Научная статья на тему 'Молекулярно-генетическая диагностика наследственного неполипозного рака толстой кишки'

Молекулярно-генетическая диагностика наследственного неполипозного рака толстой кишки Текст научной статьи по специальности «Клиническая медицина»

CC BY
1428
242
i Надоели баннеры? Вы всегда можете отключить рекламу.
Ключевые слова
НАСЛЕДСТВЕННЫЙ НЕПОЛИПОЗНЫЙ РАК ТОЛСТОЙ КИШКИ / МИКРОСАТЕЛЛИТНАЯ НЕСТАБИЛЬНОСТЬ / НАСЛЕДСТВЕННЫЕ МУТАЦИИ / HEREDITARY NON-POLYPOSIS COLORECTAL CANCER / MICROSATELLITE INSTABILITY / HEREDITARY MUTATIONS

Аннотация научной статьи по клинической медицине, автор научной работы — Янус Г. А., Корнилов А. В., Суспицын Е. Н., Зайцева О. А., Яцук О. С.

На долю наследственного неполипозного рака толстой кишки (hereditary non-polyposis colorectal cancer; HNPCC) приходится 2-3 % всех случаев колоректальных карцином. Развитие данного синдрома обусловлено наличием мутации в генах, кодирующих ферменты репарации неспаренных оснований ДНК. В результате изучения 672 историй болезни больных колоректальным раком, подвергшихся хирургическому лечению в НИИ онкологии им. Н.Н. Петрова, на молекулярно-генетическое обследование была отобрана группа из 16 пациентов с выраженными клиническими признаками HNPCC-синдрома. На первом этапе диагностики HNPCC выполнялся тест на микросателлитную нестабильность (microsatellite instability, MSI), предусматривающий использование 3 мононуклеотидных маркеров (ВАТ26, ВАТ25 и ВАТ40); присутствие MSI было подтверждено в 10 из 16 случаев. Образцы ДНК нормальной ткани MSI-положительных пациентов были исследованы на предмет наличия наследственных мутаций в генах MLH1 и MSH2. Высокоточный анализ кривых плавления (high resolution melting analysis, HRMA) с последующим секвенированием аномальных фрагментов позволил выявить потенциально патогенные мутации у 5 пациентов.

i Надоели баннеры? Вы всегда можете отключить рекламу.
iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.
i Надоели баннеры? Вы всегда можете отключить рекламу.

Molecular testing for hereditary non-polyposis colorectal cancer

Hereditary non-polyposis colorectal cancer (HNPCC) contributes to 2-3 % of colorectal cancer incidence and is caused by mutations in the DNA mismatch genes. We considered 672 clinical records for colorectal cancer patients, who underwent surgical treatment in the N.N. Petrov Institute of Oncology (St.-Petersburg, Russia). 16 cases with single or multiple clinical features of the HNPCC were selected for the microsatellite instability (MSI) testing by ВАТ26, ВАТ25 and ВАТ40 monucleotide markers, and 10 MSI+ tumors were revealed. Normal tissues from these patients were analyzed by high resolution melting analysis (HRMA) and DNA sequencing for the presence of mutations in MLH1 and MSH2 genes. Potentially pathogenic mutations were identified in 5 out of these patients.

Текст научной работы на тему «Молекулярно-генетическая диагностика наследственного неполипозного рака толстой кишки»

лабораторные и экспериментальные исследования

УДК:616.345-006.6-056.7-07

молекулярно-генетическая диагностика наследственного нЕполипозного рака толстой кишки

г.А. Янус12, А.В. корнилов3, Е.н. Суспицын12, о.А. зайцева2, о.С. Яцук2, д.л. Стрекалов2, и.О. поляков4, С.и. Бреништер5, и.В. правосудов1,

А.В. гуляев16, В.В. Семиглазов3, Е.н. имянитов236

НИИ онкологии им. Н.Н. Петрова, г. Санкт-Петербург1 Санкт-Петербургская государственная педиатрическая медицинская академия2 СПбГМУ им. акад. И.П. Павлова, г. Санкт-Петербург3 Кубанская медицинская академия, г. Краснодар4 Институт онкологии, г. Кишинёв5 Медицинская академия последипломного образования, г. Санкт-Петербург6 197758, г. Санкт-Петербург, п. Песочный, ул. Ленинградская, 68, e-mail: evgeny@imyanitov. spb.ru2

На долю наследственного неполипозного рака толстой кишки (hereditary non-polyposis colorectal cancer; HNPCC) приходится 2-3 % всех случаев колоректальных карцином. Развитие данного синдрома обусловлено наличием мутации в генах, кодирующих ферменты репарации неспаренных оснований ДНК. В результате изучения 672 историй болезни больных колоректальным раком, подвергшихся хирургическому лечению в НИИ онкологии им. Н.Н. Петрова, на молекулярно-генетическое обследование была отобрана группа из 16 пациентов с выраженными клиническими признаками HNPCC-синдрома. На первом этапе диагностики HNPCC выполнялся тест на микросателлитную нестабильность (microsatellite instability, MSI), предусматривающий использование 3 мононуклеотидных маркеров (ВАТ26, ВАТ25 и ВАТ40); присутствие MSI было подтверждено в 10 из 16 случаев. Образцы ДНК нормальной ткани MSI-положительных пациентов были исследованы на предмет наличия наследственных мутаций в генах MLH1 и MSH2. Высокоточный анализ кривых плавления (high resolution melting analysis, HRMA) с последующим секвенированием аномальных фрагментов позволил выявить потенциально патогенные мутации у 5 пациентов.

Ключевые слова: наследственный неполипозный рак толстой кишки, микросателлитная нестабильность, наследственные мутации.

MOLECULAR TESTING FOR HEREDITARY NON-POLYPOSIS COLORECTAL CANCER G.A. Yanus1,2, A.V. Kornilov3, E.N. Suspitsin1,2, O.A. Zaitseva2, O.S. Yatsuk2, D.L. Strekalov2, I.S. Polyakov4, S.I. Brenister5,

I.V Pravosudov1, A.V. Guliaev1,6, V.V. Semiglazov3, E.N. Imyanitov2,3,6 N.N. Petrov institute of Oncology, St.-Petersburg1 St.-Petersburg Pediatric Medical Academy2 I.P. Pavlov Medical University, St.-Petersburg3 Kuban Medical Academy. Krasnodar4 Institute of Oncology, Kishinev5 Medical Academy for Postgraduate Studies, St.-Petersburg6 68, Leningradskaya Street, 197758-St.-Petersburg, Russia, e-mail: 68, e-mail: evgeny@imyanitov.spb.ru2

Hereditary non-polyposis colorectal cancer (HNPCC) contributes to 2-3 % of colorectal cancer incidence and is caused by mutations in the DNA mismatch genes. We considered 672 clinical records for colorectal cancer patients, who underwent surgical treatment in the N.N. Petrov Institute of Oncology (St.-Petersburg, Russia). 16 cases with single or multiple clinical features of the HNPCC were selected for the microsatellite instability (MSI) testing by ВАТ26, ВАТ25 and ВАТ40 monucleotide markers, and 10 MSI+ tumors were revealed. Normal tissues from these patients were analyzed by high resolution melting analysis (HRMA) and DNA sequencing for the presence of mutations in MLH1 and MSH2 genes. Potentially pathogenic mutations were identified in 5 out of these patients.

Key words: hereditary non-polyposis colorectal cancer, microsatellite instability, hereditary mutations.

Рак толстой кишки (РТК) занимает пятое-шестое место в структуре онкологической заболеваемости [2, 3]. Около 5 % РТК имеют наследственную природу [5]. Наиболее характерными формами наследственного РТК являются семейный аденоматозный полипоз (FAP, familial adenomatous polyposis) и так называемый синдром Линча (наследственный неполипозный рак толстой кишки, hereditary non-polyposis colorectal cancer, HNPCC). Встречаемость HNPCC в некоторых популяциях достигает значений 1:500-1:1000 [1, 17], что делает этот синдром одним из самых частых наследственных заболеваний. Средний возраст развития колоректального рака при HNPCC составляет около 45 лет [11]. В основе патогенеза данного синдрома лежит нарушение системы репарации неспаренных оснований ДНК. В опухолевых клетках дефект репарации проявляется в виде нестабильности длины микросателлитных повторов (так называемой микросателлитной нестабильности, microsatellite instability, MSI) [5, 24, 25].

К настоящему времени идентифицировано 4 гена, достоверно ассоциированных с развитием синдрома Линча: hMLH1, hMSH2, hMSH6 и hPMS2. Основная доля мутаций (около 90 %) приходится на гены hMLH1 и hMSH2, тогда как hMSH6 и PMS2 вовлекаются относительно нечасто и, как правило, ассоциированы с менее выраженным семейным анамнезом [16]. В редких случаях синдром Линча связан с делецией 3'-концевой последовательности гена TACSTD1 (EPCAM). Следует отметить, что перечисленные выше мутации обнаруживаются далеко не у всех пациентов с HNPCC, поэтому усилия исследователей направлены на идентификацию новых генов предрасположенности к раку толстой кишки [14].

Диагностика наследственного неполипозного РТК представляет собой сложную задачу и складывается из тщательного анализа семейной истории с последующим проведением ДНК-тестирования. Первым этапом молекулярно-генетической диагностики обычно является анализ образца опухолевой ткани, полученной в ходе операции, на предмет наличия микросателлитной нестабильности. Согласно данным литературы, тест на MSI оказывается положительным более чем в 90 % случаев синдрома Линча [24]. Примерно в 8-15 % епорадических случаев колоректального рака MSI-тест также может быть позитивным и поэтому не

является абсолютным признаком наследственного заболевания.

Целью исследования является оценка спектра наследственных мутаций в генах MMR у пациентов с MSI-положительными РТК, соответствующих клиническим критериям НОТСС.

Материал и методы

Работа основана на ретроспективном анализе данных историй болезни 672 первичных больных раком ободочной кишки, подвергшихся хирургическому лечению в НИИ онкологии им. Н.Н. Петрова (г. Санкт-Петербург) в период с 1999 по 2009 г. В этой группе у 653 (97,2 %) больных выявлялась одна опухоль, оставшиеся 19 (2,8 %) пациентов страдали первично-множественными новообразованиями ободочной кишки. Возраст на момент диагноза составлял от 19 до 85 лет. Подавляющее большинство больных находилось в возрастной группе старше 50 лет (88,4 %). Отмечалось некоторое преобладание женщин, доля которых составила 63 % (425 человек).

Все опухоли были представлены аденокарциномами различной степени злокачественности. У 370 (55 %) пациентов новообразования обладали умеренной, у 100 (15 %) - высокой, у 168 (25 %) - низкой степенью дифференцировки. В 34 (5 %) случаях наблюдался недифференцированный рак. Стадия опухолевого процесса определялась согласно Международной классификации злокачественных опухолей по системе ТКМ (2003). У 295 (44 %) больных диагностирована 1-11 стадии, у 377 (56 %) - ПНУ стадии РТК.

Выделение ДНК. В случае использования архивного патоморфологического материала срезы толщиной 15 мм депарафинизировались в двух сменах ксилола по 5 мин. Затем образцы промывались в двух сменах 96 % этанола по 2 мин. После тщательного удаления этанола к тканям добавлялся лизирующий буфер (10 мМ Tris-НCl (рН=8,0), 0,1 мМ ЭДТА; рН=8,0, 2 % натрия доде-цилсульфат) и протеиназа К (20 мг/мл). Инкубация образцов проводилась при 60°С в течение 8-16 ч до полного лизиса тканей. Далее проводилась фенол-хлороформная экстракция. К лизату добавлялся однократный объем нейтрального фенола и 0,3 объема смеси хлороформ-изоамиловый спирт (24:1). После интенсивного встряхивания пробирки в течение 10 мин проводилось центрифугирование при 15000 g в течение 20 мин. Затем надосадочная

жидкость отбиралась в чистые пробирки, в которые добавляли 0,1 объема 3 М ацетата натрия (рН=4,0) и 0,3 объема хлороформа. После интенсивного встряхивания образцы центрифугировались при 15000 g в течение 20 мин. Супернатант отбирался в чистые эппендорфы; после добавления гликогена (20 мг/мл) и 1 объема холодного изопропанола образцы подвергались длительному (3 ч и более) охлаждению до -20°С. Затем пробирки центрифугировались при 15000 g в течение 30 мин. Изопропанол удалялся, а полученный осадок однократно промывался в 70 % этаноле в течение 10 мин. После тщательного удаления этанола осадок подсушивался в термостате при 40°С, а затем растворялся в 30 мкл стерильной воды при 65°С. Раствор ДНК хранился при -20°С до использования в ПЦР. Выделение ДНК из лейкоцитов периферической крови проводилось посредством модифицированного соль-хлороформного метода [18].

Анализ микросателлитной нестабильности. Микросателлитная нестабильность выявлялась при помощи квазимономорфных мононуклеотидных маркеров ВАТ25, ВАТ26 и ВАТ40 [5, 7, 12]. Использовались следующие пары праймеров: ВАТ25: TCGCCTCCAAGAATGTAAGT и TCTGCATTT-TAACTATGGCTC; ВАТ26: TGACTACTПTGACT-TCAGCC и ААССАТТСААСАТТТТТААССС; ВАТ40: АТТААСТТССТАСАССАСААС и GTA-GAGCAAGACCACCTTGTCTC. Полимеразная цепная реакция (ПЦР) проводилась в конечном

1 2 3 4 5

Рис. 1. Микросателлитная нестабильность по маркеру ВАТ-26:

1 - маркер молекулярного веса; 2-4 - образцы без микросателлитной нестабильности; 5 - образец с микросателлитной нестабильностью (пациент 16); - - негативный контроль

объеме 10 мкл. Каждая реакция содержала 1 мкл раствора ДНК, 0,5 ед. термостабильной ДНК-полимеразы, 1х ПЦР-буфер (pH 8,3), 2,5 мМ MgCl2, 200 мкМ каждого из четырех нуклеотидтрифос-фатов, 0,3 мкМ прямого и обратного праймеров. Использовались следующие условия реакции: стартовая 10-минутная активация Taq-полимеразы при 95°C; 45 циклов амплификации (денатурация: 15 сек при 95°C; отжиг: 30 сек при 60°C; элонгация 30 сек при 72°C). Полученный продукт разделяли методом электрофореза в 15 % полиакриламидном геле. Позитивным (MSI+) считался образец. демонстрирующий изменение длины одной или нескольких микросателлитных последовательностей. Наличие феномена микросателлитной нестабильности (рис. 1) служило критерием отбора для дальнейшего генетического анализа.

Анализ мутации BRAF V600E. Детекция замены V600E в гене BRAF проводилась методом аллель-специфической ПЦР с использованием праймеров GGTGATTTTGGTCTAGCTACAGT (аллель дикого типа), GGTGATTTTGGTCTAGC-TACAGA (мутантный аллель) и ATAGCCTCAAT-TCTTACCATCC (общий праймер). ПЦР в режиме реального времени проводилась на оборудовании iCycler iQ Real-Time PCR Detection System (BioRad Laboratories, Hercules, USA) и состояла из 50 циклов (денатурация: 15 сек при 95°C; отжиг: 30 сек при 63°C; синтез: 30 сек при 72°C). Каждая ПЦР -реакция (суммарный объем 20 мкл) содержала 1 мкл раствора ДНК, 1 ед. ДНК-полимеразы, 1-кратный ПЦР-буфер (pH 8,3), 2,5 мМ MgCl2, 200 мкМ каждого из нуклеотидтрифосфатов, 0,3 мкМ каждого праймера и 0,2х SYBR green I.

Анализ мутаций в генах hMLHl и HMSH2. Выявление мутаций в кодирующих последовательностях генов hMLH1 (экзоны 1-19) и hMSH2 (экзоны 1-16) проводилось при помощи комбинации методов полимеразной цепной реакции (ПЦР) и высокоразрешающего анализа кривых плавления ДНК (high resolution melting analysis, HRMA). Последовательности праймеров для проведения ПЦР-HRMA приведены в табл. 1.

ПЦР c анализом кривых плавления проводили на приборе Rotor Gene 6000 (Corbett Research, Австралия). В качестве флуоресцентного красителя использовали 1Х раствор EvaGreen. Условия реакции для амплификации всех экзонов были одинаковыми: 95°С 10 мин, 55 циклов 95°С 15 сек/60°С

Таблица 1

Праймеры для ПЦР и высокоточного анализа кинетики плавления ДНК

Название праймера Последовательность 5’-3’ Размер фрагмента, п.н.

МКН1ех1 F СТТССОТТОАОСАТСТАОАС 184

МКН1ех1 Я СССООСТСОАСТСССТС

МЬН1ех2 F САТТАОАОТАОТТОСАОАСТО 184

МЬН1ех2 Я ССАТОААОСОСАСАААСАТС

МЬН1ех3 F СТСАГСТТТТТООТАГСТААСАО 151

МЬН1ех3 Я ТТТАСАСАТТТСТТОААТСТТТАО

МЬН1ех4 F ООТОАООТОАСАОТОООТО 167

МЬН1ех4 Я ТАТОАОТААААОААОТСАОСАС

МЬН1ех5 F ТСТСТСТАСТООАТАТТААТТТО 160

МЬН1ех5_Я ТСТСССАТОТАССАТТСТТАС

MLН1ex6_F ОСТТТТОССАООАСАТСТТО 186

МЬН1ехб_Я САААТСТСАОАОАСССАСТ

MLН1ex7_F ОСТСТОАСАТСТАОТОТОТО 127

MLН1ex7_R ССССАТАААССААОААСТТАС

MLН1ex8_F1 САОССАТОАОАСААТАААТСС 142

MLН1ex8_R1 САТАССОАСТААСАОСАТТТС

MLН1ex8_F2 СААТОССТСААССОТООАС 150

МКН1ех8 АСАСАТААТАТСТТОАААООТТС

MLНex9 F СТОАТТСТТТТОТААТОТТТОАО 204

MLН1ex9_R ТТСССАТОТООТТСТТТТТААС

MLН1ex10_F ССССТСАООАСАОТТТТОАА 161

MLН1ex10_R АООАОТТТООТОСТАСАТТА

MLН1ex11_F САСТАТСТААООТААТТОТТСТС 235

MLН1ex11 Я САААООССССАОАОААОТАО

МКН1ех12 2 F ОАСТТОСТООССССТСТО 138

MLН1ex12_2_R ОАААТОСАТСААОСТТСТОТТС

MLН1ex12_3_F ССАОАТООТТСОТАСАОАТТС 139

MLН1ex12 3Я АОТТСААОСАТСТССТСАТСТ

MLН1ex12_4_F СТАООСАОСААОАТОАООАО 139

MLН1ex12 4 Я СТООООТТОСТООААОТАО

МКН1ех12 5 F ТООАОООООАТАСААСАААО 175

MLН1ex12 5 Я АОТСАООСАОАОАОААОАТО

MLН1ex13_F ОАТСТОСАСТТССТТТТСТТС 199

MLН1ex13_R ОСАООССАСАОСОТТТАС

MLН1ex14_F ОТАООАТТСТАТТАСТТАССТО 194

МКН1ех14 Я ОТАОСТСТОСТТОТТСАСАС

MLН1ex15_F СССААСТООТТОТАТСТСААО 210

MLН1ex15 Я САААТААОАТАТТАОТООАОАОС

MLН1ex1б 1F ТСТТОООААТТСАООСТТСАТ 195

MLН1ex1б 1Я ОССТТСТТСТТСАОАААСТСА

MLН1ex1б_F2 АОАООААОАТООТСССАААО 124

МКН1ех16_Я2 ОТАТААОААТООСТОТСАСАС

Продолжение таблицы 1

МКН1ех17 F САТТАТТТСТТОТТСССТТОТС 167

МКН1ех17_Я АССОАААТОСТТАОТАТСТОС

MLН1ex18F ОАООТАТТОААТТТСТТТООАС 155

MLН1ex18R ТОСАТСАССАСТОТАССТО

MLН1ex19 F1 САААСАОООАООСТТАТОАС 230

MLН1ex19_R2 СССАСАОТОСАТАААТААССА

MSН2ex1_1F ААССАООАООТОАООАООТ 215

МБН2ех1 1Я ТСАСССССТОООТСТТОАА

MSН2ex1 2F СОАССООООСОАСТТСТА 162

MSН2ex1 2Я ТССССАОСАСОСОССОТ

MSН2ex2_1F ОСАОСАТОААОТССАОСТАА 164

MSН2ex2_1R СТСТАТАСТОАСОААССАОАА

MSН2ex2_2F ОАТСТТСТТСТООТТСОТСА 124

MSН2ex2 2Я ОООООТАААТТАААААООААОА

MSН2_ex 3_1F ОООООАОТАТОТТСААОАОТ 145

MSН2 ех 3 1Я ОАСАТТТТААСАСССАСААСАС

MSН2 ех 3 2F ААСААТОАТАТОТСАОСТТССА 130

MSН2_ex 3_2Я ТАТСАОООААТТСАСАСАОТС

MSН2ex3_3F ООАТТССАТАСАОАООАААСТ 125

MSН2ex3 3Я СТССТСТАТСАСТАОАСТСАА

MSН2ex4 1F ТОТАООТОААТСТОТТАТСАСТ 185

MSН2ex4 1Я ОТТОАООТССТОАТАААТОТС

MSН2ex4_2F ОООАТААТТСАААОАООАООА 176

MSН2ex4 2Я ООООТТСАСАТТТАТААТССАТ

MSН2 ех5 1 F АТССАОТООТАТАОАААТСТТС 174

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

MSН2_ex5_1_R ОАСТОСТОСААТАТССААТТТС

MSН2_ex5_2_R САТСАСТОТСТОСООТААТС 230

MSН2_ex5_F2 ТАТААОСТТСТТСАОТАТАТОТС

MSН2ex6_1F СТААТОАОСТТОССАТТСТТТС 178

MSН2ex6_1R СТСТССТСТАТТСТОТТСТТАТ

(m13)MSН2ex6_2F ТОТААААСОАСООССАОТОТООАТТААОСАОССТСТСА 129

(m13)MSН2ex6_2R АОСООАТААСААТТТСАСАСАОООСАООТТАСАТААААС ТААСОА

MSН2ex7_1F ОАОАСТТАСОТОСТТАОТТОА 195

MSН2ex7 1Я ТОСТТОТСТТТОАААСТТСТТО

MSН2_ex 7_2F СССАОАТСТТААССОАСТТО 177

MSН2 ех 7 2Я АОТАТАТАТТОТАТОАОТТОААО

MSН2 ех 8 F ОООООАОАТСТТТТТАТТТОТ 162

MSН2 ех 8Я ТАТТОСАТАССТОАТССАТАТС

MSН2ex9F ТТОТСАСТТТОТТСТОТТТОС 176

MSН2ex9R ТАТТССААССТССААТОАСС

MSН2ex10 1F ААТООТАОТАООТАТТТАТООАА 126

MSН2ex10_1R ССТТАСАООТТАСАСОАААОТ

Продолжение таблицы 1

MSH2ex10 2F GCACAGTTTGGATATTACTTTC 173

MSH2ex10_2R ATCATGTTAGAGCATTTAGGGA

MSH2ex11F GTACACATTGCTTCTAGTACA 200

MSH2ex11R CAGGTGACATTCAGAACATTA

MSH2ex12 1F GTATTCCTGTGTACATTTTCTG 174

MSH2ex12 1R TTCTTCCTTGTCCTTTCTCCA

MSH2ex12 2F ACGTGTCAAATGGAGCACCT 207

MSH2ex12_2R CCCACAAAGCCCAAAAACCA

MSH2ex13 1F CATCAGTGTACAGTTTAGGAC 207

MSH2ex13 1R CAGTCCACAATGGACACTTC

MSH2ex13 2F GTGCCATGTGAGTCAGCAG 183

MSH2ex13_2R CTCACAGGACAGAGACATAC

MSH2_ex14_1 F TATGTGATGGGAAATTTCATGTA 143

MSH2 ex14 1R TGTTGCAATGTATTCTGATATAG

MSH2_ex14_2F TTTGGGTTAGCATGGGCTATA 136

MSH2 ex14 2R GTGCTGTGACATGTAGATTATTA

MSH2_ex14_3F TGCCTTGGCCAATCAGATAC 132

MSH2_ex14_3R CCAAGTTCTGAATTTAGAGTAC

MSH2ex15_1F GCTGTCTCTTCTCATGCTGT 225

MSH2ex15 1R TCTCTTTCCAGATAGCACTTC

MSH2ex15 2F CCCTAAGCATGTAATAGAGTG 200

MSH2ex15_2R AACCTTCATCTTAGTGTCCTG

MSH2ex16 1F GGGACATTCACATGTGTTTCA 214

MSH2ex16 1R CATTCCATTACTGGGATTTTTC

MSH2ex16 2F CCTTTACTGAAATGTCAGAAGAA 224

MSH2ex16_2R ACTGACAGTTAACACTATGGAA

30 сек/72°С 30 секунд. Интервал плавления - с 75°С до 95°С с шагом 0,1°С, время удержания каждой температуры 10 сек. Кривые, нормализованные по уровню флуоресценции, анализировались с помощью установленного производителем программного обеспечения. Кривые плавления исследуемых образцов сравнивались с кривыми плавления ДНК здоровых доноров. Образцы ДНК, обладающие аномальной кривой плавления, были отобраны для дальнейшего анализа. Секвенирова-ние проводилось с помощью набора GenomeLab DTCS Quick Start Kit (Beckman Coulter, USA) согласно рекомендациям производителя. Продукт реакции после преципитации этанолом разбавлялся в 40 мл SLS (Sample Loading Solution, Beckman Coulter, USA) и подвергался капиллярному электрофорезу в системе генетического анализа CEQ 8000 (Beckman Coulter, USA).

Результаты и обсуждение

Для молекулярно-генетического исследования были отобраны 16 пациентов, у которых молодой возраст пациентов (<50 лет) сочетался с присутствием в истории болезни сведений о семейном анамнезе НОТСС-ассоциированных заболеваний [23, 25]. Первый этап молекулярно-генетического исследования - тест на микросателлитную нестабильность (MSI) - оказался положительным у 10 из 16 исследуемых больных (63 %); при этом в 7 опухолях наблюдалось вовлечение 2 или 3 маркеров (табл. 2).

Полный анализ нуклеотидной последовательности генов репарации неспаренных оснований ДНК является очень трудоёмким и дорогостоящим мероприятием, поэтому многие исследовательские коллективы используют дополнительные критерии отбора MSI-положительных опухолей на эту

Таблица 2

Характе

эистика пациентов с феноменом микросателлитной нестабильности

№ образца Возраст, лет Наличие первичномножественных опухолей Наследственный анамнез МБІ Мутации

1 39 - У бабушки - рак толстой кишки, у тети - рак молочной железы ВАТ26 -

3 31 - У бабушки по материнской линии -рак яичников, у прабабушки - рак молочной железы ВАТ26 hMLH1, R226L (с.677 G>T)

5 45 Синхронный рак слепой и поперечноободочной кишки У матери - метахронный РТК, у бабушки - РТК и рак эндометрия, у сестры бабушки - РТК, у брата - РТК ВАТ26, ВАТ40 hMLH1, R659X (с.1975 С>Т)

7 32 - У отца - рак прямой кишки, у тети - рак почки ВАТ25, ВАТ26, ВАТ40 ШБШ E878fsX3 (с.2633_2634delAG)

8 44 - У тети по материнской линии - рак желудка, у бабушки - рак прямой кишки ВАТ26, ВАТ40 -

9 50 - У матери - рак прямой кишки, у прабабушки - рак пищевода ВАТ26, ВАТ40 -

11 36 - У матери - рак прямой кишки, у бабушки - рак поджелудочной железы ВАТ25, ВАТ26, ВАТ40 hMSH2, N139fsX (с.415_4Ше1АА)

13 46 - У отца - кардиоэзофагеальный рак, у деда - рак прямой кишки ВАТ25, ВАТ26, ВАТ40 -

15 47 Синхронный рак сигмовидной и слепой кишки У бабушки - рак тела матки ВАТ40 -

16 42 - У отца - рак желудка, у деда отца - РТК, у сестры отца - РТК и рак матки, у двоюродной сестры - рак шейки матки ВАТ25, ВАТ26 hMSH2, А636Р (с.1906 G>C)

процедуру. В частности, некоторые специалисты рекомендуют иммуногистохимический анализ опухоли на предмет экспрессии ММЯ-белков с последующим отбором для секвенирования только тех генов, продукты которых не выявляются соответствующими антителами. Однако мы приняли решение не использовать данный подход, так как он не лишен существенных недостатков. Например, если инактивирующая мутация не затрагивает домен стабильности белка, его экспрессия может сохраняться [15]. Другой способ дифференциальной диагностики между наследственными и спорадическими MSI-положительными карциномами предусматривает мутационный анализ гена BRAF.

Патогенез спорадических опухолей толстой кишки с микросателлитной нестабильностью влечет потерю экспрессии hMLH1, которая возникает за счет метилирования промоторной области этого гена [26]. Показано, что в таких опухолях часто встречается мутация BRAF V600Е, которая никогда не обнаруживается в «истинных» (т.е. связанных с наследственными дефектами MMR) случаях НОТСС [6]. В данной работе все образцы с микро-сателлитной нестабильностью были проверены на наличие этой мутации, однако замена V600E не была обнаружена ни в одном случае.

Таким образом, все 10 MSI-положительных образцов были подвергнуты анализу нуклеотид-

Normalized, Temperature-Shifted Melt Curve

76 78 80 82 84 86

Shifted Temperature

Рис. 2. Мутация A636P, пациент 16: А - высокоразрешающее плавление (HRMA) ПЦР-продукта экзона 12 гена hMSH2. mut -кривая плавления образца с мутацией; wt - кривая плавления контрольных образцов без мутации; В - нуклеотидная замена с.1906 G>C (A636P) в гене hMSH2; C - образец ДНК здорового донора

ной последовательности генов hMLH1 и hMSH2 посредством высокоточного анализа кинетики плавления ДНК с последующим секвенировани-ем кандидатных фрагментов. Эти мутации были обнаружены у 5 из 10 пациентов (табл. 2). Важно отметить, что функциональная значимость обнаруживаемых мутаций не всегда очевидна, особенно в случае мутаций, не ведущих к появлению стоп-кодонов. Для выяснения этого вопроса, помимо литературы, использовалась информация специализированных баз данных: InSiGHT (International Society for Gastrointestinal Hereditary Tumors) http:// www.insight-group.org/mutations/ и Mismatch Repair

Genes Variant Database http://www.med.mun.ca/ mmrvariants/.

Мутация А636Р (рис. 2) является известным «founderw-вариантом, возникшим около 200-500 лет назад в популяции евреев Ашкенази [20]. Замена аланина на пролин в АТФазном домене нарушает связывание белка с неспаренными основаниями. Это повреждение имеет популяционную частоту 0,4-0,7 % [13] и встречается более чем у 1 % не-селектированных больных раком эндометрия [4] и в 7 % случаев раннего рака толстой кишки [9]. Данная мутация многократно увеличивает риск развития колоректального рака и рака эндометрия в течение жизни, поэтому в группе евреев восточноевропейского происхождения целесообразен скрининг с целью выявления носителей. Мутация hMLH1 R226L обнаружена в ряде европейских стран. Результаты функциональных тестов и оценки in silico предполагают, что данная мутация может дестабилизировать конформацию белка [22]. Патогенность остальных трех обнаруженных мутаций (hMLH1 R659X, hMSH2 E878fsX3, hMSH2 N139fsX) не вызывает сомнений, так как их последствием является преждевременная терминация синтеза белка. При этом мутация в 3 экзоне гена MSH2 - N139 fsX (c.415-416delAA) ранее в литературе не описана.

Таким образом, мутации, ответственные за развитие наследственного опухолевого синдрома, выявлены в половине MSI-позитивных случаев. У остальных пациентов заболевание могло быть связано с повреждением других генов системы репарации (hMSH6, PMS2 и др.). Кроме того, нельзя исключить наличие более масштабных повреждений hMLH1 и hMSH2 (делеции и дупликации одного или нескольких экзонов), которые не могут быть детектированы секвенированием. Для проверки такой возможности необходимо применение таких методов диагностики. как MLPA (Multiple Ligation-dependent Probe Amplification).

Учитывая большие размеры России и разнообразие народностей, которые ее населяют, любопытным фактом является наличие в нашей стране выраженного «эффекта основателя». В частности, анализ BRCA мутаций у женщин c признаками наследственного рака молочной железы и яичников показал, что в различных, удаленных друг от друга регионах России преобладает одна и та же мутация - 5382insC в гене BRCA1 [18, 21].

Ожидалось, что и для пациентов с HNPCC удастся найти повторяющиеся варианты, однако в нашем исследовании все обнаруженные мутации уникальны, что можно объяснить небольшим числом наблюдений.

Конечной целью медико-генетического консультирования пациентов с HNPCC является выявление мутации, ответственной за развитие заболевания в данной семье, и разъяснение риска развития новообразований взрослым членам семьи. Если генетическое повреждение выявлено у больного, становится возможным пресимптоматическое тестирование ближайших родственников на предмет наследования этой мутации. При обнаружении мутации можно говорить о чрезвычайно высокой вероятности развития опухолевого синдрома (не менее 80 %) в течение жизни [19]. Поэтому таким лицам необходимо рекомендовать комплекс мероприятий, направленных на максимально раннюю диагностику опухолей HNPCC-спектра. Оправданным является проведение колоноскопии (раз в 1 или 2 года), начиная с 25-летнего возраста, а у женщин - УЗИ матки с 30-35 лет [11]. Кроме того, при лечении пациентов с HNPCC следует учитывать некоторые особенности течения заболевания, такие как относительно благоприятный прогноз, небольшая вероятность метастазирования, низкая чувствительность к терапии фторпиримидинами и хороший ответ на лечение иринотеканом [8, 10].

Генетическая диагностика наследственного неполипозного рака толстой кишки в настоящее время представляет собой непростую задачу. Сложности связаны с целым рядом факторов (большое количество генов, ассоциированных с развитием синдрома; необходимость анализа всей последовательности этих генов; отсутствие выраженного «эффекта родоначальника»). Использование методики высокоразрешающего плавления ПЦР-продуктов (HRMA) является перспективным подходом к поиску наследственных мутаций в генах репарации ДНК у пациентов с клиническими признаками HNPCC и наличием микросателлитной нестабильности.

Работа выполнена при поддержке грантов РФФИ (№ 10-04-00962-а), Министерства образования и науки Российской Федерации (№ 02.740.11.0780) и Правительства Москвы (№ 15/11-Ген-М).

ЛИТЕРАТУРА

1. Егоренков В.В., Имянитов Е.Н., Правосудов И.В. и др. Клинические аспекты наследственного неполипозного рака толстой кишки: опыт проведения генетического консультирования // Вопросы онкологии. 2008. Т. 54, № 2. С. 178-182.

2. Мерабишвили ВМ. Злокачественные новообразования в мире, России, Санкт-Петербурге. СПб.: Коста, 2007. 290 c.

3. Чиссов В.И., Старинский В.В., Петрова Г.В. Злокачественные новообразования в России в 2007 году (заболеваемость и смертность). М.: ФГУ МНИОИ им. П.А. Герцена Росмедтехнологий, 2009. 68 c.

4. BarakF., Milgrom R., Laitman Y. et at. The rate of the predominant Jewish mutations in the BRCA1, BRCA2, MSH2 and MSH6 genes in unselected Jewish endometrial cancer patients // Gynecol. Oncol. 2010. Vol. 119. P 511-515.

5. Boland C.R., Thibodeau S.N., Hamilton S.R. et at. A National Cancer Institute Workshop on Microsatellite Instability for cancer detection and familial predisposition: development of international criteria for the determination of microsatellite instability in colorectal cancer // Cancer Res. 1998. Vol. 15. P. 5248-5257.

6. BouzoureneH., Hutter P., Losi L. et at. Selection of patients with ger-mline MLH1 mutated Lynch syndrome by determination of MLH1 methyla-tion and BRAF mutation // Fam. Cancer. 2010. Vol. 9. P 167-172.

7. Buhard O., Cattaneo F., Wong Y.F. et at. Multipopulation analysis of polymorphisms in five mononucleotide repeats used to determine the microsatellite instability status of human tumors // J. Clin. Oncol. 2006. Vol. 24. P. 241-251.

8. GryfeR., Kim H., HsiehE.T. et al. Tumor microsatellite instability and clinical outcome in young patients with colorectal cancer // N. Eng. J. Med. 2000. Vol. 342. P. 69-77.

9. Guillem J.G., Moore H.G., Palmer C. et al. A636P testing in Ashkenazi Jews // Fam. Cancer. 2004. Vol. 3. P 223-227.

10. Fallik D., Borrini F., Boige V et al. Microsatellite instability is a predictive factor of the tumor response to irinotecan in patients with advanced colorectal cancer // Cancer Res. 2003. Vol. 63. P. 5738-5744.

11. Lynch H.T., Boland C.R., Gong G. et al. Phenotypic and genotypic heterogeneity in Lynch syndrome: diagnostic, surveillance and management implications // Eur. J. Hum. Genet. 2006. Vol. 16. P. 390-402.

12. LoukolaA., Eklin K., Laiho P. et al. Microsatellite marker analysis in screening for hereditary nonpolyposis colorectal cancer (HNPCC) // Cancer Res. 2001. Vol. 61. P. 4545-4549.

13. Mukherjee B., Rennert G.,Ahn J. et al. High risk of colorectal and endometrial cancer in Ashkenazi families with the MSH2 A636P founder mutation // Gastroenterology. 2011. Vol. 140. P. 1919-1926.

14. Muller A., Edmontson T.B., Dietmaer W. et al. MSI-testing in hereditary non-polyposis colorectal carcinoma (HNPCC) // Dis. Markers. 2004. Vol. 20. P. 225-236.

15. Ollila S., Dermadi BebekD., Jiricny J., Nystrom M. Mechanisms of pathogenicity in human MSH2 missence mutants // Hum. Mutat. 2008. Vol. 29. P. 1355-1363.

16. Peltomaki P., Vasen H. Mutations associated with HNPCC predisposition. Update of ICG-HNPCC/INSiGHT mutation database // Dis. Markers. 2004. Vol. 20. P. 269-276.

17. Rahner N., Streinke V, Schelgelberer B. et al. Clinical utility gene card for: Lynch syndrome (MLH1, MSH2, MSH6, PMS2 // Eur. J. Hum. Genet. 2010. Vol. 18, doi: 10.1038/ejhg. 2009. 232

18. Sokolenko A.P., Rozanov M.E., Mitiushkina N.V et al. Founder mutations in early-onset, familial and bilateral brest cancer patients from Russia // Fam. Cancer. 2007. Vol. 6. P. 281-286.

19. Strate L.L., Syngal S. Hereditary colorectal cancer syndromes // Cancer Causes Control. 2005. Vol. 16. P. 201-213.

20. Sun S., Grennwood CM., Thiffault J. et al. The HNPCC associated MSH2*1906 G-->C founder mutation probably originated between 1440 CE and 1715 CE in Ashkenazi Jewish population // J. Med. Genet. 2005. Vol. 42. P. 766-768.

21. Suspitsin E.N., Sherina N.Y., Ponomariova D.N. et al. High frequency of BRCA1, but not CHEK2 or NBS1(NBN) founder mutations in Russian ovarian cancer patients // Hered. Cancer Clin. Pract. 2009. Vol. 25. P. 5.

iНе можете найти то, что вам нужно? Попробуйте сервис подбора литературы.

22. TakahashiM., Shimodaira H., Andreutti-Zaugg C. et al. Functional analysis of human MLH1 variants using yaest and vitro mismatch repair assays // Cancer Res. 2007. Vol. 67. P. 4595-4604.

23. Umar A., Boland C.R., Terdiman J.P. et al. Revised Bethesda Guidelines for hereditary nonpolyposis colorectal cancer (Lynch syndrome) and microsatellite instability // J. Natl. Cancer Inst. 2004. Vol. 96. P. 261-268.

24. Vasen H.F., Boland C.R. Progress in genetic testing, classification, and identification of Lynch syndrome // JAMA. 2005. Vol. 293. P. 2028-2030.

25. Wijnen J.T., Vasen H.F., Khan PM. et al. Clinical findings with implications for genetic testing in families with clustering of colorectal cancer // N. Engl. J. Med. 1998. Vol. 339. P. 511-518.

26. Zighelboim I., Powell MA., Babb S.A. et al. Epitope-positive truncating MLH1 mutation and loss of PMS2: implications for IHC-directed genetic testing for Lynch syndrome // Fam. Cancer. 2009. Vol. 8. P. 501-504.

Поступила 17.10.12

i Надоели баннеры? Вы всегда можете отключить рекламу.