Protistology 18 (2): 113-129 (2024) | doi:10.21685/1680-0826-2024-18-2-3 Pl'OtiStOlO&y
Original article
New data on Thecamoeba striata (Penard, 1890) (Amoebozoa, Discosea, Thecamoebida), and the geographical distribution of "T. striata species group"
Yelisei Mesentsev*, Savelii Poluzerov and Alexey Smirnov
Department of Invertebrate Zoology, Faculty of Biology, St. Petersburg State University, 199034 St. Petersburg, Russia
| Submitted December 5, 2023 | Accepted April 29, 2024 |
Summary
Until recently, it was believed that amoebae of the genus Thecamoeba Fro-mentel, 1874 could be relatively easily distinguished from each other at the light-microscopic level. The main characteristics were the shape and size of the locomotive form and the morphology of the nucleus. However, recent studies with molecular methods have shown that several sibling species may be hidden behind every "classical" morphological species of Thecamoeba. Therefore, re-description and obtaining molecular data on "classic" Thecamoeba species became necessary tasks. However, during recent decades, almost all type cultures have been lost from international culture collections. During our study of the fauna of Moscow ponds, we isolated a strain identical to the type culture of T. striata established by F.C. Page both at the morphological level and by the sequence of the 18S rRNA gene. We obtained new images that clearly illustrated the diversity of locomotive forms and the morphology of the nucleus of the species T. striata. An analysis of faunistic studies showed that amoebae of " T. striata species group" are distributed almost worldwide and are a common component of freshwater and terrestrial ecosystems.
Key words: Amoebozoa, phylogeny, systematics, Thecamoeba
Introduction
Lobose amoebae of the genus Thecamoeba Fromentel, 1874 are widely distributed in a variety of habitats: bottom sediments of freshwater and saltwater bodies, soil, leaf litter, plant surfaces and other terrestrial habitats (Greeff, 1866; Penard, 1905, 1913; Page, 1971, 1977; Kudryavtsev and Hausmann, 2009; Mesentsev and Smirnov, 2019, 2021; Mesentsev et al., 2020, 2022, 2023). The members of this group have remarkable morphological features,
https://doi.org/10.21685/1680-0826-2024-18-2-3
© 2024 The Author(s)
Protistology © 2024 Protozoological Society Affiliated with RAS
such as smooth rounded or oval contours of the locomotive form. They do not produce discrete pseudopodia or subpseudopodia, but form surface wrinkles and folds. These features make it easy to distinguish members of the genus Thecamoeba from other amoebae. Most species have a complex nuclear structure. For some time, it was thought that species of the genus Thecamoeba could be easily identified by light microscopy (Page, 1977).
However, recent studies suggest that each "classical" Thecamoeba morphospecies is likely to
Corresponding author: Yelisei Mesentsev. Department of Invertebrate Zoology, Faculty of Biology, St. Petersburg State University, Universi-tetskaya Emb. 7/9, 199034 St. Petersburg, Russia; e.mezentsev@spbu.ru
contain several sibling species that have tiny morphological differences and can only be distinguished by molecular methods. Nowadays, three such groups ofspecies are known (Mesentsev and Smirnov, 2019; Mesentsev et al., 2020, 2022). Each of them forms a monophyletic branch on the phylogenetic tree. The discovery of sibling species made it necessary to obtain molecular data on "classical" species. Light microscopic data for many "classical" species were obtained in the second half of the 20th century (Page, 1971, 1977; Smirnov, 1999). Type cultures of these species have never been established or have been lost, and there are no molecular data for them. There are only two 18S rRNA gene sequences from Thecamoeba type cultures: those of T. similis (Fahrni et al., 2003) and T. striata (Mesentsev et al., 2022).
The species Amoeba (= Thecamoeba) striata was described by Penard (1890). These flattened amoebae have a smooth, elongated to oval outline, and usually form 3—4 longitudinal dorsal ridges. The nucleus of Amoeba striata contains flattened peripheral nucleoli. Schaeffer placed the species Amoeba striata in the genus Thecamoeba (Schaeffer, 1926). Bovee and Jahn (1966) proposed to separate small amoebae with distinct dorsal ridges from those with irregular dorsal ridges and multiple folds. Two suborders, Rugina and Striatina, were established within the order Thecida Bovee et Jahn, 1966. The suborder Striatina contained the single family Striamoebidae with the type species Striamoeba (= Thecamoeba) striata. Bovee (1985) listed this family as a member of the suborder Thecina and included the species Striamoeba munda (Schaeffer, 1926) in the genus Striamoeba. However, Page (1971, 1977) and other authors (e.g. Rogerson and Patterson, 2000; Smirnov and Brown, 2004) did not support the division of the genus. Some species, including T. striata, have been re-described and neotypified on the basis of Penard's original description (Page, 1977; Smirnov, 1999). Recently, a sibling species of T. striata, T. vumurta, was described by Mesentsev et al. (2022).
The amoebae identified as T. striata have been mentioned in studies from various fields of biology: from cell biology to faunistic studies. Its laconic, almost "bilateral" locomotive form attracted the attention of researchers of amoeboid locomotion (Rhumbler, 1898; Abé, 1961, 1962). Experiments on aspects of cultivation and nutrition of Thecamoeba spp. were carried out by Page (1977). In particular, he obtained data on selective feeding and the need for T. striata to hunt smaller amoebae. In faunistic and ecological studies, amoebae identified as T.
striata have been found in a wide range offreshwater and terrestrial habitats. Furthermore, amoebae morphologically identified as T. striata are hosts of unique intranuclear parasites of the species Nucleophaga striatae (Rozellomycota) (Michel et al., 2021), as well as fungi of the genus Acaulopage (Zoopagales; Fungi; Opistokonta) (Michel et al., 2014; Corsaro et al., 2017).
Despite the interest of researchers and frequent records, there is a noticeable lack of modern data on T. striata. GenBank contains three 18S rRNA gene sequences attributed to T. striata. One of these sequences was obtained from type culture CCAP 1583/4, which was established by Page as the neotype of T. striata (Page, 1977; Mesentsev et al., 2022). It is a partial sequence of 1083 bp. The other two show significant divergence from the type sequence as well as from the sequence of T. vumurta, the second species belonging to the " T. striata species group" (Patsyuk, 2023).
During our studies of the fauna of amoeboid organisms in urban freshwater reservoirs, we isolated an amoeba belonging to the " T. striata species group". The sequence of the 18S rRNA gene of this isolate was found to be identical to that of the type culture of T. striata CCAP 1583/4. From this, we concluded that we had re-isolated the species T. striata. We re-described T. striata using modern light microscopy and obtained a more complete sequence of the 18S rRNA gene.
Material and methods
Isolation and cultivation
Thecamoeba striata strain T1O1 was isolated from the upper layer of pond sediment of Oleniy Pond, in the park Sokolniki, Moskow, Russia (Sur-kova et al., 2022). To isolate cells, a small volume of the sediment was placed in sterile 60 mm Petri dish filled with wMY agar (Spiegel et al., 1995). In order to get a clonal culture, tiny fragments of agar containing a single amoeba cell were cut off and transferred each to a fresh dish filled with the same medium. Clones were cultured with accompanying bacteria, fungi, and small non-identified amoebae.
Light microscopy
Live cells were studied, measured, and photographed on the glass object slides using a Leica DM2500 upright microscope equipped with diffe-
rential interference contrast (DIC) and phase contrast optics and a DS-Fi3 camera (Nikon, USA). To increase the focal depth, we applied z-stacking as described by Mesentsev et al. (2020).
DNA EXTRACTION AND SEQUENCING
To extract DNA, cells were washed offfrom the agar surface with an aliquot of sterile Prescott and James (PJ) medium (Prescott and James, 1955) and left to starve for three days (Mesentsev et al., 2023). After that, the cells were transferred in 0.2 ml PCR tubes in small volume of sterile PJ medium. The genomic DNA from a few cells was extracted using the Arcturus PicoPure DNA Extraction Kit (Thermo Fisher Scientific, USA). For PCR amplification of the 18S rRNA gene, we used the forward RibA (5'>ACCTGGTTGATCCTGCCAGT<3') primer, which is the second half of the original "Primer A" (Medlin et al., 1988) and the reverse RibB (5'>TGATCCTTCTGCAGGTTCACCTAC<3') primer (Pawlowski, 2000); also Thermo Scientific Taq DNA Polymerase (Thermo Fisher Scientific, USA) were used. Thermal cycle parameters were: initial denaturation (10 min at 95 °C) followed by 39 cycles of 30 s at 94 °C, 60 s at 58 °C, and 120 s at 72 °C, followed by 10 min at 72 °C for the final extension. Amplicons were purified in 1.5% agarose gel using the Cleanup mini Purification Kit (Eurogene, Moscow, Russia). All amplicons were sequenced directly using the ABI-PRISM Big Dye Terminator Cycle Sequencing Kit with s6F, s12.2, s12.2R, s14 and s20R primers for the 18S rRNA gene (Medlin et al., 1988; Pawlowski, 2000; Adl et al., 2014). A search in the GenBank database (Benson et al., 2013) was performed using BLASTN (Zhang et al., 2000) on the NCBI site (https://www.ncbi.nlm. nih.gov/). The system by Petrov et al. (2014) was used as a reference to identify regions and helices in the sequence of the 18S rRNA gene.
Phylogenetic analysis
Obtained sequences were added in the alignment of Thecamoebida sequences, containing all named sequences of these organisms and a set of outgroups. Sequences were automatically aligned using the Muscle algorithm (Edgar, 2004) implemented in SeaView 4.0 (Gouy et al., 2010); the alignment was further refined manually. Initial selection of nucleotide sites for tree inference was done using GBlocks (Castresana, 2000). The
phylogenetic analysis was performed using the maximum likelihood method as implemented in the RaxML program (Stamatakis, 2014) with the GTR + у model; 1655 sites were selected for the analysis, and 1000 bootstrap pseudoreplicates were used. Bayesian analysis of the same dataset was performed using MrBayes 3.2.6, GTR model with gamma correction for intersite rate variation (8 categories), and the covarion model (Ronquist and Huelsenbeck, 2003). Trees were run as two separate chains (default heating parameters) for 10 million generations, by which time they had ceased converging (the final average standard deviation of the split frequencies was less than 0.01). The quality of chains was estimated using built-in MrBayes tools and additionally using the software Tracer 1.6 (Rambaut et al., 2014); based on the estimates by Tracer, the first 25 % of generations were discarded as burn-in. RaxML and MrBayes programs were run at the Cipres V.3.3 website (Miller et al., 2010).
The obtained sequence was deposited with Gen Bank under the number OR994897 (Thecamoeba striata T1O1, length 1962 bp).
Results and discussion
Light microscopy
On slides, the cells adhered relatively quickly to the glass surface and began to move. The locomotive form of strain T1O1 amoebae was similar to that described by Page (1971, 1977) for T. striata. The amoebae moved as a whole and did not form pseu-dopodia or subpseudopodia. Locomotive amoebae had the shape of an elongated oval with a slightly narrowed posterior end (Fig. 1, A-I). The anterior edge was usually rounded and could have small smooth irregularities. The lateral sides of the cell were either slightly convex or almost parallel. The posterior end was noticeably tapered, smoothly rounded and had no differentiated uroidal structures. The widest part ofthe cell was the central area or anterior half of the amoeba. The size range of T1O1 cells overlapped with that ofthe type strain and three other cultures of T. striata isolated by Page (Table 1). During locomotion, the cells were unevenly flattened. The anterior end was often flatter and continued smoothly into the thicker main body of the cell. The posterior end was usually raised above the substrate. The central part of the cell, filled with granuloplasm, was convex. Clearly thinner lateral
Fig. 1. Light microscopy of T. striata strain T1O1, DIC. A—D and F—I — Locomotive forms, z—stacking; E — ventral surface of the amoeba; J and K — slowly moving locomotive forms, z—staking; L and M — stationary forms, z—staking. Abbriviation: cv — contractile vacuole; fv— food vacuole; white arrow — lateral lobe; black arrow — dorsal fold; black arrowhead — ridge; white triangle — hyaloplasm outgrows. Scale bar: 10 ^m.
lobes were located along the sides of the cell. The lateral lobes started smoothly in the frontal area and extended almost to the posterior end ofthe cell. The anterior part of the cell consisted ofthe hyaloplasm, which could occupy up to half the length of the cell. The hyaloplasm continued to the lateral sides of the cell, forming the antero-lateral hyaline crescent. The dorsal side of the cell usually had several well-defined longitudinal ridges. The ridges began in the frontal hyaline area with a small, gently sloping extension and typically continued to the posterior end of the cell. In the frontal area, we occasionally observed small wrinkles running parallel to the frontal edge of the cell. The ventral side had small
smooth irregularities that were clearly visible only in the frontal area of the hyaloplasm (Fig. 1, E).
When the cell changed the direction of movement during continuous locomotion, it moved the frontal hyaline area slightly sideways and bent in a new direction. Sometimes cells reversed the direction of movement. When this happened, the cell stopped and formed a new hyaline region in the uroidal area. A similar radical change in direction of movement was observed by Rhumbler (1898). Rarely, at the beginning of the observation, individual cells could stop, detach from the substrate and begin to float as irregular bodies. Slowly moving cells were wider in outline and more wrinkled (Fig
Table 1. Morphometric data of the strains of "T. striata species group".
Species (source) 75, CCAP 1583/4 (Page, 1971) 76 (Page, 1971) 77 (Page, 1971) 112 (Page, 1971) T1O1 T. vumurta Ta130 (Mesentsev et al., 2022)
Length 28-78 30-62 32-78 31-60 32-66 46-73
Mean length 48 49 52 49 46.2 60.7
Breadth - - - - 18-35 32-59
Mean breadth - - - - 24.7 46.1
L/B ratio 1.1-2.2 1.2-2.3 1.4-3.4 1.1-2.1 1.4-2.5 1.0-1.8
Mean L/B ratio 1.5 1.7 2.0 1.4 1.9 1.3
Nucleus diameter 7-10 6-9 6.5-9 - 6-9 9-15
Mean nucleus diameter 7.7 (Page, 1988) - - - 7.5 13
1, J and K). Slow moving cells frequently changed direction. Such cells produced several hyaline areas so that the outline of the cell resembled an irregular polygon with rounded corners. The dorsal ridges of such cells were arranged in different directions, corresponding to the new and previous directions of movement. Stationary cells had irregular, rounded outlines (Fig. 1, L and M). The surface of stationary cells was covered with multidirectional folds and ridges. The peripheral hyaline layer in such cells was more uniform in width. A single or a few small rounded protrusions could appear at the edges of the cell.
The size and structure of the nucleus was consistent with the description of T. striata by Page (1971, 1977). The single nucleus had a clearly visible flexible envelope (Fig. 2). The outline of the nucleus was round or slightly elongated. The nuclear envelope could be deformed in contact with organelles or denser areas of cytoplasm (Fig. 2, C and D). The nucleus contained peripheral nucleoli that were almost adjacent to the nuclear envelope (Fig. 2). Nucleoli had lens-like or broad plate shape, and occupied more than half of the inner nuclear surface. Small nucleoli were homogeneous in texture and smooth in outline (Fig. 2, A, E and G). Plate-shaped nucleoli showed lacunae and invaginations. Depending on the projection of the nucleus, one to four nucleoli could be visible. However, the visible nucleolar material often represented an optical section of several lobes belonging to the single broad nucleolus (Fig. 2, H). Page (1971) described the same number of nucleoli, but Penard (1890) indicated in the original description that there were only two nucleoli, located on opposite sides of the nucleus. A similar nuclear morphology with oppositely located
nucleoli has been described for T. munda (Schaeffer, 1926; Smirnov, 1999), but it is almost impossible to confuse it with T. striata, both because of other morphological differences and because T. munda has only been isolated from marine habitats. The central part of the karyoplasm never contained nucleolar material. Rarely, small spherical or slightly flattened structures could be seen adjacent to the inner side of the nucleoli or close to the nuclear envelope (Fig. 2, K—M). Similar differences in the shape and texture of nucleoli within a nucleus have been noted in the sibling species T. vumurta and may be a feature of the "T. striata species group" (Mesentsev et al., 2022).
Numerous food vacuoles containing amoeba cysts, bacteria or fungal conidia (Fig. 1, C; Fig. 2, M) were present in the cytoplasm. The contractile vacuole was usually several times larger than the nucleus and was highly deformable, in agreement with older observations (Penard, 1890, 1902, 1905; Page, 1971, 1977). As it moved in the cytoplasm, multiple invaginations could reach almost to the centre of the vacuole (Fig. 1). The cell produced empty vacuoles of various sizes which, after a short time, fused with the contractile vacuole. The cytoplasm of the cell also contained small round or oval bodies (Fig. 2, M) and spherical dense granules, clearly visible by DIC.
Molecular phylogenetic analysis (Fig. 3)
The length of the 18S rRNA gene sequence obtained is 1962 bp, corresponding to helices 20—44. The degree of identity between the sequences obtained from type strain CCAP 1583/4 and T1O1 was 99.82% (corresponding to two single substitutions in
Fig. 2. Light microscopy of the cytoplasm of T. striata strain T1O1, DIC. A—G, I —L — Nuclei of T. striata; H — schematic drawing of the nucleus of T. striata; M — higher magnification of the cell showing granuloplasm, nucleus, and cytoplasmic inclusions. Abbriviation: fv — food vacuole; l — lacuna; n — nucleus; nu — nucleolus; black arrow — intranuclear spherical body; black arrowhead — cytoplasmic spherical body, white arrowhead — citoplasmic small granule.
the 1083 bp fragment). Comparison ofthe sequences of T. striata and T. vumurta confirmed the presence ofmotifs unique to this clade in conserved and semi-conserved regions of the 18S rRNA gene (e.g. the 22nd and the end of the 21st helices) (Mesentsev et al., 2022).
Comparison of the obtained sequence with other sequences named T. striata (OQ134482 and OQ134483) showed significant differences in conserved regions (Patsyuk, 2023). The two sequences are almost identical. BLAST analysis of these sequences showed a high degree of similarity (more than 99%, at 1613 bp) to the sequence of Thecamoeba
sp. ATCC PRA-35. The strain ATCC PRA-35 was initially identified as a Thecamoeba-like organism (Yoon et al., 2008), but was later described as Parv-amoeba monura (Himatismenida) (Cole et al., 2010). Despite the re-description of strain ATCC PRA-35 and the change in its systematic position, the sequence is still listed in NCBI as Thecamoeba sp. This appears to be partly responsible for the misidentification of sequences OQ134482 and OQ134483. This highlights the need for critical evaluation of GenBank sequence annotations. At the same time, the data obtained by Patsyuk (2023) raise some questions. The material used to obtain the
Fig. 3. Molecular phylogenetic tree based on 18S rRNA gene sequences of all named species belonging to Thecamoebida and some species of Dermamoebida and Acathopodida used as outgroup. 1655 sites used in the analysis. Node supports indicated as PP/BS values; black circles mark fully supported nodes (1.0/100 support), white circles mark highly supported nodes (PP>0.95 and BS>95).
sequences were amoebae isolated from freshwater habitats. However, both known representatives of the genus Parvamoeba are marine amoebae (Ro-gerson, 1993; Cole et al., 2010).
Identification and geographical distribution of
" T. STRIATA SPECIES GROUP"
Despite the presence of clearly visible characters in cell morphology and nuclear morphology, there are many identifications of amoebae of the genus Thecamoeba in the literature that apparently do not correspond to the original descriptions and modern species boundaries. There are cases where striate amoebae with a vesicular nucleus have been identified as T. striata (e.g. Bovee, 1953; Pappas, 1954), although in modern understanding this set of characters corresponds to the species T. quad-rilineata (Page, 1977). Part of the reason for this misidentification may be the uncertainty about the morphology of the nucleus that remains from Penard's work. In the original description, Penard (1890) characterised T. striata as an amoeba with peripheral opposite nucleoli. In later studies, Penard pointed out that the nuclei of T. striata had a compact nucleolus, often containing lacunae
that could be large enough to give the nucleolus the appearance of a peripheral ring, which could be fragmented (Penard, 1902, 1905). The restructuring of nucleoli proposed by Penard erased the clear morphological boundaries between the striate amoebae of the species T. striata and T. quadrilineata in the modern sense (Page, 1988). This confusion persisted until the neotypification of both species by Page (1971, 1977). However, names such as "Amoeba striata" or " Striamoeba striata" can also be found in some relatively recent papers (e.g. Jiang and Shen, 2003, 2005; Liu et al., 2008). The use of such names, especially "Striamoeba striata", may indicate the use of outdated identification keys, e.g. those by Bovee, who also did not distinguish between T. quadrilineata and T. striata (Bovee, 1953). In most of these studies, it is not possible to verify the correctness of the species identification, because no detailed illustrative material was provided.
However, even correct morphological identification without the use of molecular methods cannot be considered reliable. A sibling species, T. vumurta, has been described for T. striata (Mesentsev et al., 2022). This species cannot be distinguished on the basis of the morphology of individual cells because their size ranges overlap, while minute differences
Fig. 4. Map showing the finding sites of "T. striata species group". Circle marker with a star — a molecular confirmed finding of T. striata; green marker — terrestrial habitat; blue marker — freshwater habitat; gray marker — unidentified habitat, orange marker — finding of T. vumurta.
in the morphology of the nucleus are not constant features. The lack of molecular identification in most faunistic studies suggests that the isolated amoebae may belong to the " T. striata species group" rather than the species T. striata.
Amoebae of the " T. striata species group" have been recorded almost all over the world (Fig. 4; Table 2): repeatedly in Eurasia and North America, and once in South America and Australia. The closest records to the poles have been made near the polar circles: on Surtsey Island near Iceland in the north and on Livingston Island near Antarctica in the south. There is evidence of their presence on islands quite far from the mainland; in addition to the islands near the Arctic Circle, there are references to their discovery in Puerto Rico, Ascension Island and New Zealand. An interactive map of isolation sites for amoebae identified as T. striata is also available at the following link: https://www. google.com/maps/d/u/0/edit?mid=18XSybJUxU EqmWHeOVZMPdukgbMNTXqE&usp= sharing.
Generally, these works indicate that these amoebae are isolated from the bottom sediments of lakes and rivers, from the water column and groundwater, and there is also evidence of their presence on the surface of freshwater soft-shelled turtles. In terrestrial habitats, they have been isolated from samples of various soils, cyanobacterial mats,
lichens, mosses, tree bark and leaf litter. In addition to isolation from natural habitats, amoebae identified as T. striata have been found in water samples from urban swimming pools (Rivera et al., 1983) and municipal wastewater treatment systems of various designs (Liu et al., 2008).
Almost all faunal studies lack photographs or other images of the amoebae to verify the correct identification of the organisms found. The need for such verification arises in the context of the difficulties in distinguishing T. quadrilineata from T. striata, and the unclear origin of the two T. striata sequences in GenBank (both cases are described above). We can only speak with confidence of a few cases of reliable isolation of amoebae belonging to the "T. striata species group": Wisconsin, USA and Cambridge, UK (Page, 1971, 1977), Moscow, Russia (Surkova et al., 2022) and Izhevsk, Russia (Mesentsev et al., 2022). Even these few data indicate a wide distribution of amoebae of this morphological species, but only in the Northern Hemisphere.
Acknowledgments
Supported by RSF 23-24-00397 research grant. The present study utilized equipment of the Core facility centres "Development of molecular and cell
Table 2. Findings of amoebae of the "T. striata species group".
No Reference Geographic location Sample type Habitat
1 Penard, 1890 Germany, Wiesbaden pond, bottom sediment (?) aquatic
2 Edmondson, 1920 USA, North Dakota, Stump lake plant infusion from the lake aquatic
3 Stout, 1958 New Zealand, in central North Island near Waiouru (Thornton, 1958) Taupo hill soil, the topsoil (2- 4 in.) between tussock plants and the topsoil near to the tussock plants terrestrial
4 Stout, 1958 New Zealand, Canterbury, Black Range near Bealey (Thornton, 1958) Tekoa steepland soil, the topsoil (2- 4 in.) between tussock plants and the topsoil near to the tussock plants terrestrial
5 Stout, 1960 New Zealand, near Waiouru (Stout, 1958) brown and in-rolled tussock leaves terrestrial
6 Bovee, 1960 USA, Virginia, Giles County, Mountain Lake region water, some surface and bottom detritus from the small muddy, turbid pool at piped spring aquatic
7 Bovee, 1960 USA, Virginia, Giles County, Mountain Lake region water, some surface and bottom detritus from shallow, rain-filled rock pool Bald Knob of Salt Pond Mt., with lechens and dead leaves aquatic
8 Bovee, 1960 USA, Virginia, Giles County, Mountain Lake region water, some surface and bottom detritus from small brook in gully parallelling main pond creek draining pond seepage aquatic
9 Stout, 1963 UK, Chiltern Hills, The acid mull site: Oaken Grove loose overlying litter consisted predominantly of beech leaves with some twigs and some ash leaves terrestrial
10 Stout, 1963 UK, Chiltern Hills, The calcareous mull site: Hobbs Hill granular, chalky soil also with many fine roots terrestrial
11 Bovee, 1965 USA, Florida, Gainesville, culvert under NW 16th Avenue at the north end of NW 19th Street. slightly polluted water from the flowing stream aquatic
12 Bovee, 1965 USA, Florida, Gainesville, rural creek (Lazonby's Branch) water from creek accepted runoff from several small suburban areas and a cattle pasture, and has meandered slowly through dense woodland ; seldom any evidence remaining of pollution, human or industrial aquatic
13 Page, 1971 USA, Wisconsin, Janesville, edge of Rock River Bottom sediment (?) aquatic
14 Holmberg and Pejler, 1972 Iceland, Surtsey island moss patches 1 m S of the fenced area terrestrial
15 Page, 1977 UK, River Great Ouse (Old West River) Bottom sediment (?) aquatic
16 Robinson, 1980 Australia, Adelaida water samples aquatic
17 Bovee, 1981 USA, Kansas, Kansas river near Lawrence the surface of the smooth softshell turtl from Kansas river aquatic
18 Rivera et al., 1983 Mexica, Mexico water from indoor and outdoor swimming pools aquatic
19 Stout, 1984 New Zealand, south-east of North Island, Ngakawau, 4.5 km southwest of Castlepoint the surface 2.5 cm of topsoil seasonally flooded grassland. From the negative control area or experimental area with treatment of insecticide/ nematicide aquatic
20 Flößner et al., 1985 Germany, Lake Stechlin - aquatic
21 Inamori Y. et al., 1987 Japan, Lake Kasumigaura - aquatic
22 Guhl, 1987 Germany, Düsseldorf, Baggersee Eller lake the surface water aquatic
23 Das et al., 1993 India, Kamarkundu, Calcutta and Hughly districts Soil and freshwater aquatic and terrestrial
24 Smirnov and Goodkov, 1996 Russia, Republic of Karelia, Ladoga lake, Valaamo Island, Leshchevo lake upper 10 cm of sediments aquatic
Table 2. Continuation.
No Reference Geographic location Sample type Habitat
25 Herdendorf et al., 2000 USA, Ohio, Old Woman Creek Estuary - aquatic
26 Mrva, 2003 Slovakia, Dechtice, Nahàc, Katarinka dendrotelmae (sediment with decaying leaves, water) terrestrial
27 Jiang et al., 2003 China, River Hanjiang The PFU (Polyurethane foam Unit) method aquatic
28 Bamforth, 2004 USA, Arizona, Grand Canyon Crusts compounded by Cyanobacteria, or Bryophytes, or together terrestrial
29 Golemansky and Todorov, 2004 Antarctica, Livingston Island, Hurd Peninsula moss terrestrial
30 Mrva, 2005 Slovakia, Malé Karpaty Mts., Fùgelka (Zlinska et al., 2005) 3 km NW from the village of Dubova, oak-hornbeam forests, mosses growing on soil terrestrial
31 Mrva, 2005 Slovakia, Malé Karpaty Mts., Nahac, Katarinka (Zlinska et al., 2005) old oak-hornbeam forest stand under the monastery ruins, mosses growing on soil terrestrial
32 Mrva, 2005 Slovakia, Trnavska pahorkatina hills, Lindava (Zlinska et al., 2005) 1 km on E from the village of Pila, oak-hornbeam forests, mosses growing on soil terrestrial
33 Mrva, 2005 Slovakia, Malé Karpaty Mts., Losonec-lom quarry (Zlinska et al., 2005) oak-hornbeam forests, mosses growing on soil terrestrial
34 Jiang and Shen, 2005 China, Hunan, Changde The PFU blocks placed at the depth of 1 m below the surface water for 15-20 days aquatic
35 Khaled and Saeed, 2006 Yemen, Lahej Governorate, Al-Anad bridge, Tuban valley - -
36 Wilkinson and Smith, 2006 Ascension Island, Sisters Peak Moss and lichen "crust" just below the summit. Soil; arid, limited plant cover e.g. Ipomoea pescaprae terrestrial
37 Bamforth, 2007 USA, Puerto Rico, The Luquillo National Forest In tabonuco forest: - soil under the litter on 30° slope. - litter on riparian soil, a young soil due to periodic floodin - litter on riparian soil and soil; many palm fronds on ground terrestrial
38 Bamforth, 2007 USA, Puerto Rico, The Luquillo National Forest Liana adventitious roots in palo verde and tabonuco zones: - moss covered soil between liana roots and rock. - between liana adventitious roots attaching to tree trunk. terrestrial
39 Bamforth, 2008 USA, Utah, the "Island in the Sky'' area of Canyonlands National Park Three crusts, a cyanobacteria (Microcoleus), a Scytonema/Nostoc lichen, and a black moss, Syntrichia caninervis, were collected from a shallow sandy soil terrestrial
40 Bamforth, 2008 USA, Utah, Kane Creek Road, near Moab crust was composed of two lichens, Fulgensis bracteata and Squarmarina lentigera, on an exposed evaporate containing gypsum terrestrial
41 Liu et al., 2008 China, Beijing, Gaobeidian wastewater treatment systems aquatic
42 Liu et al., 2008 China, Beijing, Qinghe wastewater treatment systems aquatic
43 Liu et al., 2008 China, Beijing, Beixiaohe wastewater treatment systems aquatic
44 Liu et al., 2008 China, Beijing, Jiuxianqiao wastewater treatment systems aquatic
45 Zou et al., 2009 China, Xiaolong Mountains, National Nature Reserve, Mayan Forest Region soil terrestrial
46 Ramirez et al., 2009 Mexico, Mexico wells of the Zacatepec aquifer aquatic
47 Paziuk, 2010 Ukraine, Zhytomyr Oblast, near Radomyshl' water samples from the lake with sandy bottom aquatic
Table 2. Continuation.
No Reference Geographic location Sample type Habitat
48 Satkauskiene, 2012 Lithuania, near highway Vilnius-Prienai-Marijampolë lichen on the soil (turf and sandy loam) along the road terrestrial
49 Patsyuk, 2012 Ukraine, Zhytomyr Oblast, Kam'yanka river - aquatic
50 Patsyuk, 2013 Ukraine, Zhytomyr and Volyn' parts of Ukrainian Polesia fresh water aquatic
51 Michel et al., 2014 Austria,Tyrol, Tannheim, Grotto Tannheim - -
52 Patsyuk, 2014a Ukraine, Zhytomyr and Volyn' parts of Ukrainian Polesia water of river, bog, canal and floodplain Aquatic
53 Patsyuk, 2014b Ukraine, Kyev Polesia bottom sediment aquatic
54 Fang et al., 2014 China, Changbai Mountains soil terrestrial
55 Dominska et al., 2015 Ukraine, Zhytomyr, Huiva river - aquatic
56 Patsyuk, 2016 Ukraine, Zhytomyr, Teterev river the upper layer of bottom sediments and the near-bottom layer of water aquatic
57 Corsaro et al., 2017 Germany, Andernach bark of a sycamore tree terrestrial
58 Spoljar et al., 2017 Croatia, North West Croatia, Sutla river the complex and submerged C. demersum in the littoral zone of shallow water body aquatic
59 Spoljar et al., 2017 Croatia, North West Croatia, Zajarki gravel pit floating-leaved yellow waterlily, N. lutea in the littoral zone of shallow water body aquatic
60 Patsyuk, 2017 Ukraine, small standing water body near the Dnieper the upper layer of bottom sediments and the near-bottom layer of water aquatic
61 Patsyuk, 2018 Ukraine, Zhytomyr Oblast, Hnylop'yat' river upper layer of bottom sediment representsed by sands occupied by higher aquatic plants (0-15 cm) aquatic
62 Mattos Conislla et al., 2018 Peru, Huacachina, Regional Conservation Area (ACR) "Laguna de Huacachina" water samples aquatic
63 Lordan, 2018 Croatia, Krka, Roski Slap glass substrate in fast and slow flows in the water aquatic
64 Patsyuk and Uvayeva, 2019 Ukraine, Zhytomyr Oblast , Sinevir lake the upper layer of bottom sediments and the near-bottom layer of water aquatic
65 Patsyuk and Uvayeva, 2019 Ukraine, a floodplain pond near Ivano-Frankivsk the upper layer of bottom sediments and the near-bottom layer from floodplain pond aquatic
66 Olehnovich et al., 2020 Ukraine, Rivne Oblast, Sarny Raion soil sample; pine forest with lichen; soil -weak sub-leaved, clay-sandy terrestrial
67 Olehnovich et al., 2020 Ukraine, Zhytomyr Oblast, Turchynets'ke Lisnytstvo soil sample; oak forest, gray forest soils terrestrial
68 Olehnovich et al., 2020 Ukraine, Zhytomyr Oblast, Bohuns'ke Lisnytstvo soil sample; hornbeam-oak forest; gray forest soils terrestrial
69 Olehnovich et al., 2020 Ukraine, Zhytomyr Oblast, Zytomirs'ke Lisove gospodarstvo soil sample; hornbeam-oak-pine forest, gray forest soils terrestrial
70 Olehnovich et al., 2020 Ukraine, Vinnytsia Oblast, Chechel'nyts'k Raion soil sample; oak forest, gray forest soils terrestrial
71 Olehnovich et al., 2020 Ukraine, Lviv Oblast soil sample; oak-beech forest; gray forest soils terrestrial
72 Olehnovich et al., 2020 Ukraine, Kiyv Oblast soil sample; hornbeam-oak forest; gray forest soils terrestrial
73 Olehnovich et al., 2020 Ukraine, Sumy Oblast soil sample; maple-linden-oak forest, dark-gray silty soils terrestrial
74 Olehnovich et al., 2020 Ukraine, Khmelnytskyi Oblast soil sample; hornbeam-oak forest, degraded chernozems terrestrial
Table 2. Continuation.
No Reference Geographic location Sample type Habitat
75 Olehnovich et al., 2020 Ukraine, Kharkiv Oblast soil sample; maple-linden-oak forest; gray forest soils terrestrial
76 Patsyuk, 2020a Ukraine, Zhytomyr Oblast, Berdychiv Raion soil from oak forest terrestrial
77 Patsyuk, 2020a Ukraine, Zhytomyr Oblast, Popilnya Raion soil from oak forest terrestrial
78 Patsyuk, 2020a Ukraine, Zhytomyr Oblast, Novograd-Volhynsky Raion soil from oak forest terrestrial
79 Patsyuk, 2020a Ukraine, Zhytomyr Oblast, Baraniv Raion soil from mixed forestst terrestrial
80 Patsyuk, 2020a Ukraine, Zhytomyr Oblast, Lyubar Raion soil from mixed forestst terrestrial
81 Patsyuk, 2020b Ukraine, Zhytomyr Oblast , Novohrad-Volynsky Raion mosses, lichens terrestrial
82 Patsyuk, 2020b Ukraine, Zhytomyr Oblast , Olevsk Raion mosses terrestrial
83 Patsyuk, 2020c Ukraine, Rivne oblast, Sarny raion moss and soil terrestrial
84 Patsyuk, 2020c Ukraine, Zhytomyr Oblast soil terrestrial
85 Patsyuk, 2020c Ukraine, Zhytomyr Oblast moss and soil terrestrial
86 Patsyuk, 2020d Ukraine, Kharkiv Oblast soil sample from the forest terrestrial
87 Patsyuk, 2020e Ukraine, Vinnytsia Oblast, Floodwater reservoir near the Lemeshivka village the upper layer of bottom sediments and the near-bottom layer of water aquatic
88 Patsyuk, 2020e Ukraine, Vinnytsia Oblast, the river near the Zhmerynka city the upper layer of bottom sediments and the near-bottom layer of water aquatic
89 Michel et al., 2021 Germany, Mayen-Koblenz District, Rhineland-Palatinate, Bendorf sycamore tree terrestrial
90 Gulin et al., 2021 Croatia, Krka River permanent streams in the site where water had been present before and after A. altissima removal and displaying well-developed moss cover aquatic
91 Gulin et al., 2021 Croatia, Krka River newly reactivated streams aquatic
92 Gulin et al., 2021 Croatia, Krka River newly reactivated streams aquatic
93 Patsyuk, 2022 Ukraine, Mykolaiv region soil samples; the dark chestnut chernozems terrestrial
94 Patsyuk, 2022 Ukraine, Khmelnytsky region soil samples; the podzolized chernozems terrestrial
95 Patsyuk, 2022 Ukraine, Kirovohrad region soil samples; the weakly podzolic clayey sandgrounds terrestrial
96 Patsyuk, 2022 Ukraine, Rivne region soil samples; grey podzolic soils terrestrial
97 Patsyuk, 2022 Ukraine; Lviv and Zhytomyr regions soil samples; forest grey soils terrestrial
98 Surkova et al., 2022 Russia, Moscow, Sobachiy Pond bottom sediment aquatic
99 Kadhim, 2022 Iraq, Baghdad City Tigris riverbank, the samples of water were obtained using plankton net aquatic
100 Patsyuk and Konstantynenko, 2022 Ukraine, Zhytomyr Oblast bottom sediment aquatic
101 Mesentsev et al., 2022 Russia, Izhevsk, Shkolnii pond bottom sediment aquatic
102 Patsyuk et al., 2023 Ukraine, Zhytomyr Oblast, Korostishivski region forest soil terrestrial
technologies", "Biobank" and "Culture collection of microorganisms" of the Research Park of St. Petersburg State University. We are grateful to Nikita Kulishkin and Alina Surkova for their help in collecting the sample, which was the source of the T1O1 strain.
References
Abé T.H. 1961. Morpho-physiological study of ameboid movement I. Dynamic organization of striata amoebae. Cytologia (Tokyo). 26 (3—4): 378-407. https://doi.org/10.1508/cytologia.26.378 Abé T.H. 1962. Morpho-physiological study of ameboid movement II. Ameboid movement and the organization pattern in a striata ameba. Cytologia (Tokyo). 27 (2): 111-139. https://doi.org/10.1508/ cytologia.27.111
Adl S.M., Habura A. and Eglit Y. 2014. Amplification primers of SSU rDNA for soil protists. Soil Biol. Biochem. 69: 328-342. https://doi.org/ 10.1016/j.soilbio.2013.10.024
Bamforth S.S. 2004. Water film fauna of microbiotic crusts of a warm desert. J. Arid Environ. 56 (3): 413-423. https://doi.org/10.1016/S0140-1963(03)00065-X
Bamforth S.S. 2007. Protozoa from aboveground and ground soils of a tropical rain forest in Puerto Rico. Pedobiologia (Jena). 50 (6): 515-525. https:// doi.org/10.1016/j.pedobi.2006.10.009
Bamforth S.S. 2008. Protozoa of biological soil crusts of a cool desert in Utah. J. Arid Environ. 72 (5): 722-729. https://doi.org/10.1016/j.jaridenv. 2007.08.007
Benson D.A., Cavanaugh M., Clark K., Karsch-Mizrachi I. et al. 2013. GenBank. Nucleic Acids Res. 41 (D1): 36-42. https://doi.org/10.1093/nar/ gks1195
Bovee E.C. 1953. Morphological identification of free-living amoebida. Proc. Iowa Acad. Sci. 60 (1): 599-615.
Bovee E.C. 1960. Protozoa of the Mountain Lake region, Giles County, Virginia. J. Protozool. 7 (4): 352-361. https://doi.org/10.1111/j.1550-7408.1960.tb05982.x
Bovee E.C. 1965. An ecological study of amebas from a small stream in Northern Florida. Hydrobiologia. 25 (1-2): 69-87. https://doi. org/10.1007/BF00189855
Bovee E.C. and Jahn T.L. 1966. Mechanisms of movement in taxonomy of sarcodina. III. Or-
ders, suborders, families, and subfamilies in the superorder Lobida. Syst. Zool. 15 (3): 229-240. https://doi.org/10.2307/2411395
Bovee E.C. 1981. New epizoic Suctorea (Protozoa) of the smooth softshell turtle, Trionyx muticus, in Northeastern Kansas. Trans. Kansas Acad. Sci. 84 (2): 98-104. https://doi.org/10.2307/3628100 Bovee E.C. 1985. Class Lobosea Carpenter, 1861. In: An Illustrated guide to the Protozoa (Eds: Lee J.J., Hutner S.H. and Bovee E.C.). Soc. of Pro-tozoologists, Lawrence, Kansas.
Castresana J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 17 (4): 540-552. https://doi.org/10.1093/oxfordjournals. molbev.a026334
Cole J., Anderson O.R., Tekle Y.I., Grant J. et al. 2010. A description of a new "amoebozoan" isolated from the American lobster, Homarus ame-ricanus. J. Eukaryot. Microbiol. 57 (1): 40-47. https://doi.org/10.1111/j.1550-7408.2009.00445.x Corsaro D., Köhsler M., Wylezich C., Ven-ditti D. et al. 2017. New insights from molecular phylogenetics of amoebophagous fungi (Zoopa-gomycota, Zoopagales). Parasitol. Res. 117 (1): 157-167. https://doi.org/10.1007/s00436-017-5685-6
Das A.K., Mandal A.K. and Sarkar N.C. 1993. Free living protozoa. Fauna West Bengal. 3 (12): 1-134.
Dominska K.E., Patsyuk M.K. and Savenko O.A. 2015. Species richness of naked amoebae in the Guiva river (Zhytomyr). Biological research -2015: Collection of scientific works. P. 173-174 (in Ukrainian).
Edgar R.C. 2004. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32 (5): 1792-1797. https://doi. org/10.1093/nar/gkh340
Edmondson C.H. 1920. Protozoa of the Devil's Lake complex, North Dakota. Trans. Am. Microsc. Soc. 39 (3): 167-198. https://doi.org/10.2307/ 3221747
Fahrni J.F., Bolivar I., Berney C., Nassonova E. et al. 2003. Phylogeny of lobose amoebae based on actin and small-subunit ribosomal RNA genes. Mol. Biol. Evol. 20 (11): 1881-1886. https://doi. org/10.1093/molbev/msg201
Fang L., Qi L., Congcong S., Haiyan C. and Wenju L. 2014. Distribution of gymnamoebae communities along an elevational gradient in Changbai Mountains. Biodivers. Sci. 22 (5): 608-617.
(in Chinese with English abstract) https://doi. org/10.3724/SP.J.1003.2014.14112
Flößner D., Kasprzak P., Mothes G., Ronne-berger D. and Schönborn W. 1985. The invertebrate communities. In: Lake Stechlin (Ed: Casper S.J.). Springer, Dordrecht, pp. 213—259. https://doi. org/10.1007/978-94-009-5506-6_7
Golemansky V. and Todorov M. 2004. Additional data and summarized check-list on the Rhizo-pods (Rhizopoda: Amoebida & Testacea) from Livingston Island, South Shetlands, the Antarctic. Bulg Antarct Res Life Sci. 4 (January): 83-93.
Gouy M., Guindon S. and Gascuel O. 2010. Sea view version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol. Biol. Evol. 27 (2): 221-224. https://doi.org/10.1093/molbev/msp259
Greeff R. 1866. Ueber einige in der Erde lebende Amöben und andere Rhizopoden. Arch. Mikrosk. Anat. 2: 299-311 (in German).
Guhl W. 1987. Aquatic ecosystem characterizations by biotic indices. Int. Rev. der gesamten Hydrobiol. und Hydrogr. 72 (4): 431-455. https:// doi.org/10.1002/iroh.19870720404
Gulin V., Matonickin Kepcija R., Sertic Peric M., Felja I. et al. 2021. Environmental and periphy-ton response to stream revitalization - a pilot study from a tufa barrier. Ecol. Indic. 126: 107629. https:// doi.org/10.1016/j.ecolind.2021.107629
Herdendorf C.E., Herdendorf R.C. and Klarer D.M. 2000. Protista: Protozoans. In: Catalogue of the invertebrate fauna of Old Woman Creek estuary, Watershed, and adjacent waters of Lake Erie, Technical Report No. 12. pp. 2-6.
Holmberg O. and Pejler B. 1972. On the terrestrial microfauna of Surtsey during the summer 1970. Surtsey Res. Prog. Rep. 6: 69-72.
Inamori Y., Ouchiyama T., Sugiura N. and Sudo R. 1987. Seasonal changes of periphytic smaller animals in Lake Kasumigaura. Jap. J. Water Treat. Biol. 23 (2): 7-14 (in Chinese with English abstract).
Jiang J. and Shen Y. 2003. Development of a biotic index using the correlation of protozoan communities with chemical water quality. New Zeal. J. Mar. Freshw. Res. 37 (4): 777-792. https:// doi.org/10.1080/00288330.2003.9517208
Jiang J. and Shen Y. 2005. Use of the aquatic protozoa to formulate a community biotic index for an urban water system. Sci. Total Environ. 346 (1-3): 99-111. https://doi.org/10.1016/j.scitotenv. 2004.12.001
Kadhim Z.Y. 2022. New Records of free-living Protozoa (Sarcodina) from Baghdad City, Iraq. Bull.
Iraq Nat. Hist. Museum. 17 (2): 219-228. https:// doi.org/10.26842/binhm.7.2022.17.2.0219
Khaled S.A. and Saeed S.M. 2006. Identification of amoeba species in Tuban valley — Lahej (Yemen). English Abstracts for Papers published in "University ofAden Journal of Natural and Applied Sciences." P. 40.
Kudryavtsev A. and Hausmann K. 2009. Thec-amoeba aesculea n. sp. (Amoebozoa, Thecamoebi-dae), a terrestrial amoeba with affinities to Th. spha-eronucleolus (Greeff, 1891). Acta Protozool. 48 (2): 91—96.
Liu J., Yang M., Qi R., An W. et al. 2008. Comparative study of protozoan communities in full-scale MWTPs in Beijing related to treatment processes. Water Res. 42 (8—9): 1907—1918. https:// doi.org/10.1016/j.watres.2007.11.020
Lordan P. 2018. The influence of hydrological stress on periphytic protozoa of tufa barriers. University of Zagreb, Zagreb (in Croatian with English abstract).
Mattos Conislla Y.L. and Ramirez Benavides C. 2018. Diversidad de protozoarios del Brea de Conservación Regional (ACR) "Laguna de Huacachina" — Ica, noviembre 2018 — mayo 2019. Universidad Nacional San Luis Gonzaga, Ica, Perú. (in Spanish with English absract)
Medlin L., Elwood H.J., Stickel S. and Sogin M.L. 1988. The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene. 71 (2): 491—499. https://doi.org/10. 1016/0378-1119(88)90066-2
Mesentsev Y.S. and Smirnov A.V. 2019. Thec-amoeba cosmophorea n. sp. (Amoebozoa, Discosea, Thecamoebida) — An example of sibling species within the genus Thecamoeba. Eur. J. Protis-tol. 67: 132—141. https://doi.org/10.1016/j.ejop.2018. 12.003
Mesentsev Y., Kamyshatskaya O. and Smirnov A. 2020. Thecamoeba foliovenanda n. sp. (Amoebo-zoa, Discosea, Thecamoebida) — One more case of sibling species among amoebae of the genus Thecamoeba. Eur. J. Protistol. 76: 125716. https://doi. org/10.1016/j.ejop.2020.125716
Mesentsev Y. and Smirnov A. 2021. Thecamoeba astrologa n. sp. — A new species of the genus Thecamoeba (Amoebozoa, Discosea, Thec-amoebida) with an unusually polymorphic nuclear structure. Eur. J. Protistol. 81: 125837. https://doi. org/10.1016/j.ejop.2021.125837
Mesentsev Y., Kamyshatskaya O., Nassonova E. and Smirnov A. 2022. Thecamoeba vumurta n. sp. (Amoebozoa, Discosea, Thecamoebida) from
freshwater pond sediment - a sibling species of T. striata (Penard, 1890) Schaeffer, 1926. Eur. J. Protistol. 83: 125866. https://doi.org/10.1016/). ejop.2022.125866
Mesentsev Y., Surkova A., Kamyshatskaya O., Nassonova E. and Smirnov A. 2023. Re-isolation and revaluation of boundaries of Thecamoeba terricola Greeff, 1886 (Amoebozoa , Discosea, Thec-amoebida), with description of Thecamoeba vicaria n. sp. Eur. J. Protistol. 91: 126030. https://doi.org/ 10.1016/j.ejop.2023.126030
Michel R., Walochnik J. and Scheid P. 2014. Article for the "Free-living amoebae Special Issue": Isolation and characterisation of various amoebo-phagous fungi and evaluation oftheir prey spectrum. Exp. Parasitol. 145 (Supplement): S131-S136. https://doi.org/10.1016/j.exppara.2014.10.005
Michel R., Walochnik J., Müller K.-D. and Corsaro D. 2021. Molecular identification of a new endonuclear parasite of amoebae, Nucleophaga striatae sp. nov. (Rozellomycota). Endocytobiosis Cell Res. 31: 1-4.
Miller M.A., Pfeiffer W. and Schwartz T. 2010. Creating the CIPRES Science Gateway for inference oflarge phylogenetic trees. 2010 Gateway Computing Environments Workshop (GCE). P. 1-8. https://doi.org/10.1109/GCE.2010.5676129 Mrva M. 2003. Diversity of active gymnamoe-bae (Rhizopoda, Gymnamoebia) in dendrotelmae of oak-hornbeam forests in Male Karpaty Mts. (Western Slovakia). Protistology. 3 (2): 121-125.
Mrva M. 2005. Diversity of active gymnamoe-bae (Rhizopoda, Gymnamoebia) in mosses of the Male Karpaty Mts (Slovakia). Ekol. Bratislava. 24 (Suppl. 2): 51-58.
Olechnovich K.V., Pavlenko M.Y. and Patsyuk M.K. 2020. The population ofnaked amoebae in the soils of forest phytocoenoses of Ukraine. Biological research - 2020. P. 111-115 (in Ukrainian).
Page F.C. 1971. A comparative study of five fresh-water and marine species of Thecamoebidae. Trans. Am. Microsc. Soc. 90 (2): 157-173.
Page F.C. 1977. The genus Thecamoeba (Protozoa, Gymnamoebia) species distinctions, locomotive morphology, and protozoan prey. J. Nat. Hist. 11 (1): 25-63. https://doi.org/10.1080/002 22937700770031
Page F.C. 1988. A new key to freshwater and soil Gymnamoebae. Freshwater Biological Association, The Farry House, Ambleside, Cumbria.
Pappas G.D. 1954. Structural and cytochemical studies of the cytoplasm in the family Amoebidae. Ohio J. Sci. 54 (3): 195-222.
Patsyuk M.K. 2012. Dynamics of species richness of naked amoebas (Protista, Gymnamoebia) in Kamianka (Zhytomyr). Abstracts of reports of the Conference ofyoung zoological researchers — 2012. P. 25—26 (in Ukrainian).
Patsyuk M.K. 2013. Tolerance of naked amoebas to the abiotic factors of water environment. V International Symposium of Ecologists of Montenegro. P. 137.
Patsyuk M.K. 2014a. Morphotypes in naked amoebas (protista): distribution in water bodies of Zhytomyr and Volyn polissia (Ukraine) and possible ecological significance. Vestn. Zool. 48 (6): 547-552. https://doi.org/10.2478/vzoo-2014-0065 Patsyuk M.K. 2014b. Naked amoebas in the fauna of Kyiv woodland region. Sci. Notes Terno-pyl'National Pedagog. Univ. Ser. Biol. 2 (59): 7-9 (in Ukrainian with English abstract).
Patsyuk M.K. 2016. Seasonal changes in the species composition of naked amoebas (Amoebina) ofthe Teterev river (the Town of Zhitomir). Hydro-biol. J. 52 (4): 55-62. https://doi.org/10.1615/ HydrobJ.v52.i4.60
Patsyuk M.K. 2017. Spatial distribution of the naked amoebae in the bottom soil of standing water body near the Dnieper (Ukraine). Sci. Bull. Lesya Ukr. East Eur. Natl. Univ. 7: 128-133 (in Ukrainian with English abstract).
Patsyuk M.K. 2018. Peculiarities of the spatial distribution of naked amoebas in sandy bottom sediments of a small river. Hydrobiol. J. 54 (5): 102-111. https://doi.org/10.1615/HydrobJ.v54. i5.100
Patsyuk M. and Uvayeva O. 2019. Freshwater naked amoebae (Tubulinea, Discosea, Hetero-lobosea) of the Zakarpattia region and the surrounding areas (Ukraine). Lesia Ukr. East. Eur. Natl. Univ. Sci. Bull. Ser. Biol. Sci. 3 (387): 109-115 (in Ukrainian with English abstract).
Patsyuk M. 2020a. Diversity of naked amoebae in soils of forest areas of Zhytomyr region (Ukraine). Zootaxa. 4743 (2): 257-265. https://doi.org/ 10.11646/zootaxa.4743.2.8
Patsyuk M. 2020b. Species composition and diversity of morphotypes in epilithic biotopes of Zhytomyr region, Ukraine. Acta Biol. 27 (1): 31-41. https://doi.org/10.18276/ab.2020.27-04
Patsyuk M. 2020c. The communities of naked amoebas on the border of the zone "moss-soil" in the forest ecosystems of Ukraine. Notes Curr. Biol. 1 (389): 60-65 (in Ukrainian with English absract). https://doi.org/10.29038/2617-4723-2020-1-389-60-65
Patsyuk M.K. 2020d. Naked amoebae in the soils of Kharkiv region (Ukraine). Sci. Bull. Uzhhorod Univ. (Ser. Biol.). 48: 20-27 (in Ukrainian with English abstract). https://doi.org/10.24144/1998-6475.2020.48.20-27
Patsyuk M. 2020e. Amoebozoa Luhe, 1913 in the water bodies ofthe Vinnytsia region. Bull. Taras Shevchenko Natl. Univ. Kyiv. Ser. Biol. 82 (3): 4852 (in Ukrainian with English abstract). https://doi. org/10.17721/1728_2748.2020.82.48-52
Patsyuk M. 2022. Species and morphotypes complexes ofnaked amoebae in several types of soils of Ukraine. Biologia (Bratisl). 77 (8): 2173-2181. https://doi.org/10.1007/s11756-022-01106-7
Patsyuk M. and Konstantynenko I. 2022. Influence of aquatic environmental factors on the distribution of naked amoebae in waters of Zhytomyr region (Ukraine). Visnyk Lviv Univ. Biol. Ser. (86): 103-113 (in Ukrainian with English abstract). https://doi.org/10.30970/vlubs.2022.86.09
Patsyuk M. 2023. Phylogenetic relationships among naked amoebae found in natural Biotopes. 57 (6): 567-578. https://doi.org/10.3103/S009545 2723060063
Patsyuk M., Khomych T., Kondratyuk M. and Golub L. 2023. Freshwater and soil species of naked amoebas ofthe Zhytomyr region. Biology theoretical and applied aspects of the development of science. P. 84-88 (in Ukrainian). https://doi.org/10.46299/ ISG.2023.1.18
Pawlowski J. 2000. Introduction to the molecular systematics offoraminifera. Micropaleontology. 46: 1-12. https://www.jstor.org/stable/1486176
Paziuk M.K. 2010. Naked loboze amoeba (Lo-bozea, Gymnamoebia) of some reservoirs of fence surrounding villages of Radomishl'. Sci. Notes Ternopyl'National Pedagog. Univ. Ser. Biol. 2 (43): 390-395 (in Ukrainian with English abstract).
Penard E. 1890. Études sur les Rhizopodes d'eau douce. Mem. la Société Phys. d'histoire Nat. Genève. 31 (2): 1-230 (in French).
Penard E. 1902. Faune rhizopodique du bassin du Léman., Henry Kündig, Genève (in French). https://doi.org/10.5962/bhl.title.1711
Penard E. 1905. Observations sur les Amibes a pellicule. Arch Protistenkd. 6: 175-206 (in French).
Penard E. 1913. Nouvelle recherches sur les Amibes du groupe Terricola. Arch. Protistenkd. (28): 78-140 (in French).
Petrov A.S., Bernier C.R., Gulen B., Waterbury C.C. et al. 2014. Secondary Structures of rRNAs from All Three Domains of Life. PLoS One. 9
(2): e88222. https://doi.org/10.1371/journal. pone.0088222
Prescott D.M. and James T.W. 1955. Culturing of Amoeba proteus on Tetrahymena. Exp. Cell Res. 8 (1): 256-258. https://doi.org/10.1016/0014-4827(55)90067-7
Rambaut A., Suchard M., Xie D. and Drum-mond A. 2014. Tracer v1.6.2014. http://beast.bio. ed.ac.uk/Tracer
Ramírez E., Robles E., Sainz M.G., Ayala R. and Campoy E. 2009. Calidad microbiolygica del acuífero de Zacatepec, Morelos, México. Rev. Int. Contam. Ambient. 25 (4): 247-255 (in Spanish with English abstract).
Rhumbler L. 1898. Physikalische Analyse von Lebenserscheinungen der Zelle. Arch. Entwicklungsmechanik der Org. 7 (1): 103-198 (in German). https://doi.org/10.1007/BF02156692
Rivera F., Ramírez P., Vilaclara G., Robles E. and Medina F. 1983. A survey of pathogenic and free-living amoebae inhabiting swimming pool water in Mexico City. Environ. Res. 32 (1): 205-211. https://doi.org/10.1016/0013-9351(83)90207-4
Robinson B.S. and Hons B.S. 1980. The distribution and biology of amoebae in freshwater in south Australia. University of Adelaidae.
Rogerson A. 1993. Parvamoeba rugata n. g., n. sp., (Gymnamoebia, Thecamoebidae): An exceptional-ly small marine naked amoeba. Eur. J. Protistol. 29 (4): 446-452. https://doi.org/10.1016/ S0932-4739(11)80407-4
Rogerson A. and Patterson D.J. 2000. The naked ramicristate amoebae (Gymnamoebae). In: An Illustrated Guide to the Protozoa (Eds: Lee J.J., Leedale G.F. and Bradbury P.). Soc. of Protozo-ologists, Lawrence, Kansas, pp. 1023-1052.
Ronquist F. and Huelsenbeck J.P. 2003. MrBa-yes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 19 (12): 1572-1574. https://doi.org/10.1093/bioinformatics/btg180
Satkauskiene I. 2012. Microfauna of lichen (Xanthoria parietina) in Lithuania: diversity patterns in polluted and non-polluted sites. Balt. For. 18 (2): 255-262.
Schaeffer A.A. 1926. Taxonomy of the amebas with description of thirty-nine new marine and freshwater species. Pap. Department Mar. Biol., Carnegie Inst. of Washington.
Smirnov A.V. and Goodkov A.V. 1996. Systematic diversity of gymnamoebae in the bottom sediments of a freshwater lake in Karelia (Lobosea, Gymnamoebia). Zoosystematica Ross. 4 (2): 201-203.
Smirnov A.V. 1999. Re-description of Thecamoeba munda Schaeffer 1926 (Gymnamoebia, Thec-amoebidae), isolated from the Baltic Sea. Eur. J. Protistol. 35 (1): 66-69. https://doi.org/10.1016/ S0932-4739(99)80023-6
Smirnov A.V. and Brown S. 2004. Guide to the methods of study and identification of soil gymn-amoebae. Protistology. 3 (3): 148-190.
Spiegel F.W., Moore D.L. and Feldman J. 1995. Tychosporium acutostipes, a new protostelid which modifies the concept of the Protosteliidae. Mycologia. 87 (2): 265-270. https://doi.org/10. 2307/3760912
Spoljar M., Lajtner J., Drazina T., Malekzadeh-Viayeh R. et al. 2017. Disentangling food webs interactions in the littoral of temperate shallow lakes. Nat. Croat. 26 (2): 145-166 (in Croatian with English absract). https://doi.org/10.20302/NC.2017. 26.14
Stamatakis A. 2014. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 30 (9): 1312-1313. https://doi.org/10.1093/bioinformatics/btu033
Stout J.D. 1958. Biological studies of some tussock-grassland soils: VII. Protozoa. New Zeal. J. Agric. Res. 1 (6): 974-984. https://doi.org/10. 1080/00288233.1958.10422400
Stout J.D. 1960. Biological studies of some tussock-grassland soils XVIII. Protozoa of two cultivated Soils. New Zeal. J. Agric. Res. 3 (2): 237-243. https://doi.org/10.1080/00288233. 1960.10418078
Stout J.D. 1963. Some observations on the Protozoa of some beechwood soils on the Chiltern
Hills. J. Anim. Ecol. 32 (2): 281. https://doi.org/ 10.2307/2541
Stout J.D. 1984. The protozoan fauna of a seasonally inundated soil under grassland. Soil Biol. Biochem. 16 (2): 121-125. https://doi.org/10. 1016/0038-0717(84)90101-9
Surkova A.A., Kulishkin N.S., Tsyganov A.N., Mesentsev Y.S. et al. 2022. Diversity and abundance of naked lobose amoebae belonging to the classes Tubulinea and Discosea in pond sediments in Moscow urban parks. Protistology. 16 (2): 122-134. https://doi.org/10.21685/1680-0826-2022-16-2-6 Thornton R.H. 1958. Biological studies of some tussock-grassland soils: I. Introduction, soils and vegetation. New Zeal. J. Agric. Res. 1 (6): 913-921. https://doi.org/10.1080/00288233.1958.10422394 Wilkinson D.M. and Smith H.G. 2006. An initial account of the terrestrial protozoa of Ascension Island. Acta Protozool. 45: 407-413.
Zhang Z., Schwartz S., Wagner L. and Miller W. 2000. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 7 (1-2): 203-214. https://doi.org/10.1089/10665270050081478
Zlinska J., Somsak L. and Holecova M. 2005. Ecological characteristics of studied forest communities of an oak-horn-beam tier in SW Slovakia. Ekolygia (Bratislava). 24 (2): 3-19.
Zou T., Shen H.X., Ma Z.X. and Ning Y.Z. 2009. Community characteristics of soil Sarcomas-tigophora in the Mayan Forest Region ofthe National Nature Reserve of Xiaolong Mountains. Zool. Res. 30 (5): 571-577 (in Chinese with English abstract). https://doi.org/10.3724/SPJ.1141.2009.05571