CC BY
5MORPHOLOGICAL AND MOLECULAR-GENETIC ANALYSIS OF THE SPECIES CORBICULA FLUMINALIS DISTRIBUTED IN WATER ECOSYSTEMS OF SOUTH UZBEKISTAN
1Izzatullaev Zuvaydulla Izzatullaevich, 2Boymurodov Khusniddin Tashboltaevich, 3Aliev Bakhtiyor Khojayarovich, 4Kuchboev Abdurakhim Ergashevich
1Doctor of Biological Sciences, Samarkand State University, Professor 2Doctor of Biological Sciences, Samarkand State University of Veterinary Medicine, Animal
Husbandry and Biotechnology, Professor 3A doctoral student of Samarkand State University 4Doctor of biological sciences, professor, Institute of Zoology, Academy of Sciences of
Uzbekistan https://doi.org/10.5281/zenodo.11079483
Abstract. Specimens of the species Corbicula fluminalis belonging to the genus Corbicula distributed in the water bodies of South Uzbekistan were studied morphologically and molecularly genetically. According to the morphological structure, the species Corbicula flunalis was found to be morphologically different from the species Corbicula cor and Corbicula purpurea. According to the results of molecular analysis, nucleotides with 660 base pairs belonging to the COI region of mtDNA were isolated from samples of Corbicula fluminalis species, and they were compared with Corbicula fluminea (KX192335) species in the International Genbank (NCBI) database. As a result, almost no differences were detected between their nucleotides.
Keywords: southern Uzbekistan, mollusk, Corbicula fluminalis, area, hydrobionts, molecular, water ecosystem.
INTRODUCTION. The inventory of biological resources and their use in the water ecosystems of South Uzbekistan is an urgent problem of great importance to humanity. At a time when the terrestrial part of the Earth is being widely used, it is important to improve the prospects of using biological resources and protect them, to further improve the lifestyle of the population and to use the existing resources wisely. The sudden change in the ecological situation observed on the globe today is mainly the result of the influence of anthropogenic forces, which affects the bioecological characteristics of the animal world, including the distribution of molluscs, resulting in the loss of their habitats, and this, in turn, changes the population of common species and rare species. and causing the extinction of rare species.
Previous studies have shown that there is a wide range of Corbicula species due to the study of genetic diversity, so the purpose of this research work is to make the morphology and molecular identification of Corbicula fluminalis distributed in the water ecosystems of South Uzbekistan.
Research methodology. The samples of mollusks belonging to the genus Corbicula collected from the Uchkizil reservoir coordinates: N 37°20'27", E 67°12'41" were collected for molecular genetic research. Samples were preserved in 96% ethanol solution and genomic DNA was extracted from them. The GeneJET Genomic DNA (Termofisher.com) reagent kit was used for DNA extraction.
Nucleotide analysis of COI fragments of mitochondrial DNA (mtDNA) from molluscs using primers LCO-1460: GGYCAACAAATCATAAAGATATTGG and HCO-219
TAAACTTCAGGGTGACCAAAAAAATCA (Folmer et al., 1994). Polymerase chain reaction (PTsR) was carried out according to the following scheme: 1 - step - DNA denaturation at 94°C for 5 minutes, 2 - step - DNA denaturation at 95°C for 45 seconds, 3 - step - DNA at 55°C Annealing of primers for 45 seconds, step 4 - elongation at 72°C for 1 minute 40 seconds, step 5 -chain elongation at 72°C for 5 minutes. From the second to the fourth step, the process was repeated up to 35 times in a loop form.
The presence of DNA in PTsR products was determined by electrophoresis on a 1.0% agarose gel with a voltage of 120 V. DNA amplification and DNA extraction from the gel were performed using a set of reagents manufactured by Sileks M (Moscow, Russia) following the manufacturer's instructions [1,2].
In DNA sequencing, ABI PRISM® BigDye™ Terminator v. Reaction products were sequenced at the Genome Center using reagent kit 3.1.
Research results and their analysis. Morphological studies Corbicula fluminalis is distributed in the water ecosystems of Tajikistan and Uzbekistan in Central Asia. In the period of research before us, it was collected and analyzed in the Amudarya, Syrdarya, Akhdarya and Karadaryas, in the ditches around the river, in the lakes and ponds around the Mirzachol, Dargom canal, in the Kattakorgan, Mirzachol and Southern Mirzachol canals.
The distribution and density of the water ecosystems of the coastal reservoirs of the rivers of South Uzbekistan were studied for the first time. We found out that it is distributed in Tallimarjon, Tashloksoy, South Surkhan and Uchkizil reservoirs in South Uzbekistan. On average, they are spread from 1.1-1.9 pieces per 1 m2 [3,5,6,7].
Shell shape and dimensions. The shell of this species is dark red to dark brown and larger than that of Corbicila cor, thick-walled, hard and evenly striated, but less swollen than that of Corbicilapurpurea, light gray with apex, rounded triangular heart-shaped, shiny. Central teeth 2a, 2v, 3a are two-edged, teeth 3v and 4v are thin and sharp, and side teeth (AII, AIII, PII, PIII) are very long. The inner wall of the shell is purple. The length of the shell of Corbicula fluminalis from the Surkhandarya basin was 21.5 mm, the height of the shell was 18 mm, and the thickness of the shell was 12 mm (Fig. 1). The asymmetry of the crown position is not clear. The inner surface of the pallas was light inky, and the outer surface was light brown [4,8,9].
It lives in reservoirs and canals of South Uzbekistan, buried in mud at depths of 4-12 cm. Peloreophil. Co-occurs with Corbicula cor. It differs in that the number is relatively small. It is an egg-laying species that begins to breed in the spring as the water temperature rises.
Figure 1. Specimens of Corbicula fluminalis species collected from the reservoirs of South Uzbekistan (a General view of Corbicula fluminalis, b. Inner side of shells)
According to the results of our morphological studies, the variability of conchological signs is manifested in the shape, color, thickness, and size of the shell, and the variability of all signs of the shell in the water environment is also dependent on the place of residence and the influence of external environmental factors.
After studying morphologically, the species Corbicula fluminalis belonging to the genus Corbicula, molecular-genetic studies were conducted on the samples.
Corbiaila_flwiinalisJJz ggactctata ttttcttttt tctatttgat ciggittaat aggaactgct tttagggtaa ttattcgaat
Corbicula_fluminalis_Uz ggagcttgac attccaggga ctttactaga tgatgggcag ctgtataaca ctattgttac tgctcatgct
Corbiaila_flwiinalisJJz itagtaataa tttttttttt agtgaigcca aiaaigatgg gtggttttgg aaattgactt gttccattaa
Corbicula_flwdnalis_Vz tgttaagggc tcctgatata gcttiiccac ggttaaataa tttaacattt tggcttttac ctatagctat
Corbicula_flwninalis_Uz gcttttgttg gttagatcgg cttatgttga gagtggtgtt gggagtgggt ggactgttta tcctcctctt
Coibicula_flvminalis_Uz tctagaaata ttgctcattc tggcccgtca gtagatttag ctattttttc tcttcattta gggggtattt
CoxbiculaflwiinaLisUz cttcaatttt agcttcaatt aattttgttg ttactagait itgtatgcgt cctggagcac aaaagctaat
CoEbicula_fl«minaIis_[fz ccggactaca atgtttattt gatgtattgt tgtaactgga attttgttga ttattgcaat gcctgtgttg
Cozbicula_flmdnalis_Uz gctggagctc ttactatgtt gttaactgat cgtmtttta acacttcatt itttgatccg gtaggcttag
Corbicula flminalisJJz gggatccttt gttgtttgtt сатттатттг
Figure 2. Comparison of the nucleotide sequence of the COI region of the mtDNA of Corbicula fluminalis and C. fluminea (KX192335) species (in the 5' to 3' direction, identical
nucleotide bases are marked with dots).
According to the results of the conducted research, 4 nucleotide differences were detected between the Corbicula fluminalis species in the Genbank database and the C. fluminea (accession
number: KX192335) species in the Genbank database (Genebank, NCBI) and made up 0.6% of the total nucleotides (2- picture). The differences between these nucleotides are A-denine at the 79th nucleotide in the C_fluminalis _Uz sample, and S-cetosine in the C. fluminea (accession number: KX192335) sample, and S-cetosine at the 80th and 119th nucleotides in the C_fluminalis_Uz sample, and in the C. fluminea (accession number: KX192335) sample. T-temin was explained by S-cetosine in Cfluminalis __Uz sample, and G-guanine nucleotides in C. fluminea (accession number: KX192335) sample at 256 nucleotides.
These obtained data were deposited in the Genbank database of the National Center for Biotechnology Information (Genebank, NCBI) and received the accession number OR233337.
CONCLUSION. According to the results of our conducted morphological studies, the variability of conchological signs is manifested in the shape, color, thickness, and dimensions of the shell, and the variability of all signs of the shell in the water environment is also dependent on the place of residence and the influence of external environmental factors.
According to the results of the conducted molecular genetic research, 660 base pairs of nucleotides belonging to the COI domain of mtDNA were isolated from 3 samples of the species Corbicula fluminalis belonging to the genus Corbicula collected from different populations, and no differences were found between the nucleotides of these samples.
When the nucleotide sequence of C. fluminalis species was compared with the data in the Genbank database, it was found that it was 99.4% similar to the C. fluminea species (accession number: KX192335) and was deposited in the National Center for Biotechnology Information Genbank database (Genebank, NCBI) and accession number (OR233337) received.
REFERENCES
1. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol. 1994;3(5):294-9.
2. Sousa R., Antunes C., Guilhermino L. Ecology of the invasive Asian clam Corbicula fluminea (Müller, 1774) in aquatic ecosystems: an overview // International Journal of Limnology. 2008. Vol. 44. P. 85-94.
3. Pigneur L.-M., Marescaux J., Roland K. et al. Phylogeny and androgenesis in the invasive Corbicula clams (Bivalvia, Corbiculidae) in Western-Europe // BMC Evol. Biol. 2011. Vol. 11. 15 p. [https://doi.org/10.1186/1471- 2148- 11-147] Accessed on 10.11.2018.
4. Иззатулаев З.И. Водные моллюски Средней Азии - индикатори загрязнения водоемов и водотоков // Гидробиологический журнал,1992.Т.28,-№1.С.85-90;
5. Izzatullaev.Z.I. Results of a study of Bivalve moluscs of Certral Asia // Вестник Житомирского педагогического университета, 2002. - №5. - С.21 23.
6. 25.Боймуродов Х.Т. 2017. Двустворчатые моллюски (Bivalvia:Unionidae, Corbiculidae) водных бассейнов Узбекистана // Автореф. докторской (DSc) диссертации по биол. наукам. Ташкент. С.29-60.
7. Boymurodov Kh. T. i dr. Istochniki zagryazneniya vodnyx resursov srednego techeniya reki zeravshan i technologii vodopodgotovki //Chemistry, physics, biology, mathematics: teoreticheskie i prikladnye issledovaniya. - 2022. - S. 16-19.
8. H. Boymurodov, Kh. Jabborov, T. Jabbarova, B. Aliyev, O. Mirzamurodov, A. Egamqulov. CHanges in the habitats of the unionidae, euglesidae, pisididae and sorbiculidae species with
the construction of reservoirs in the kashkadarya basin due to climate change. Reliability: Theory and Applications Electronic journal of international group on reliability journal is registered in the library of the u.s. congress Special Issue 4 (70), November 2022 SPECIAL ISSUE 4 (70) November 2022. Р. 343-347.
9. H. Boymurodov. Distribution and ecological groups of bivalve mollusks of the families uonionidae and sorbiculidae in the aquatic ecosystems of the kyzylkum nature reserve . Reliability: Theory and Applications Electronic journal of international group on reliability journal is registered in the library of the u.s. congress Special Issue 4 (70), November 2022 SPECIAL ISSUE 4 (70) November 2022. Р. 562-566.
