого скота Якутии по генам молочности

Н.И. Павлова*, Н.П. Филиппова*, Х.А. Куртанов**, Л.П. Корякина*

*Якутская государственная сельскохозяйственная академия, г. Якутск **Якутский научный центр комплексных медицинских проблем, г. Якутск

В изученных популяциях крупного рогатого скота Якутии выявлено два аллеля гена каппа-казеина -А и В и три генотипа - АА, АВ и ВВ. Частота встречаемости аллеля А была выше по сравнению с аллелем В и варьировала в зависимости от породы от 0,50 до 0,73. Среди исследованных пород животных с генотипом АА больше всего выявлено в симментальской австрийской селекции (55%) и холмогорской (50%). Желательный для производства сыра генотип ВВ имели 25% коров калмыцкой породы и 10% - симментальской австрийской селекции. По гену бета-лактоглобулину установлено, что частота аллеля В преобладает у коров холмогорской (0,60), симментальской местной селекции (0,65) и особенно у коров калмыцкой породы (0,83). У коров симментальской породы австрийской селекции по гену бета-лактоглобулину преимущественно встречались животные с генотипом АВ (55%) и АА (30%). В калмыцкой породе преобладали животные с генотипом ВВ (67%) и не обнаружено коров с генотипом АА. В отношении гена пролактина было установлено, что у всех исследованных пород крупного рогатого скота частота аллеля А (0,79...0,98) преобладает над частотой аллеля В (0,02. 0,21). В изученной выборке коров холмогорской породы выявлено 10 различных сочетаний генотипов CSN/LGB/PRL. Чаще встречаются животные с генотипом CSNAB/LGBBB/PRLAA(26,7%). Предварительные исследования молочной продуктивности показали, что животные с генотипом CSNAB/LGBBB/PRLAA имели наибольшие удои (3578 кг), а животные с генотипом CSNAА/LGBАB/PRLAA - наименьшие (2170 кг). Большее количество молочного жира отмечалось у коров с генотипом CSNAB/LGBBB/PRLAA (123,8 кг).

Ключевые слова: ген, каппа-казеин, бета-лактоглобулин, пролактин, аллель, генотипы, полиморфизм, крупный рогатый скот, молочная продуктивность.

Evaluation of Allelic and Genotypic Diversity of Cattle of Yakutia

on Milk Productivity Gene

N.I. Pavlova*, N.P. Filippova*, Kh.A. Kurtanov**, L.P. Koryakina*

*Yakut State Agricultural Academy, Yakutsk **Yakut Scientific Center of Complex Medical Problems, Yakutsk

In the studied populations of cattle of Yakutia we revealed two alleles of kappa-casein genes - A and B, and three genotypes - AA, AB and BB. Frequency of the A allele was higher in comparison with the B allele and varied depending on the breed from 0.50 to 0.73. Among the studied breeds cattle with genotype AA found mostly in Austrian Simmental breeding (55%) and Kholmogory (50%). Required for the production of cheese genotype BB 25% of Kalmyk breed cows had and 10% of the Austrian Simmental breed. According to the beta-lactoglobulin gene, the frequency of allele B is prevalent in Kholmogory cows (0.60), Simmental local selection (0.65), and especially in cows Kalmyk breed (0.83). Cows of Simmental Austrian selection have gene of beta-lactoglobulin predominantly with genotype AB (55%) and AA (30 %). The Kalmyk breed prevailed with BB genotype (67 %) and not found the cows with genotype AA. In respect ofprolactin gene it has been found that all investigated cattle breeds, the frequency of allele A (0.79 ... 0.98) dominates the fre-

ПАВЛОВА Надежда Ивановна - аспирант, prof@sakha.ru; ФИЛИППОВА Наталья Павловна - к.б.н., доцент; КУРТАНОВ Харитон Алексеевич - к.м.н., зав. лаб.; КОРЯКИНА Лена Прокопьевна - к.в.н., доцент.

quency of allele B (0.02 ... 0.21). In the studied group of Kholmogory breed cows we revealed 10 different combinations of genotypes CSN/LGB/PRL. More frequent there are cows with genotype CSNAB/LGB/PRLAA (26.7%). Preliminary studies of milk production showed that animals with genotype CSNab/LGBbb/PRLaa had the highest milk yield (3578 kg), and the animals with genotype CSNAA/LGBAB/PRLAA - the lowest (2170 kg). More milk fatness was observed for cows with genotype CSNAB/LGBBB/PRLAA (123.8 kg).

Key words: gene, kappa-casein, beta-lactoglobulin, prolactin, allele, genotype, polymorphism, cattle, milk production.

Введение

Для наращивания производства мяса и молока в республику завозится крупный рогатый скот из других регионов России и из-за рубежа, однако проблема насыщения рынка продуктами отечественного производства не решена. Одной из причин является то, что привозной скот не полностью адаптирован к местным условиям и требует больших экономических вложений для реализации своего генетического потенциала[1]. Поэтому очень важно дальнейшее проведение и усовершенствование селекционно-племенной работы с местными породами крупного рогатого скота с целью повышения их продуктивности, что может быть достигнуто при эффективной системе племенной оценки животных с помощью ДНК-технологии, которая позволяет значительно ускорить решение задач современной селекции.

Установленный для крупного рогатого скота спектр генов-кандидатов на связь с признаками молочной продуктивности включает в себя гены основных белков молока (лактальбуминов и ка-зеинов), гены гормонов, стимулирующих их экспрессию, а также гены, продукты которых регулируют обмен протеинов и липидов в организме [2]. Среди них особое место занимают гены каппа-казеина, беталактоглобулина и пролактина. Учитывая связь генов с признаками молочной продуктивности, возникла необходимость оценки аллельного и генотипическо-го разнообразия крупного рогатого скота, разводимого в Республике Саха (Якутия) по данным генам. В связи с этим мы изучили частоты генов каппа-казеина, бета-лактоглобулина и пролактина у завозного скота симментальской породы австрийской селекции, калмыцкой породы, а так же местной симментальской и холмогорской пород крупного рогатого скота.

Материал и методы

Экспериментальные исследования проводились на базе лаборатории генетики и селекции животных ФГБОУ ВО «Якутская государственная сельскохозяйственная академия». Материалом для исследований послужила цельная венозная кровь коров симментальской породы СХПК «Наяхы» и «Усть-Алдан» Усть-Алданского района; холмогорской породы ООО

«Кладовая Олекмы» Олекминского района и КФХ «Дайыына» Намского района; симментальской породы австрийской селекции и калмыцкой породы ООО «Агрофирма Немюгю» Хангаласского района. Сбор крови для выделения ДНК брали из ярёмной вены в объёме 6 мл в вакуумные пробирки с сухим ЭДТА К3. Геномную ДНК выделяли общепринятым стандартным фенол-хлорофорным методом [3].

С помощью полимеразной цепной реакции (ПЦР) исследовано всего 156 голов коров четырех пород, в т.ч. симментальской местной селекции - 86, холмогорской местной селекции -38, симментальской австрийской селекции - 20 и калмыцкой породы скота - 12 голов.

Метод генотипирования с помощью ПЦР и последующего анализа полиморфизма длин ре-стрикционных фрагментов (ПДРФ) основан на том, что изменения нуклеотидной последовательности в аллельных вариантах гена приводят к появлению или исчезновению сайтов рестрикции эндонуклеаз. Для проведения ПЦР использовали специфичные праймеры (ЗАО «Синтол», г. Москва, Россия):

CSN3: F: 5'-ATAGCCAAATATATCCCAAT-TCAGT-3',

R: 5'-TTTATTAATAAGTCCATGAATCTTG-3' [D.Denicourt, 1990];

bLGB: F: 5'- GTCCTTGTGCTGGACAC-CGACTACA -3',

R: 5'- CAGGACACCGGCTCCCGGTATATGA -3' [J.F. Medrano, 1990];

PRL: F: 5'-CGAGTCCTTATGAGCTTGAT-TCTT-3',

R: 5'-GCCTTCCAGAAGTCGTTTGTTTTC -3' [Mitra et al, 1995].

Для визуализации фрагментов ДНК пробы вносили в лунки 2,5 % агарозного геля с содержанием этидия бромида (0,5 мкг/мл) и проводили горизонтальный электрофорез в 1*ТВЕ буфере.

Визуализацию и идентификацию генотипов определяли по количественным и качественным признакам ПЦР ПДРФ в УФ- трансиллюминаторе.

Для получения основных показателей внут-рипопуляционной изменчивости использовали надстройку для MSExcel - GenAlEx (PeakallandSmouse, 2012) [4].

Результаты и обсуждение

В ходе анализа аллелофонда исследованных местных популяций крупного рогатого скота были получены данные, характеризующие полиморфизм каждого из генов (табл. 1-3).

Результаты ПЦР-анализа исследованных животных по локусу гена каппа-казеина представлены в табл. 1.

В изученных популяциях крупного рогатого скота выявлено два аллеля гена каппа-казеина -А и В и три генотипа - АА, АВ и ВВ (рис. 1).

Частота встречаемости аллеля А была выше по сравнению с аллелем В и варьировала в зависимости от породы от 0,50 до 0,73. Среди исследованных пород животных с генотипом АА,

Рис. 1. Электрофореограмма результатов ПЦР-ПДРФ анализа гена каппа-казеина 1,2,4,6: АВ; 3: АА; 7:ВВ

Т а б л и ц а 1

Частота встречаемости генотипов и аллелей гена каппа-казеина у коров

Порода Кол-во голов Распределение * АА АВ ВВ Частота аллелей, ед. X2

А В

п % п % п %

Холмогорская 38 Н 19 50 16 42 3 8 0,71 0,29 0,022

О 19,2 50,5 15,6 41,0 3,2 8,5

Симментальская местной селекции 86 Н 35 41 44 51 7 8 0,66 0,34 1,77

О 37,5 43,6 38,6 44,9 9,9 11,5

Симментальская австрийской селекции 20 Н 11 55 7 35 2 10 0,73 0,27 0,29

О 10,6 53,0 7,9 39,5 1,5 7,5

Калмыцкая 12 Н 3 25 6 50 3 25 0,50 0,50 0,0

О 3,0 25 6,0 50 3,0 25

* Н - наблюдаемое и О - ожидаемое распределение генотипов.

Т а б л и ц а 2

Частота встречаемости генотипов и аллелей гена бета-лактоглобулина у коров_

Порода Кол-во голов Распределение * АА АВ ВВ Частота аллелей, ед. X2

А В

п % п % п %

Холмогорская 38 Н 7 18 16 42 15 40 0,40 0,60 0,52

О 6,1 16 18,2 47,9 13,7 36,1

Симментальская местной селекции 86 Н 11 13 38 44 37 43 0,35 0,65 0,06

О 10,5 12,2 39,1 45,5 36,4 42,3

Симментальская австрийской селекции 20 Н 6 30 11 55 3 15 0,58 0,42 0,34

О 6,7 33,5 9,7 48,5 3,6 18,0

Калмыцкая 12 Н - - 4 33 8 67 0,17 0,83 0,40

О 0,35 2,9 3,4 28,3 8,75 68,8

* Н - наблюдаемое и О - ожидаемое распределение генотипов.

Т а б л и ц а 3

_Частота встречаемости генотипов и аллелей гена пролактина у коров_

Порода Кол-во голов Распределение * АА АВ ВВ Частота аллелей, ед. X2

А В

п % п % п %

Холмогорская 38 Н 27 71 10 26 1 3 0,84 0,16 0,005

О 26,8 70,5 10,2 26,8 1,0 2,7

Симментальская местной селекции 86 Н 56 65 28 33 2 2 0,82 0,18 0,56

О 57,8 67,2 25,4 29,5 2,8 3,3

Симментальская австрийской селекции 20 Н 19 95 1 5 - - 0,98 0,02 0,28

О 19,2 96,0 0,78 3,9 0,22 0,10

Калмыцкая 12 Н 7 58 5 52 - - 0,79 0,21 0,81

О 7,5 62,5 3,98 33,2 0,52 4,3

* Н - наблюдаемое О - ожидаемое распределение генотипов.

согласно данным [5], являющимся менее желательным при производстве сыра, больше всего выявлено у коров симментальской породы австрийской селекции (55%) и холмогорской породы (50%). Частота аллеля А в этих популяциях составила 0,73 и 0,71 соответственно. Гетерозиготных животных по данному гену было больше у коров симментальской породы местной селекции (51%) и калмыцкой породы (50%). Желательный для производства сыра генотип ВВ имели 25% коров калмыцкой породы и 10% - симментальской австрийской селекции.

Расчет соответствия фактического распределения генотипов по локусу каппа-казеина теоретически ожидаемому с использованием формулы Харди-Вайнберга выявил, что во всех изученных породах сохраняется генное равновесие.

С помощью методов ПЦР-ПДРФ анализа ДНК у коров исследованных пород были обнаружены два аллеля бета-лактоглобулина - А и В (рис. 2).

Согласно данным Н.В. Федотовой, благоприятным по содержанию белка и жира в молоке

Рис. 2. Электрофореограмма результатов ПЦР-ПДРФ анализа гена бета-лактоглобулина 1,3: АА; 2, 4-8; 9; 10: ВВ

считается аллель В, а по удою - аллель А [6]. У исследованных пород по гену бета-лактогло-булину установлено, что частота аллеля В преобладает с достоверностью р<0,001 у коров холмогорской породы (0,60) и симментальской породы местной селекции (0,65) и особенно у коров калмыцкой породы (0,83) (табл. 2).

У коров симментальской породы австрийской селекции по гену бета-лактоглобулину преимущественно встречались животные с генотипом АВ (55%) и АА (30%). У коров калмыцкой породы преобладают животные с генотипом ВВ (67%) и не встречались с генотипом АА.

Расчет соответствия фактического распределения генотипов по локусу бета-лактоглобулина теоретически ожидаемому выявил, что во всех изученных породах сохраняется генное равновесие.

В изученных популяциях крупного рогатого скота выявлено два аллеля гена пролактина - А и В и три генотипа - АА, АВ и ВВ (рис. 3).

В отношении гена пролактина было установлено, что частота аллеля А (0,79...0,98) досто-

»

Рис. 3. Электрофореограмма результатов ПЦР-ПДРФ анализа гена пролактина 1,2,4,5,6,8: АА; 3,7:АВ

верно (р<0,001) преобладает над частотой алле-ля В (0,02.0,21) у всех исследованных пород крупного рогатого скота (табл. 3).

Существуют межпородные различия по частоте встречаемости животных с генотипом АА. Так, у коров калмыцкой породы и симментальской породы австрийской селекции животных с генотипом АА не обнаружено. Калмыцкая порода отличается наибольшей частотой аллеля А (0,21) и наибольшей встречаемостью гетерози-гот (52%).

В изученной выборке коров холмогорской породы выявлено 10 различных сочетаний генотипов CSN/LGB/PRL. Чаще встречаются животные с генотипом СЗ^^В^/РЖ^^^0/«). Предварительные исследования молочной продуктивности показали, что животные с генотипом CSNAB/LGBBB/PRLAA имели наибольшие удои (3578 кг), а животные с генотипом CSNAА/LGBАB/PRLAA - наименьшие (2170 кг). Большее количество молочного жира отмечалось у коров с генотипом CSNAB/LGBBB/PRLAA (123,8 кг).

Расчет соответствия фактического распределения генотипов по локусу пролактина теорети-

чески ожидаемому выявил, что во всех изученных породах сохраняется генное равновесие.

При рассмотрении обобщающих показателей генетической структуры пород крупного рогатого скота Якутии получены результаты, показанные в табл. 4.

Наибольшей полиморфностью по трем генам характеризуется симментальская порода местной селекции (1,691). Самый низкий уровень полиморфности наблюдался у симментальской породы австрийской селекции (1,557). Наблюдаемая степень гетерозиготности по трем генам варьировала от 0,317 (симментальская порода австрийской селекции) до 0,426 (симментальская порода местной селекции). Показатель ожидаемой степени гетерозиготности был выше также в симментальской породе местной селекции (0,400).

Рассчитанный коэффициент инбридинга показывает генетическую изменчивость популяций. В исследованных породах крупного рогатого скота наблюдается избыток гетерозигот, на что указывает рассчитанный коэффициент инбридинга по трем генам, который имеет отрицательное значение в калмыцкой породе

Т а б л и ц а 4

Значение основных показателей генетической изменчивости крупного рогатого скота Якутии по генам молочности

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Порода Локус Ае Ho He F

Холмогорская (п=38) Каппа-казеин 1,699 0,421 0,411 -0,024

Бета-лактоглобулин 1,915 0,421 0,478 0,119

Пролактин 1,362 0,263 0,266 0,010

М±т 1,659±0,161 0,368±0,053 0,385±0,063 0,035±0,043

Симментальская местной селекции (п=86) Каппа-казеин 1,821 0,523 0,451 -0,161

Бета-лактоглобулин 1,833 0,442 0,454 0,027

Пролактин 1,419 0,314 0,295 -0,062

М±т 1,691±0,136 0,426±0,061 0,400±0,052 -0,065±0,054

Симментальская австрийской селекции (п=20) Каппа-казеин 1,663 0,350 0,399 0,122

Бета-лактоглобулин 1,956 0,550 0,489 -0,125

Пролактин 1,051 0,050 0,049 -0,026

М±т 1,557±0,267 0,317±0,145 0,312±0,134 -0,010±0,072

Калмыцкая (п=12) Каппа-казеин 2,000 0,500 0,500 0,000

Бета-лактоглобулин 1,385 0,333 0,278 -0,200

Пролактин 1,492 0,417 0,330 -0,263

М±т 1,626±0,190 0,417±0,048 0,369±0,067 -0,154±0,079

Примечание. N - количество особей; Ae - эффективное число аллелей; Но - средняя наблюдаемая гетерозиготность; Не -средняя ожидаемая гетерозиготность; F - коэффициент инбридинга.

Т а б л и ц а 5

Значение коэффициента F-статистики Райта для популяций крупного рогатого скота исследованных пород

Локус Fis Fit Fst

Каппа-казеин -0,019 0,017 0,035

Бета-лактоглобулин -0,028 0,065 0,090

Пролактин -0,110 -0,065 0,040

В среднем -0,052 0,005 0,055

Примечание. Fit - коэффициент инбридинга особи относительно большой популяции; Fis - коэффициент инбридинга особи относительно субпопуляции; Fst - коэффициент инбридинга субпопуляции относительно большой популяции.

(-0,154), симментальской породе местной (-0,065) и австрийской селекции (-0,010), а также довольно низкое положительное значение в холмогорской породе (0,035).

Использование F-статистики Райта (табл. 5) показало, что в целом у коров исследованных пород по трем изученным генам коэффициент Fis имеет отрицательное значение, который также указывает на смещение генетического равновесия в сторону избытка гетерозигот. Коэффициент Fst (0,055), отражающий пространственную дифференциацию популяций, незначителен.

Выводы

1. В изученных популяциях крупного рогатого скота Якутии выявлено два аллеля гена каппа-казеина - А и В и три генотипа - АА, АВ и ВВ. Частота встречаемости аллеля А была выше по сравнению с аллелем В и варьировала в зависимости от породы от 0,50 до 0,73. Среди исследованных пород крупного рогатого скота животных с генотипом АА больше всего выявлено в симментальской породе австрийской селекции (55%) и в холмогорской породе (50%). Частота аллеля А в этих популяциях составила 0,73 и 0,71 соответственно. Гетерозиготных животных по данному гену больше всего встречалось в симментальской породе местной селекции (51%) и в калмыцкой породе (50%). Желательный для производства сыра генотип ВВ имели 25% коров калмыцкой породы и 10% -симментальской австрийской селекции.

2. У исследованных пород по гену бета-лактоглобулину установлено, что частота алле-ля В преобладает у коров холмогорской (0,60), симментальской пород местной селекции (0,65) и особенно у коров калмыцкой породы (0,83).

У коров симментальской породы австрийской селекции по гену бета-лактоглобулину преимущественно встречались животные с генотипом АВ (55%) и АА (30%). У коров калмыцкой породы преобладают животные с генотипом ВВ (67%) и не встречались с генотипом АА.

3. В отношении гена пролактина было установлено, что у всех исследованных пород крупного рогатого скота частота аллеля А (0,79...0,98) преобладает над частотой аллеля В (0,02...0,21).

4. В изученной выборке коров холмогорской породы выявлено 10 различных сочетаний генотипов CSN/LGB/PRL. Чаще встречаются животные с генотипом CSNab/LGBbb/PRLaa(26,7%). Предварительные исследования молочной продуктивности показали, что животные с генотипом CSNab/LGBbb/PRLaa имели наибольшие удои (3578 кг), а животные с генотипом CSN^/LGB^/PRL^ - наименьшие (2170 кг).

Большее количество молочного жира отмечалось у коров с генотипом CSNab/LGBbb/PRLaa (123,8 кг).

5. Наибольшей полиморфностью по трем генам характеризуется симментальская порода местной селекции (1,691). Самый низкий уровень полиморфности наблюдался у симментальской породы австрийской селекции (1,557). Наблюдаемая степень гетерозиготности по трем генам варьировала от 0,317 (симментальская порода австрийской селекции) до 0,426 (симментальская порода местной селекции). Показатель ожидаемой степени гетерозиготности был выше также в симментальской породе местной селекции (0,400).

6. В исследованных породах крупного рогатого скота наблюдается избыток гетерозигот, на что указывает рассчитанный коэффициент инбридинга (F) по трем генам, который имеет отрицательное значение в калмыцкой (-0,154), симментальской породе местной (-0,065) и австрийской селекции (-0,010), а также довольно низкое положительное значение в холмогорской породе (0,035).

Литература

1. Чугунов А.В. Якутия и адаптация пород // Перспективы социально-экономического развития села. - Якутск, 2015. - С. 3-5.

2. Перчун А.В., Лазебная И.В., Белокуров С.Г. и др. Полиморфизм генов CSN3, bPRL и bGH у коров костромской породы в связи с показателями молочной продуктивности // Фундаментальные исследования. - 2012. - № 11-2. -С.304-308;

3. Калашникова Л.А и др. ДНК- технологии оценки сельскохозяйственных животных. -Лесные поляны: ВНИИплем, 1999. - 148 с.

4. Peakall R. and Smouse P.E. (2012) GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research - an update. Bioinformatics 28, 2537-2539.

5. Калашникова Л.А., Труфанов В.Г. Влияние генотипа каппа-казеина на молочную продуктивность и технологические свойства молока коров холмогорской породы // Доклады Российской академии сельскохозяйственных наук. -2006.- № 4. - С. 43-44.

6. Федотова Н.В., Лозовая Г.С. Полиморфизм бета-лактоглобулина и оценка молочной продуктивности черно-пестрых коров разных генотипов // Вестник Алтайского государственного аграрного университета. - 2011. - 6 (80). -С.57-60.

Поступила в редакцию 31.05.2016

i Надоели баннеры? Вы всегда можете отключить рекламу.