Научная статья на тему 'Новый вирусный вектор для суперпродукции эпитопов вакцинных белков в растениях'

Новый вирусный вектор для суперпродукции эпитопов вакцинных белков в растениях Текст научной статьи по специальности «Агробиотехнологии»

CC BY
440
104
i Надоели баннеры? Вы всегда можете отключить рекламу.
Журнал
Acta Naturae (русскоязычная версия)
WOS
Scopus
ВАК
RSCI
PubMed
Область наук
Ключевые слова
ПОТЕКСВИРУСЫ / ВИРУСНЫЙ ВЕКТОР / ЧУЖЕРОДНЫЙ ЭПИТОП / ХИМЕРНЫЕ ВИРУСОПОДОБНЫЕ ЧАСТИЦЫ

Аннотация научной статьи по агробиотехнологии, автор научной работы — Тюлькина Л. Г., Скурат Е. В., Фролова О. Ю., Комарова Т. В., Каргер Е. М.

На основе геномов потексвирусов генома Х-вируса картофеля (ХВК) и гена капсидного белка вируса мозаики альтернантеры (КБ ВМАльт), сконструированы гибридные вирусные векторы ХВК-КБ ВМАльт и ХВКdt-КБ ВМАльт, обеспечивающие высокий уровень накопления капсидного белка. Система экспрессии на основе векторов ХВК-КБ ВМАльт и ХВКdt-КБ ВМАльт генетически безопасна, так как у гибридных вирусов нарушен системный транспорт и образование инфекционных вирусных частиц. КБ ВМАльт, формирующий вирусоподобные частицы (ВПЧ) в отсутствие геномной РНК, может служить платформой для эффективной презентации чужеродных эпитопов (включая эпитопы патогенов человека). В качестве модельного гетерологичного пептида при создании химерного КБ ВМАльт мы использовали N-концевой домен белка М2 (М2е) вируса гриппа А человека и его укороченный ДМ2е-вариант. Химерные капсидные белки ВМАльт с эпитопами белка М2 вируса гриппа А также способны формировать на основе самосборки протяженные ВПЧ. В процессе накопления, полимеризации и выделения химерных ВПЧ эпитопы белка М2 вируса гриппа А не элиминируются, что свидетельствует о стабильности химерного КБ ВМАльт при С-концевой локализации чужеродного эпитопа. Таким образом, гибридный вирусный вектор ХВК-КБ ВМАльт может использоваться в биотехнологии для продукции вирусоподобных наноразмерных частиц, представляющих на своей поверхности эпитопы вакцинных белков. Химерные ВПЧ, несущие на поверхности чужеродные эпитопы, можно рассматривать как потенциальные вакцины.

i Надоели баннеры? Вы всегда можете отключить рекламу.

Похожие темы научных работ по агробиотехнологии , автор научной работы — Тюлькина Л. Г., Скурат Е. В., Фролова О. Ю., Комарова Т. В., Каргер Е. М.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Текст научной работы на тему «Новый вирусный вектор для суперпродукции эпитопов вакцинных белков в растениях»

УДК 576.315.42

Новый вирусный вектор для суперпродукции эпитопов вакцинных белков в растениях

Л. Г. Тюлькина1, Е. В. Скурат1, О. Ю. Фролова2, Т. В. Комарова2, Е. М. Каргер2, И. Г. Атабеков1*

биологический факультет Московского государственного университета им. М.В. Ломоносова, 119991, Москва, Ленинские горы, 1, стр. 12

2Научно-исследовательский институт физико-химической биологии им. А.Н. Белозерского Московского государственного университета им. М.В. Ломоносова, 119991, Москва, Ленинские горы, 1, стр. 40 *E-mail: atabekov@genebee.msu.su Поступила в редакцию 20.06.2011 г.

реферат На основе геномов потексвирусов - генома Х-вируса картофеля (ХВК) и гена капсидного белка вируса мозаики альтернантеры (КБ ВМАльт), сконструированы гибридные вирусные векторы ХВК-КБ ВМАльт и XBKdt-КБ ВМАльт, обеспечивающие высокий уровень накопления капсидного белка. Система экспрессии на основе векторов ХВК-КБ ВМАльт и XBKdt-КБ ВМАльт генетически безопасна, так как у гибридных вирусов нарушен системный транспорт и образование инфекционных вирусных частиц. КБ ВМАльт, формирующий вирусоподобные частицы (ВПЧ) в отсутствие геномной РНК, может служить платформой для эффективной презентации чужеродных эпитопов (включая эпитопы патогенов человека). В качестве модельного гетерологичного пептида при создании химерного КБ ВМАльт мы использовали N-концевой домен белка М2 (М2е) вируса гриппа А человека и его укороченный ДМ2е-вариант. Химерные капсидные белки ВМАльт с эпитопами белка М2 вируса гриппа А также способны формировать на основе самосборки протяженные ВПЧ. В процессе накопления, полимеризации и выделения химерных ВПЧ эпитопы белка М2 вируса гриппа А не элиминируются, что свидетельствует о стабильности химерного КБ ВМАльт при С-концевой локализации чужеродного эпитопа. Таким образом, гибридный вирусный вектор ХВК-КБ ВМАльт может использоваться в биотехнологии для продукции вирусоподобных наноразмерных частиц, представляющих на своей поверхности эпитопы вакцинных белков. Химерные ВПЧ, несущие на поверхности чужеродные эпитопы, можно рассматривать как потенциальные вакцины.

ключевые слова потексвирусы, вирусный вектор, чужеродный эпитоп, химерные вирусоподобные частицы.

список сокращений ХВК - Х-вирус картофеля; ВМАльт - вирус мозаики альтернантеры; КБ - капсид-ный белок; dt - делеция генов транспорта; ХВК-КБ ВМАльт - гибридный вирусный вектор на основе генома ХВК с КБ ВМальт; M2e - эктодомен белка М2 вируса гриппа А; ДМ2е - укороченный вариант M2e; КБ-М2е ВМАльт, КБ-ДМ2е ВМАльт - химерные КБ ВМАльт с эпитопом белка М2; ВПЧ - вирусоподобные частицы; ПЦР - полимеразная цепная реакция; НТО - нетранслируемая область.

введение

Использование растений с целью экспрессии и накопления чужеродных (целевых) белков (ЦБ), применяемых в медицине, ветеринарии, сельском хозяйстве и промышленности, - одно из перспективных направлений биотехнологии.

Преимущество растений перед клетками животных или микроорганизмов состоит в технологической простоте и возможности единовременного производства большого количества недорогого целевого продукта, а отсутствие патогенов, общих для человека и растений, делает произведенные в растениях бел-

ки полностью безопасными. Наличие в растениях систем посттрансляционных модификаций обычно обеспечивает формирование правильной конформации целевых белков при помощи дисульфидных связей и гликозилирования.

Один из наиболее эффективных методов быстрого получения в растениях значительных количеств целевого белка основан на использовании автономно реплицирующихся рекомбинантных вирусных векторов. Высокая скорость репликации вирусных геномов обеспечивает высокую копийность транскриптов чужеродных генов в цитоплазме инфицированных

клеток. Поэтому продуктивность вирусной системы экспрессии в среднем на два порядка выше, чем при стабильной трансформации растений или тран-зиентной экспрессии с помощью невирусных векторов [1, 2]. Наиболее широко используются вирусные векторы, созданные на основе РНК-содержащих вирусов растений (тобамо-, потеке-, комо-, бромо- и по-тивирусов) [3].

Существуют две основные стратегии получения целевых белков при использовании вирусного вектора:

1) ген ЦБ под контролем вирусного промотора экс-прессируется с образованием индивидуального белка. Это может быть выполнено на основе «стратегии добавления гена», когда ген ЦБ помещают под контроль дуплицированного субгеномного промотора, например, гена белка оболочки [2, 4-6], или «стратегии замены гена», когда вирусный ген (чаще всего ген белка оболочки или/и гены межклеточного транспорта) заменены геном ЦБ [7-11]. Такой подход позволяет за короткое время накапливать целевой белок в количествах, достигающих 10% и более от суммарного растворимого белка растений. Векторы на основе геномов фитовирусов успешно применяются для продукции в растениях белков медицинского назначения, в том числе вакцинных. Эту стратегию использовали для синтеза сердцевинного белка вируса гепатита В (HBcAg) и капсидного белка калици-вируса, способных формировать стабильные вирусоподобные частицы, стимулирующие гуморальный и клеточный иммунные ответы [12, 13];

2) стратегия «слияния» нуклеотидной последовательности гена ЦБ или его фрагмента с вирусным геном или его фрагментом. Чаще всего вирусный ген капсидного белка и ген ЦБ экспрессируются как единая рамка трансляции. Но существуют ограничения на допустимый размер добавленной чужеродной последовательности. Протяженные полипептиды, как правило, соединяют с основным белком через гибкий мостик, сайты протеолиза, через последовательность пептида 2А вируса ящура или иным способом [14-17].

Изучение молекулярных механизмов активации адаптивного иммунного ответа свидетельствует о том, что скорее пептиды, нежели целые белки отвечают за активацию Т- и В-лимфоцитов [18]. Пептиды (как синтетические, так и рекомбинантные) нестабильны и обладают слабой антигенной активностью [19], однако усиление их иммуногенности и повышение стабильности происходят после связывания с высокомолекулярными и высокоиммуногенными носителями [18].

Примером таких носителей могут быть капсидные белки (КБ) вирусов растений, способные формировать вирусные и/или вирусоподобные наночастицы

и служить платформой для презентации эпитопов патогена. Подобные наночастицы имеют стабильную и регулярно повторяющуюся структуру, которая способствует индукции сильного как клеточного, так и гуморального иммунного ответа [20-23].

Используя данную стратегию экспрессии, созданы вирусные векторы, продуцирующие в растениях вирусы с химерным КБ. На поверхности этих вирио-нов были презентированы эпитопы антигенов золотистого стафилококка, вирусов ящура, гепатита С, папилломы, полиомиелита, вируса иммунодефицита человека, вируса гриппа [24-33] и многих других (см. также обзоры [3, 34]).

Но вирусные векторы на основе полноразмерных геномов, способных к системному транспорту и образованию инфекционных вирусных частиц, небезопасны для использования в биотехнологии. В процессе производства целевых белков нельзя исключить возможность попадания рекомбинантных вирусов в окружающую среду с последующим неконтролируемым распространением генетического материала.

Капсидные белки некоторых вирусов животных и растений сохраняют способность формировать стабильные капсиды, вирусоподобные частицы (ВПЧ) в отсутствие вирусного генома. Использование ВПЧ в качестве платформы для эффективной презентации чужеродных для иммунной системы эпитопов [21, 35-37] может решить проблему биобезопасности производства вакцинных белков. В настоящее время особое внимание уделяется конструированию векторных систем, экспрессирующих капсидные белки, которые формируют ВПЧ, свободные от каких-либо примесей РНК. Считается, что только такие ВПЧ могут использоваться в биотехнологии и нанотехноло-гии [38, 39].

Цель настоящей работы - создание системы генетически безопасных вирусных векторов на основе геномов потексвирусов для продукции в растениях ВПЧ, презентирующих на своей поверхности эпито-пы патогена.

экспериментальная часть

Среды, реактивы, ферменты и синтетические олигонуклеотиды

В работе использовали Escherichia coli XL-1 Blue («Stratagene», США) и Agrobacterium tumefa-ciens GV3101 из коллекции кафедры вирусологии МГУ. Рекомбинантные ДНК клонировали в клетках E. coli XL-1 Blue стандартными методами [40] с использованием рестрикционных эндонуклеаз, ДНК-лигазы, Taq- и Pfu-полимераз («Fermentas», Литва и «СибЭнзим-М», Россия). Олигонуклеоти-ды были синтезированы фирмой «Синтол» (Россия).

Для клонирования использовали следующие синтетические олигонуклеотиды: ВМАльт-КБ-XhoI-p (CTAGCTCGAGATGTCCACTCCATTTCCTCAA), ВМАльт-КБ-XbaI-m (CGTCTAGATTACTC-CGGTGGTGGGAGGTATTGA), PVX-R-Avr2-p (TGCACAGATTTTCCTAGGCAC), PVX-R-XhoI-m (AGcTcTcGAGcTTATTcAAATcTcTAAGG-TA), PVX-3ntr-XbaI-p (AGCTTCTAGACTACGTC-TACA TAACCGACGC), Oligo(dT)24-Kpn-m (AGCTGGTACCTTTTTTTTTTTTTTTTTTTTTTT T), PVX-Kpn-(dT)12-3ntr-m (AGCTGGTACC-TTTTTTTTTTATATTATTCATACAATC), PVX-Xba-cpxho-3ntr-p (AGTCTCTAGTCGAGGCGT-TCAGGAACA), ВМАльт-КБ-evetpirn-XbaI-m (cGTcTAGATTAGTTTcTGATGGTGTTTcAc-CCTCCGGTGGTGGGAGGTA), ВМАльт-КБ-М2Е-т (TTTCCACCTCTGTCAAGAGT-GACTCCGGTGGTGGGAGGTA), M2E-XbaI-m (CGTCTAGATTAGTCGGATGAGTCGTTGCATCT), M2E-p (TCACTCTTGACAGAGGTGGAAACAC-CAATCAGAAACGAGTGGG), M2E-m (GTCGGAT-GAGTCGTTGCATCTGCATCCCCACTCGTTTCT-GATT). Правильность полученных конструкций подтверждали путем автоматического секвенирова-ния препаратов плазмидных ДНК в фирме «ГеноТех-нология» (Россия).

Векторные конструкции ХВК-КБ ВМАльт и XBKdt-КБ ВМАльт

Бинарные гибридные векторы получали в несколько стадий с использованием промежуточных конструкций (ПК).

ПК 1 - Фрагмент плазмиды PVX-201, содержащий 35S промотор, репликон ХВК с дуплицированным субгеномным промотором, но без терминатора транскрипции гена нопалинсинтазы (Tnos-терминатор), по сайтам HindIII/EcoRI был перенесен в бинарный вектор pBIN 19.

ПК 2 - Ген капсидного белка ВМАльт получен методом ПЦР на матрице кДНК-копии З'-концевой области геномной РНК ВМАльт с использованием пары праймеров ВМАльт-КБ-XhoI-p и ВМАльт-КБ-XbaI-m и субклонирован в вектор Cambia 6963 по сайтам рестрикции XhoI/XbaI.

ПК 3 - Для удобства клонирования сайт рестрикции XbaI, фланкирующий субгеномный промотор белка 25 кДа ХВК, был заменен сайтом рестрикции XhoI. С этой целью фрагмент кДНК ХВК, кодирующий С-концевую область вирусной полимеразы, получен методом ПЦР на матрице PVX-201 с использованием пары праймеров - PVX-R-Avr2-p и PVX-R-XhoI-m. Синтезированный фрагмент клонировали по сайтам Avr2/XhoI в вектор pGEM3-11369(polio)x2, содержащий субгеномный промотор

гена белка 25 кДа, последовательность, кодирующую С-концевую часть полимеразы ХВК и КБ U1 вируса табачной мозаики (ВТМ) с удвоенным полиовирус-ным эпитопом. Этой операцией из вектора pGEM3-11369(polio)x2 была удалена последовательность гена капсидного белка u1 ВТМ и создан сайт рестрикции XhoI на З'-конце субгеномного промотора белка 25 кДа.

ПК 4 - Три варианта З'-НТО получены с помощью ПЦР на матрице PVX-201 с использованием трех пар праймеров: PVX-3ntr-XbaI-p и Oligo(dT)24-Kpn-m использовали для синтеза З'-НТО ХВК (А)24; прай-меры PVX-3ntr-XbaI-p и PVX-Kpn-(dT)12-3ntr-m -для синтеза З'-НТО ХВК (А) ; праймеры PVX-Xba-cpxho-3ntr-p и PVX-Kpn-(dT)12-3ntr-m - для синтеза З'-НТО ХВК p/cp (A)12.

Синтезированные фрагменты ДНК, соответствующие различным вариантам З'-НТО, после расщепления рестриктазами XbaI/Kpn одновременно с геном КВ ВМАльт, предварительно выщепленным из ПК 2 по сайтам XhoI/XbaI клонировали в плазмиду pBlue-Script II SK+ по сайтам XhoI-(XbaI)-KpnI.

ПК 5 - Фрагмент ДНК, соответствующий КБ ВМАльт с прилегающей З'-НТО, выщепляли из ПК 4 по сайтам рестрикции XhoI/KpnI и одновременно с фрагментом ДНК, соответствующим Tnos-терминатору, и предварительно выщеплен-ным по сайтам KpnI/SacI из содержащего Tnos-терминатор субклона pGEM, клонировали в ПК З по сайтам XhoI-(KpnI)-SacI.

На последнем этапе клонирования фрагмент ДНК из ПК 5 по сайтам XhoI/SacI или AvrI/SacI переносили в ПК 1, предварительно обработанную рестрик-тазами SalI/SacI или AvrI/SacI.

Получение векторных конструкций, экспрессирующих химерные капсидные белки ВМАльт

ПК 6 - Ген КБ ВМАльт, содержащий последовательность, кодирующую ДМ2е-вариант, получен методом ПЦР на матрице кДНК-копии З'-концевой области геномной РНК ВМАльт с использованием пары праймеров - ВМАльт-КБ-XhoI-p и ВМАльт-КБ-evetpirn-XbaI-m, и субклонирован в вектор Cambia 696З по сайтам рестрикции XhoI/XbaI. Ген КБ ВМАльт, кодирующий полноразмерный домен М2е получен методом ПЦР в три стадии с использованием пары синтетических олигонуклеотидов М2Е-р и М2Е-т и двух пар праймеров - ВМАльт-КБ-XhoI-p и ВМАльт-КБ-М2Е-т, и ВМАльт-КБ-XhoI-p и M2E-XbaI-m, и субклонирован в вектор Cambia 696З по сайтам рестрикции XhoI/XbaI.

ПК 7 - В ПК 5 по сайтам XhoI/XbaI последовательность вирусного капсидного белка заменяли

на последовательности химерных капсидных белков из ПК 6.

На последнем этапе клонирования фрагменты ДНК из ПК 7 по сайтам XhoI/SacI или AvrI/SacI переносили в ПК 1, предварительно обработанную рестриктазами SalI/SacI или AvrI/SacI.

Агроинъекция

Агробактерии A. tumefaciens (штамм GV3101) трансформировали рекомбинантными плазмидами, используя метод «замораживания-оттаивания» [41]. Агробактерии, содержащие рекомбинантные бинарные векторы, выращивали в течение ночи на качалке при 280С в среде LB, содержащей 50 мг/л рифампицина, 50 мг/л канамицина и 25 мг/л ген-тамицина. Клетки осаждали центрифугированием при 4000 g в течение 5 мин и ресуспендировали в буфере для агроинъекции, содержащем 10 мМ Mes (pH 5.5) и 10 мМ MgSO4. Листья растений Nicotiana benthamiana инъецировали суспензией агробактерий (OD600 = 0.2) с помощью шприца без иглы. После агро-инъекции растения выращивали под лампой дневного света при 16-часовом световом дне и 220С. Для подавления посттранскрипционного умолкания генов агроинъекцию растений проводили в присутствии гена-супрессора р19 вируса кустистой карликовости томатов.

Анализ экспрессии капсидного белка ВМАльт при агроинъекции

Высечки из агроинъецированных листьев N. benthamiana гомогенизировали в трех-пяти объемах экстракционного буфера (10 мМ Трис, pH 8.0, содержащего 5 мМ EDТА). Полученную суспензию осветляли центрифугированием при 12000 g в течение 15 мин. К супернатанту добавляли равный объем денатурирующего буфера для нанесения на полиакриламидный гель (ПААГ). Буфер для нанесения проб на ПААГ содержит 60% глицерина, 20% Р-меркаптоэтанола, 10% додецилсульфата натрия, 250 мМ Трис-НС1-буфера, pH 6.8 и 1% бром-фенолового синего. Анализируемые пробы прогревали при 950С в течение 15 мин и фракционировали с помощью электрофореза в 12% ПААГ по методу Лэммли [42] с последующим окрашиванием Кумасси R-250. Синтезированные в листьях N. benthamiana химерные капсидные вирусные белки идентифицировали методом Вестерн-блотинга, как описано ранее [43], с использованием поликлональных антител к КБ ВМАльт и/или М2е-эпитопу и вторичных антител, конъюгированных с пероксидазой хрена («Sigma»). Продукты реакции визуализировали методом хе-милюминесценции с использованием системы EcL («Amersham Biosciences»).

Выделение капсидных белков ВМАльт из растительной ткани

На шестые-восьмые сутки после заражения листовой материал растирали до образования однородной суспензии в экстракционном буфере (10 мМ Трис, pH 8.0, 5 мМ EDTA). Полученную смесь центрифугировали при 12000 g в течение 15 мин и отбирали су-пернатант, в котором содержались капсидные белки. Для полимеризации КБ ВМАльт и образования ВПЧ к супернатанту добавляли 0.5 М цитратный буфер, pH 4.0, до концентрации 25 мМ и инкубировали в течение 40 мин при комнатной температуре. Псевдо-вирионы из растительного экстракта осаждали ультрацентрифугированием при 100 000 g в течение 120 мин или полиэтиленгликолем (8% ПЭГ 6000, 2% NaCl, 25 мМ цитратный буфер, рН 4.0). Осадки суспендировали в 25 мМ цитратном буфере, рН 4.0, инкубировали в течение 40 мин для корректирующей полимеризации и осветляли центрифугированием при 12000 g в течение 15 мин. Полученные препараты химерных ВПЧ подвергали иммуноферментному и электронно-микроскопическому анализу.

Электронная микроскопия

Образцы, приготовленные по стандартной методике негативного контрастирования с использованием 1% раствора уранилацетата, просматривали на просвечивающем электронном микроскопе JEM-1011 («JEOL», Япония). Фотографировали при помощи цифровой камеры Gatan Erlangshen ES500W, используя программу Gatan Digital Micrograph. х 250000.

результаты и обсуждение

Гибридные вирусные векторы

Х-вирус картофеля и вирус мозаики альтернантеры относятся к роду Potexvirus (потексвирусы) семейства Flexiviridae. Частицы типового ХВК представляют собой гибкие нитевидные вирионы со спиральной структурой длиной 515 и диаметром 13.5 нм. Около 1300 идентичных субъединиц капсидного белка формируют полярную спираль ХВК с шагом 3.6 нм. Вирусная РНК заключена между витками этой спирали, каждый виток спирали включает 8-9 субъединиц КБ. Частицы имеют полый центральный осевой канал диаметром 3 нм [44, 45]. Систему экспрессии на основе геномов по-тексвирусов создавали с использованием популярного вектора PVX-201, содержащего полную кДНК-копию генома ХВК UK3, клонированную между 35S промотором вируса мозаики цветной капусты (CaMV) и Tnos-терминатором [4]. В качестве донора капсидного белка мы использовали ВМАльт, который серологически близок, но не идентичен вирусу мозаики папайи (ВМП) [46]. Отличие КБ ВМП от КБ типового представителя

ХВК-КБ ВМАльт RB

I ,_Кг---,1 RDRP II TGB1 I [ TGB3 II AltMV CP К-ц-1

ч^-11 ^ 1--Tü^I^HI-Ei—1

XBKdt-КБ ВМАльт, RB

tAltMV CP I IN^O^

ХВК-КБ-М2е ВМАльт RB

■—К |г,.,т„|| RDRP 11 TGB1 I I TGB3 П AltMV CP M2e L-il-- I

-1 1 1TGB2|N---i^^CEF

XВKdt-KБ-М2е ВМАльт

L(35S^j57NTR^-

RDRP I I AltMV CP I M2e

3j3'NTR[ffnos)—1

ХВК-КБ-ДМ2е ВМАльт RB

I—|35sj>j5'NTR}.

S|P1 SGP3

1 j TGB1 j |TGB3 I [-AltMV CP ДM2e'

TGB2

IN&1

XВKdt-KБ-ДМ2е ВМАльт RB

35S 5'NTR

I AltMV CP ДM2e

^'NTR^nos]—I

Рис. 1. Схемы гибридных векторов, сконструированных на основе геномов потексвирусов - ХВК и ВМАльт. RDRP (RNA dependent RNA polymerase) - ген вирусной РНК-зависимой-РНК-полимеразы; TGB1, TGB2, TGB3 (triple genes block) - тройной блок генов (25, 12 и 8 кДа); SGP (subgenomic promoter) - промоторы субгеномных РНК, обозначены стрелками; AltMV CP (Alternanthera mosaic virus capsid protein) - ген капсидного белка ВМАльт; M2e, N-концевой эктодомен белка М2 вируса гриппа А; AM2e, укороченный вариант М2е; 35S (promoter for the 35S RNA of CaMV) - промотор 35S РНК вируса мозаики цветной капусты; Tnos (terminator of nopaline synthase) -терминатор транскрипции гена нопалинсинтазы; NTR (non-translatable region) - нетранслируемая область; LB (left border) и RB (right border) - левая и правая границы Т-ДНК. Исходный полногеномный вектор ХВК-КБ ВМАльт и укороченный вектор-репликон ХВ^^КБ ВМАльт содержали фрагменты ДНК, кодирующие полноразмерный нативный КБ ВМАльт. Полногеномные химерные векторы (ХВК-КБ-M2e ВМАльт, ХВК-КБ-AМ2e ВМАльт) и химерные векторы-репликоны (ХВКdt-КБ-M2e ВМАльт, ХВКdt-КБ-AМ2e ВМАльт) кодировали химерные белки оболочки: №-M2e ВМАльт и КБ-AМ2e ВМАльт. Перечисленные конструкции клонировали в бинарный вектор для доставки в листья растений методом агробактериальной инъекции.

SGP1

SGP3

SGP1

_B

RDRP

SGP1

SGP3

SGP1

_B

RB

SGP1

_B

RDRP

RDRP

потексвирусов - ХВК, состоит в его способности образовывать in vitro вирусоподобные частицы со спиральным типом симметрии без участия РНК [47]. Данные электронно-микроскопического анализа препаратов КБ ВМАльт свидетельствуют, что капсидный белок ВМАльт также способен образовывать in vitro ВПЧ.

На основе геномов ХВК и ВМАльт мы сконструировали два типа гибридных вирусных векторов: ХВК-КБ ВМАльт (полногеномный вариант) и ХВМ1-КБ ВМАльт (репликон-мини-вариант). Геном ХВК-КБ ВМАльт находится под контролем 35S промотора и Tnos-терминатора, содержит 5'- и З'-нетранслиру-емые области РНК ХВК, ген РНК-зависимой-РНК-полимеразы ХВК, тройной блок генов транспорта ХВК. Ген КБ ВМАльт экспрессируется под контролем субгеномного промотора КБ ХВК. Геном ХВМ1-КБ ВМАльт также находится под контролем 35S промотора и Tnos-терминатора, содержит 5'- и З'-нетранс-лируемые области РНК ХВК, ген РНК-зависимой-РНК-полимеразы ХВК, но в нем отсутствуют гены транспорта, как и в конструкции, описанной в работе [10]. В вирусных векторах ХВМ1-КБ ВМАльт ген капсидного белка ВМАльт находится под контролем субгеномного промотора белка 25 кДа ХВК.

Известно, что для эффективного синтеза целевого белка вирусный вектор должен содержать определенный набор цис-действующих элементов в З'-нетранслируемой области, которые определяют сродство к репликазе, облегчают транскрипцию и трансляцию, обеспечивая максимальный уровень экспрессии чужеродных генов. Так как в гибридных вирусных векторах З'-концевой ген КБ ХВК заменен геном КБ ВМАльт, при конструировании векторов мы использовали три модельных варианта З'-НТО: З'-НТО ХВК (А)24; З'-НТО ХВК (А)12 и З'-НТО ХВК p/cp (A)12. З'-НТО ХВК (А)12 соответствует З'-конце-вой области полноразмерной инфекционной кДНК-копии генома ХВК (PVX-201). В З'-НТО ХВК (А)24 отсутствует последовательность ATAAAT, но поли-(А)-тракт увеличен с 12 до 24 А. З'-НТО ХВК p/cp (A)12 имеет соответствующий PVX-201 поли-(А)-тракт, но с 5'-конца З'-НТО увеличена на 60 нукле-отидов за счет прилегающего к НТО З'-концевого фрагмента гена КБ ХВК.

Таким образом, на первом этапе на основе генома ХВК мы сконструировали два типа гибридных вирусных векторов (рис. 1), ХВК-КБ ВМАльт и мини-вектор-репликон ХВМ1-КБ ВМАльт с тремя

Рис. 2. Накопление капсидного белка ВМАльт в листьях N. benfhamiana после агроинъекции векторами ХВК-КБ ВМАльт и ХВ^-КБ ВМАльт с различными 3'-НТО (1 и 161, 3'-НТО ХВК (А)24; 2 и 3'-НТО ХВК р/ср (А)12; 3 и 3df, 3'-НТО ХВК (А)12). 12% гель (ДСН-ПААГ), окрашенный Кумасси. На гель нанесены экстракты растворимого белка, соответствующие 2.5 мг растительного материала; К+, КБ ВМАльт - 0.5 мкг; К— неинокулиро-ванный лист (отрицательный контроль); маркеры подвижности белков обозначены М. А — Агроинъецированные листья, 8-й день после агроинъекции; Б - верхние системные листья, 16-й (1, 2, 3) и 20-й (1', 2', 3') дни соответственно после агроинъекции нижних листьев.

вариантами 3'-НТО каждый. Все конструкции клонировали в бинарный вектор рВШ19 для последующего инфицирования растений N. ЪеПЬат1апа с помощью агробактерий.

Репликация гибридных вирусных векторов в листьях растений N. ЪеПЬат1апа Эффективность экспрессии гена КБ ВМАльт различными векторами определяли по накоплению капсидного белка в листьях растений N. ЪепЛат{-апа на 6-8 день после агроинъекции. Необходимо отметить, что во всех рассмотренных конструкциях репликация гибридного вирусного вектора ХВК-КБ ВМАльт в растениях N. ЪепЛат(апа приводила к накоплению КБ ВМАльт примерно в тех же количествах, как и КБ ХВК при механической инокуляции растений вирусом (более 1 мг на 1 г зеленой массы). ВМАльт обычно накапливается в растениях в более низких концентрациях (около 340 мкг на 1 г зеленой массы).

Мы не обнаружили различий в эффективности продукции КБ при использовании различных вариантов 3'-НТО. Удаление З'-концевого 60-нуклеотид-ного фрагмента гена КБ ХВК не снижало уровня КБ ВМАльт, в отличие от данных, приведенных в работе [10]. Можно предположить, что имеющейся гомологии между 3'-концевыми областями генов КБ ХВК и КБ ВМАльт достаточно для эффективной работы поли-меразы ХВК. Аналогичные результаты, а именно от-

сутствие преимуществ у какого-либо из вариантов З'-НТО и сходный уровень накопления рекомбинант-ного КБ ВМАльт, получены и при репликации вирусных векторов ХВМ1-КБ ВМАльт (рис. 2А). В дальнейшем мы использовали векторные конструкции только с одним вариантом 3'-НТО - с 3'-НТО ХВК (А)12 (рис. 1).

По накоплению рекомбинантного капсидного белка ВМАльт в листьях растений N. Ъеп^ат1апа на 6-8 день после агроинокуляции в присутствии гена-супрессора умолкания генов (гена белка р19 вируса кустистой карликовости томатов) мини-векторы ХВМ1-КБ ВМАльт не превосходили векторы ХВК-КБ ВМАльт (рис. 2А).

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

Известно, что функция межклеточного и системного транспорта ХВК в растениях контролируется четырьмя генами, включая тройной блок генов (TGB) и КБ [4]. В «системных», не агроинъецированных листьях растений N. Ъеп^ат{апа, агроинокулиро-ванных гибридными вирусными векторами ХВК-КБ ВМАльт на 16-20 день мы не обнаружили рекомби-нантного КБ ВМАльт (рис. 2Б). Таким образом, замена гена КБ ХВК в рекомбинантных гибридных вирусных векторах на ген КБ ВМАльт приводит к нарушению системного транспорта гибридного вируса.

Электронно-микроскопический анализ экстрактов листьев растений N. Ъеп^ат1апа, агроинокулиро-ванных гибридными вирусными векторами ХВК-КБ ВМАльт и ХВМ1-КБ ВМАльт, показал, что реком-

л

кДа 130 -72 -55 -43 -

34 -26 -

КБ ВМАльт -

кДа

72 55 43

34 26

КБ ВМАльт 17

М К-

2 2а

3 3а

Рис. 3. Накопление КБ ВМАльт и химерных капсидных белков ВМАльт в листьях N. benthamiana на шестой день после агроинъекции векторами ХВК-КБ ВМАльт ( 1) и XBKdt-КБ ВМАльт ( 1а), ХВК-КБ-М2е ВМАльт (2) и XBKdt-КБ-М2е ВМАльт (2а), ХВК-КБ-ДМ2е ВМАльт (3) и ХВ^-КБ-ДМ2е ВМАльт (3а); Л - 12% гель (ДСН-ПААГ), окрашенный Кумасси. На гель нанесены экстракты растворимого белка, соответствующие 1.5 мг растительного материала; К— отрицательный контроль; Б - Вестерн-блот-анализ экстрактов растворимых белков из листьев, агроинокулированных вирусными векторами, с использованием мышиных поликлональных антител к КБ ВМАльт. Маркеры подвижности белков - М. Стрелкой отмечено положение КБ ВМАльт.

Б

)

2

3

)

бинантный капсидный белок ВМАльт способен формировать протяженные вирусоподобные частицы (см. далее), которые можно использовать в качестве платформы для презентации чужеродных эпитопов. Спектр УФ-поглощения в диапазоне 225-339 нм препарата ВПЧ КБ ВМАльт, выделенного из растительного экстракта, свидетельствует об отсутствии в нем РНК (данные не приведены).

Необходимо отметить, что ВПЧ со спиральным типом симметрии при использовании в качестве платформы для презентации эпитопов патогена имеют некоторое преимущество перед ВПЧ с икосаэдриче-ским типом симметрии: большее число субъединиц в ВПЧ и соответственно возможность презентации химерными КБ в ВПЧ значительно большего числа эпитопов патогена.

Конструирование гибридных вирусных векторов, экспрессирующих химерные капсидные белки ВМАльт

В качестве модельного чужеродного пептида при создании химерного КБ ВМАльт мы использовали П-концевой домен белка М2 (М2е) вируса гриппа А и его укороченный вариант (ДМ2е), ответственные за индукцию протективного иммунного ответа [48]. Матриксный (М2) белок вируса гриппа А считается

перспективным кандидатом для создания противовирусной вакцины, так как аминокислотная последовательность эктодомена этого белка (М2е) высококонсервативна и практически не изменилась с момента первого выделения в 1933 г. вируса гриппа А человека [49]. На основании компьютерного анализа 55 изолятов вируса гриппа А человека предложена кон-сенсусная синтетическая аминокислотная последовательность эктодомена белка М2 [50].

Так как конформационная структура КБ ВМАльт в настоящее время не известна, поиск оптимального сайта инсерции, который, с одной стороны, обеспечивает презентацию гетерологичного эпитопа на поверхности капсидного белка, а с другой, минимально влияет на конформацию КБ и не препятствует формированию полимерных структур, проводили с использованием пакета программ DNAStar. В результате выбрали С-концевую локализацию М2е-эпитопа и ДМ2е-варианта в составе химерного КБ ВМАльт. Нуклеотидная последовательность М2е-эпитопа и ДМ2е-варианта была сконструирована на основе соответствующей консенсусной аминокислотной последовательности П-концевого домена белка М2 вируса гриппа А с использованием синонимических ко-донов, наиболее часто встречающихся в геноме ХВК и капсидного белка ВМАльт.

Рис. 4. Анализ препаратов ВПЧ, образованных КБ ВМАльт и химерным капсидным белком ВМАльт с эпитопами белка M2 вируса гриппа А. Препараты ВПЧ выделены из растительного экстракта листьев растений N. benthamiana преципитацией полиэтиленгликолем ( 1) или дифференциальным центрифугированием (2). А — Электро-форетический анализ препаратов ВПЧ, выделенных дифференциальным центрифугированием. 12% гель (ДСН-ПААГ), окрашенный Кумасси. Б — Вестерн-блот-анализ препаратов ВПЧ с использованием поликлональных антител к КБ ВМАльт. В — Вестерн-блот-анализ препаратов ВПЧ с использованием поликлональных антител к М2е-эпитопу. ДГФР-М2е - рекомбинантный белок (ген дигидрофолатредуктазы слит с нуклеотидной последовательностью М2е-эпитопа), который использовали в качестве иммуногена для получения антител к М2е-эпитопу вируса гриппа А; положительный контроль на М2е-эпитоп.

Методом ПЦР получены гены химерных КБ ВМАльт, кодирующие полноразмерный экто-домен белка М2 (23 аминокислотных остатка, М2е-эпитоп), SLLTEVETPIRNEWGCRCNDSSD, и укороченный вариант, ДМ2е (8 аминокислотных остатков, EVETPIRN), слитые с С-концом КБ (КБ-М2е ВМАльт и КБ-ДМ2е ВМАльт). При помощи клонирования в гибридных вирусных векторах ХВК-КБ ВМАльт и XBKdt-КБ ВМАльт последовательности вирусного капсидного белка заменяли последовательностями химерных капсидных белков.

Таким образом, на основе генома ХВК нами сконструированы четыре гибридных вирусных вектора, содержащие гены химерных капсидных белков ВМАльт (рис. 1): ХВК-КБ-М2е ВМАльт и его мини-вариант ХВ^-КБ-М2е ВМАльт; ХВК-КБ-ДМ2е ВМАльт и его мини-вариант ХВШ^КБ-ДМ2е ВМАльт. Этими конструкциями трансформировали компетентные клетки агробактерий для инфицирования растений N. benthamiana.

Экспрессия химерных капсидных белков ВМАльт в листьях растений N. benthamiana Гибридные вирусные векторы на основе генома ХВК, кодирующие гены химерных капсидных белков ВМАльт (КБ-М2е и КБ-ДМ2е), агроинъециро-вали в листья растений N. benthamiana. На шестые-восьмые сутки после агроинъекции синтез химерных белков оценивали количественно фракционированием растворимых белков в ПААГ и окраской Кумас-си (рис. 3А). Химерные капсидные вирусные белки идентифицировали методом Вестерн-блотинга с поликлональными антителами к КБ ВМАльт или к М2е-эпитопу (рис. 3Б). Как и в случае КБ ВМАльт, мы не обнаружили различий в накоплении химерных капсидных белков при репликации полноразмерного гибридного вирусного вектора или его мини-варианта. Продукция КБ-М2е и КБ-ДМ2е зависела от индивидуальных особенностей растения, ярусности листа, условий сезонности. Тем не менее, из электрофореграмм, представленных на рис. 3, следует, что уровень накопления химерных капсид-ных белков ВМАльт (КБ-М2е и КБ-ДМ2е) в листьях

растений сравним с уровнем рекомбинантного КБ ВМАльт и составляет более 1 мг (в некоторых опытах до 3 мг) на 1 г зеленой массы.

Химерные капсидные белки ВМАльт с М2е-эпитопом и ДМ2е-вариантом, так же как и исходный капсидный белок ВМАльт, формируют протяженные вирусоподобные частицы при снижении рН до 4.0-4.9 в условиях низкой ионной силы раствора. Препарат химерных ВПЧ можно выделить из растительного экстракта дифференциальным центрифугированием или преципитацией полиэтиленгликолем. На рис. 4 и рис. 5 представлены результаты электро-форетического, иммуноферментного и электронно-микроскопического анализов препаратов химерных ВПЧ. Как следует из приведенных данных, в процессе накопления, полимеризации и выделения эпитопы белка М2 вируса гриппа А не элиминируются, что свидетельствует о стабильности химерного КБ ВМАльт при С-концевой локализации чужеродного эпитопа. Тот факт, что чужеродный эпитоп при С-концевой локализации не препятствует полимеризации химерного КБ ВМАльт, указывает на различия в конформации С-концевых областей КБ ВМАльт и ХВК [51].

выводы

Цель нашей работы состояла в создании системы презентации гетерологичных эпитопов (эпи-топов патогена) на поверхности вирусоподобных частиц, образованных капсидным белком фитовиру-са. На основе генома ХВК и гена КБ ВМАльт сконструированы гибридные вирусные векторы ХВК-КБ ВМАльт и ХВКdt-КБ ВМАльт, обладающие рядом преимуществ по сравнению с исходными вирусами, ХВК и ВМАльт:

1) уровень накопления рекомбинантного капсид-ного белка ВМАльт при агроинъекции листьев растений N. Ъеп^ат1апа гибридными вирусными векторами достигает 1 мг/г растительного материала, что значительно превышает накопление при механической инокуляции природного хозяина;

2) замена гена КБ ХВК в гибридных вирусных векторах на ген КБ ВМАльт приводит к подавлению системного транспорта гибридного вируса и нарушению формирования вирусных частиц;

3) способность формировать ВПЧ обеспечивается особенностью капсидного белка ВМАльт, КБ ХВК не обладает способностью образовывать ВПЧ.

Представленные результаты указывают на возможность применения вирусных векторов ХВК-КБ ВМАльт и ХВ^-КБ ВМАльт в биотехнологии для продукции вакцинных белков в растениях. Кап-сидный белок ВМАльт, накапливающийся в высоких концентрациях и формирующий в отсутствие

КБ-ДМ2е ВМАльт

КБ-М2е ВМАльт

Рис. 5. Электронно-микроскопический анализ препаратов ВПЧ, выделенных из растительного экстракта листьев растений N. benthamiana, образованных КБ ВМАльт, КВ-ДМ2е ВМАльт и КБ-М2е ВМАльт. Негативное контрастирование 1% раствором уранила-цетата; х 250000.

геномной РНК вирусоподобные наночастицы, может служить платформой для эффективной презентации на поверхности ВПЧ эпитопов инфекционных агентов человека и животных. Химерные капсидные белки ВМАльт с модельными гетерологичными пептидами, эпитопами белка М2 вируса гриппа А, также способны формировать стабильные ВПЧ. Система экспрессии на основе гибридных вирусных векторов ХВК-КБ ВМАльт и ХВШг-КБ ВМАльт является генетически безопасной; использование этой векторной системы позволяет избежать самопроизвольного вертикального и горизонтального заражения растений, неконтролируемого распространения генетического материала в окружающей среде. •

Авторы выражают благодарность П.А. Иванову за предоставление кДНК копии 3-концевой области геномной РНК ВМАльт, А. Мухамеджановой за препарат мышиных антител к КБ ВМАльт и Т.В. Гасановой за препарат мышиных антител к эпитопу М2е вируса гриппа А.

Работа выполнена при финансовой поддержке Министерства образования и науки РФ (государственный контракт 02.527.11.0002) и 7-й рамочной программы Европейского союза (проект PLAPROVA).

СПИСОК ЛИТЕРАТУРЫ

1. Giddings G., Allison G., Brooks D., Carter A. // Nat. Biotech-nol. 2000. V. 18. № 11. P. 1151-1155.

2. Lindbo J.A. // Biotechnology. 2007. V. 7. P. 1-11.

3. Yusibov V., Rabindran S., Commandeur U., Twyman R.M., Fischer R. // Drugs. 2006. V. 7. № 4. P. 203-217.

4. Baulcombe D.C., Chapman S., Santa Cruz S. // Plant J. 1995. V. 7. № 6. P. 1045-1053.

5. Shivprasad Sh., Pogue G.P., Lewandowski D.J., Hidalgo J., Donson J., Grill L.K., Dawson W.O. // Virology. 1999. V. 255. № 2. P. 312-323.

6. Wagner B., Fuchs H., Adhami F., Ma Y., Scheiner O., Breitene-der H. // Methods. 2004. V. 32. № 3. P. 227-234.

7. Takamatsu N., Ishikawa M., Meshi T., Okada Y. // EMBO J. 1987. V. 6. № 2. P. 307-311.

8. Ravin N.V., Kuprianov V.V., Zamchuk L.A., Kochetov A.V., Do-rokhov Yu.L., Atabekov J.G., Skryabin K.G. // Biochemistry (Moscow). 2008. V. 73. № 10. P. 1108-1113.

9. Ravin N.V., Mardanova E.S., Kotyarov R.Y., Novikov V.K., Atabekov J.G., Skryabin K.G. // Biochemistry (Moscow). 2008. V. 73. № 1. P. 44-49.

10. Komarova T.V., Skulachev M.V., Zvereva A.S., Schwartz A.M., Dorokhov Yu.L., Atabekov J.G. // Biochemistry (Moscow). 2006. V. 71. № 8. P. 846-850.

11. Natilla A., Hammond R.W., Nemchinov L.G. // Arch. Virol. 2006. V. 151. № 7. P. 1373-1386.

12. Huang Z., Santi L., LePore K., Kilbourne J., Arntzen Ch.J., Mason H.S. // Vaccine. 2006. V. 24. № 14. P. 2506-2513.

13. Santi L., Barchelora L., Huanga Z., Hjelm B., Kilbourne J., Arntzen Ch.J., Chen Q., Hugh S., Mason H.S. // Vaccine. 2008. V. 26. № 15. P. 1826-1824.

14. Santa Cruz S., Chapman S., Roberts A.G., Roberts I.M., Prior D.A., Oparka K. // Proc. Natl. Acad. Sci. USA. 1996. V. 93. № 13. P. 6286-6290.

15. Unde K., Fischer R., Commandeur U. // Arch. Virol. 2005. V. 150. № 2. P. 327-340.

16. Werner S., Marillonner S., Hause G., Klimyuk V., Gleba Y. // Proc. Natl. Acad. Sci. USA. 2006. V. 103. № 47. P. 17678-17683.

17. Zelada A.M., Calamante G., Santangelo M., Bigi F., Verna F., Mentaberry A., Cataldi A. // Tuberculosis. 2006. V. 86. № 3-4. P. 263-267.

18. Molnar E., Dopfer E.P., Deswal S., Schamel W.W. // Curr. Pharm. Des. 2009. V. 15. № 28. P. 3237-3248.

19. Lico C., Chen Q., Santi L. // J. Cell Physiol. 2008. V. 216. № 2.

P. З66-З77.

20. Noad R., Roy P. // Trends Microbiol. 200З. V. 11. № 9. P. 4З8-444

21. Denis J., Majeau N., Acosta-Ramirez E., Savard Ch., Bedard M.C., Simard S., Lecours K., Bolduc M., Pare Ch., Willems B., et al. // Virology. 2007. V. З6З. № 1. P. 59-68.

22. Denis J., Acosta-Ramirez E., Zhao Y., Hamelin M.-E., Koukavica I., Baz M., Abed Y., Savard Ch., Pare Ch., Macias C.L., et al. // Vaccine. 2008. V. 26. № 27-28. P. ЗЗ95-З40З.

23. McCormick A.A., Palmer K.E. // Expert. Rev. Vaccines. 2008. V. 7. № 1. P. ЗЗ-41.

24. Brennan F.R., Jones T.D., Longstaff M., Chapman S., Bellaby T., Smith H., Xu F., Hamilton W.D.O., Flock J.I. // Vaccine. 1999. V. 17. № 15-16. P. 1846-1857.

25. Porta C., Spall V.E., Loveleand J., Johnson J.E., Barker P.J., Lomonosoff G.P. // Virology. 1994. V. 202. № 2. P. 949-955.

26. Joelson T., Akerblom I., Oxelfelt P., Strandberg B., Tomenius K., Morris T.J. // J. Gen. Virol. 1997. V. 78. № 6. P. 121З-1217.

27. Natilla A., Piazzolla G., Nuzzaci M., Saldarelli P., Tortorella C., Antonaci S., Piazzolla P. // Arch. Virol. 2004. V. 149. № 1. P. 1З7-154.

28. Мещерякова Ю.А., Эльдаров М.А., Мигунов А.И., Степанова Л.А., Репко И.А., Киселев О.И., Ломоносов Д.П., Скрябин К.Г. // Молекуляр. биология. (Москва). 2009. V. 4З. № 4. P. 741-750.

29. Wu L., Jiang L., Zhou Z., Fan J., Zhang Q., Zhu H., Han Q., Xu Z. // Vaccine. 200З. V. 21. № 27-З0. P. 4З90-4З98.

30. Jiang L., Li Q., Li M., Zhou Z., Wu L., Fan J., Zhang Q., Zhu H., Xu Z. // Vaccine. 2006. V. 24. № 2. P. 109-115.

31. Lico Ch., Mancini C., Italiani P., Betti C., Boraschi D., Benve-nuto E., Baschieri S. // Vaccine. 2009. V. 27. № З1. P. 5069-5076.

32. Palmer K.E., Benko A., Doucette S.A., Cameron T.I., Foster T., Hanley K.M., McCormick A.A., McCulloch M., Pogue G.P., Smith M.L., Christensen N.D. // Vaccine. 2006. V. 24. № 26.

P. 5516-5525.

33. Fujiyama K., Sarjung W., Yanagihara I., Nakado J., Misaki R., Honda T., Watanabe Y., Seki T. // J. Biosci. Bioengin. 2006. V. 101. № 5. P. З98-402.

34. Komarova T.V., Baschieri S., Donini M., Marusic C., Ben-venito E., Dorokhov Yu.L. // Expert. Rev. Vaccines. 2010. V. 9. № 8. P. 859-876.

35. Nemchinov L.G., Natilla A. // Protein Expr. Purif. 2007. V. 56. № 2. P. 15З-159.

36. Leclerc D., Beauseigle D., Denis J., Morin H., Pare Ch., Lama-

rre A., Lapointe R. // J. Virol. 2007. V. 81. № 3. P. 1319-1326.

37. Morin H., Tremblay M.-H., Plante E., Pare Ch., Majeau N., Hogue R., Leclerc D. // J. Biotechnol. 2007. V. 128. № 2. P. 423-434.

38. Saunders K., Sainsbury F., Lomonossoff G.P. // Virology. 2009. V. 393. № 2. P. 329-327.

39. Kothyarov R.Y., Kuprianov V.V., Migunov A.I., Stepanova L.A., Tsybalova L.M., Kiselev O.L., Ravin N.V., Skryabin K.G. // Acta Naturae. 2010. V. 2. № 2(5). P. 71-76.

40. Sambrook J., Russel D. Molecular Cloning: A Laboratory Manual. N.Y.: CSHL Press, 2001.

41. Chen H., Nelson R.S., Sherwood J.L. // Biotechniques. 1994. V. 16. № 4. P. 664-668.

42. Laemmli U. // Nature. 1970. V. 227. № 5259. P. 680-685.

43. Tyulkina L.G., Karger E.M., Sheveleva A.A., Atabekov J.G. // J. Gen. Virol. 2010. V. 91. № 6. P. 1621-1628.

44. Tollin P., Wilson H.R. // The Plant Viruses / Ed. Milne R.C. N.Y.: Plenum Press, 1988. V. 4. P. 51.

45. Atabekov J.G., Dobrov E.N., Karpova O.V., Rodionova N.P. // Molec. Plant Pathol. 2007. V. 8. № 5. P. 667.

46. Geering A.D.W., Thomas J.E. // Arch. Virol. 1999. V. 144. № 3. P. 577-592.

47. Erickson J.W., Bancroft J.B. // Virology. 1976. V. 72. № 2. P. 514-517.

48. Liu W., Zou P., Chen Y.-H. // Immunol. Lett. 2004. V. 93. № 2-3. P. 131-136.

49. Liu W., Zou P., Jian D., Chen Y.-H. // Microb. Infect. 2005. V. 7. № 2. P. 171-177.

50. Fiers W., De Filette M., Birkett A., Neirynck S., Min Jou W. // Virus Res. 2004. V. 103. № 1-2. P. 173-176.

51. Lukashina E., Badun G., Fedorova N., Ksenofontov A., Nemykh M., Serebryakova M., Mukhamedzhanova A., Rodionova N., Baratova L., Dobrov E. // FEBS J. 2009. V. 276. № 23. P. 7006-7015.

i Надоели баннеры? Вы всегда можете отключить рекламу.