CC BY
22
Protistology 11 (3), 135-142 (2017)
Protistology
Molecular tools for invasion biology: a new approach for amplification of dinoflagellate nitrogen transport genes with unknown exon-intron structure
Sofia A. Pechkovskaya1, Olga V. Matantseva1, Natalya A. Filatova1, Sergei O. Skarlato1 and Irena V. Telesh12
1 Institute of Cytology, Russian Academy of Sciences, St. Petersburg, Russia
2 Zoological Institute, Russian Academy of Sciences, St. Petersburg, Russia
| Submitted September 1, 2017 | Accepted September 15, 2017 |
Summary
Dinoflagellates are an important group of unicellular eukaryotes widespread in aquatic ecosystems. Many dinoflagellates are mixotrophic, toxic or potentially toxic, highly competitive and invasive, while molecular mechanisms that underpin their success in natural communities remain enigmatic. Due to peculiar features of dinoflagellate genome, little is known about the structure and expression of genes in these organisms. We analyzed the transcriptome databases of the dinoflagellate Prorocentrum minimum in order to identify the sequences of urea transporter (dur3) and nitrate transporter (nrt2.1) genes. Taking into account prospective exon-intron organization of dinoflagellate genome we suggested two variants of choosing the primer positions. We designed six primer pairs for amplification of the urea transporter gene fragments and three — for amplification of the nitrate transporter gene fragments. As a result of PCR, fragments of target genes were obtained. Alignment of amplicons with database transcriptome sequences showed that those sequences were identical. Primers developed in this study can be further used for examination of P. minimum gene expression by RT-qPCR. This approach would provide a better understanding of the influence of various nitrogen sources on physiological characteristics of these protists responsible for their effective adaptations to fluctuating environment.
Key words: dinoflagellates, invasions, nitrogen metabolism, Prorocentrum minimum, protists, transcriptome
Introduction
Dinoflagellates are unicellular protists widespread in marine and freshwater ecosystems. About one-half of all dinoflagellates are phototrophs and mixotrophs (Stoecker, 1999; Matantseva and Skarlato, 2013 and references therein) thus
representing an important group of primary producers in the ocean. Many of them play a significant role in the formation of harmful algal blooms in marine coastal regions (Alonso-Rodríguez and Páez-Osuna, 2003; Glibert et al., 2012). Consumption of seafood which is contaminated with dinoflagellate metabolites by humans and by
doi:10.21685/1680-0826-2017-11-3-1 © 2017 The Author(s)
Protistology © 2017 Protozoological Society Affiliated with RAS
organisms in aquaculture can cause intoxication or even lethal cases (Denardou-Queneherve et al., 1999; Tango et al., 2005).
Moreover, some dinoflagellate species are successful invaders to new marine environments, and consequences of those invasions often alter ecosystems' structure, functions and biodiversity paradigms (Telesh, 2016; Skarlato and Telesh, 2017). One of the brightest examples is the potentially toxic, mixotrophic, bloom-forming planktonic dinoflagellate Prorocentrum minimum (Pavillard) Schiller, or Prorocentrum cordatum (Ostenfeld) Dodge according to priority rule, and its invasion history in the Baltic Sea. Within two decades after this invasion, P. minimum had outcompeted its congeners from the complex of dominant dino-flagellate species (Telesh et al., 2016). However, fine mechanisms behind the competitive advantages and pronounced adaptive potential of dinoflagellates are not fully understood (Skarlato et al., 2017).
Research on the dinoflagellate genomes has always been challenging due to the large size of genomic DNA. There is still no complete genome sequence for these organisms, and little is known about the structure and expression oftheir genes. The use of such tool as reverse transcription quantitative real-time PCR (RT-qPCR) for examination ofgene expression would allow a better understanding of dinoflagellate physiology determining their role in natural ecosystems, but it is hampered by the scarcity of genomic information necessary for the primer design. Expressed sequence tag (EST) projects and transcriptome databases provide an alternative way for molecular studies; however, they do not possess information about exon-intron gene structure in dinoflagellates. Recently Mendez and co-authors (Mendez et al., 2015) found out that introns of the dinoflagellate Crypthecodinium cohnii are flanked by specific combinations of nucleotides (AGG) at the splice sites. This allows to assume intron locations and gene structure, which can be useful for the purposes of primer design.
It is known that nitrogen availability limits phytoplankton growth in many marine ecosystems (Vitousek and Howarth, 1991; Falkowski, 1997; Dyhrman and Anderson, 2003; Howarth and Marino, 2006). However, at the present time anthropogenic eutrophication leads to elevated concentration of nitrogenous compounds, such as urea, in coastal habitats (Galloway et al., 2004; Glibert et al., 2005, 2016). Under eutrophication conditions, dinoflagellates often demonstrate com-
petitive advantages over the other phytoplankton groups (Glibert et al., 2012; Telesh et al., 2016), since these organisms exploit diverse nutrition strategies and thus can effectively satisfy their nitrogen requirements. It was suggested that high concentrations of urea in seawater may promote harmful dinoflagellate blooms (Anderson et al., 2002; Heisler et al., 2008). Dinoflagellates readily use this organic compound as a nitrogen source, often in preference to nitrate (Glibert et al., 2006; Solomon and Glibert, 2008). Moreover, it was demonstrated that the presence of urea in the medium has an inhibitory effect on nitrate uptake by dinoflagellates P. minimum (Matantseva et al., 2016a, 2016b).
Presumably, nitrogen uptake can be regulated at the level of transcription; however, information about molecular aspects of nitrogen metabolism of dinoflagellates is still scarce. Our preliminary analysis of incorporation of H3-uridine by dinoflagellate cells revealed that addition of diverse nitrogen sources to the culture medium resulted in different RNA synthesis rates (Pechkovskaya et al., 2016). We therefore hypothesized that the observed differences in the RNA synthesis rate may be related to the transcriptional regulation of synthesis of proteins involved in nutrient transport.
Proteins NRT2 and DUR3 are known to be responsible for the transport of nitrate and urea, correspondingly. A protein homologous to NRT2.1, a high-affinity nitrate transporter of the major facilitator family (MFS), has been identified as the most likely candidate to be involved in nitrate transport in the dinoflagellate Lingulodi-nium polyedrum (Bellefeuille and Morse, 2016). Transporter DUR3 is a high-affinity secondary active urea transporter which is present in a wide range of organisms from microalgae to higher plants (Wang et al., 2008; Witte, 2011). Homologs of both NRT2.1 and DUR3 have been found in the P. minimum transcriptomes (Matantseva et al., 2016b). Expression levels of genes encoding these transporters are assumed to vary depending on available nitrogen sources; further studies using such methods as RT-qPCR could reveal important features of the nitrogen transport regulation in P. minimum. This approach requires internal standards such as housekeeping genes used for normalization of gene expression. The research of Guo and Ki (2012) provides references for internal controls suitable for examination of gene expression in P. minimum.
The goal of this study was to develop a primer design strategy based on the transcriptomic sequences of dinoflagellates and obtain primers for amplification of P. minimum dur3and nrt2.1 genes suitable for further RT-qPCR analysis.
Material and methods
Strain and culturing conditions
A monoculture of dinoflagellates Prorocentrum minimum from The Culture Collection ofAlgae and Protozoa, Scottish Marine Institute, Oban, UK (CCAP clone 1136/16) was used. The culture was grown at salinity 25 in f/2 medium without silicate based on artificial seawater (Guillard and Ryther, 1962). The culture was exposed to a 12 h light: 12 h dark cycle at 21-23 °C and photon flux density 50 ^mol photons m-2 s-1.
Transcriptome analysis
The sequences of dur3 and nrt2.1 for P. minimum were obtained from the transcriptome database Marine Microbial Eukaryote Transcriptome Sequencing Project (MMETSP, Keeling et al., 2014) (Table 1). Dinoflagellate (Symbiodinium sp.) and coccolithophyceae (Emiliania huxleyi) gene sequences from the National Center for Biotechnology Information (NCBI; http://www.ncbi. nlm.nih.gov/protein) were used as queries in local BLAST search. Local BLAST search was performed by means of the BioEdit 7.2.5 software (Hall, 1999) with BLOSUM62 matrix (E-value < 10-10).
Primer design
Nine PCR primer pairs targeting nitrate (NRT2.1) and urea (DUR3) transporter genes were designed. Each primer was evaluated for possible formation of secondary structures, self- and hetero-dimers using OligoAnalyzer 3.1 tool (Integrated DNA Technologies, Inc.; https://eu.idtdna.com/calc/ analyzer). Specificity of primers was tested in silico using BLAST (https://blast.ncbi.nlm.nih.gov/Blast. cgi) against the NCBi database and P. minimum transcriptome. PCR primer oligonucleotides were synthesized by Beagle Co. Ltd. (St. Petersburg, Russia).
Table 1. Sequences of the nitrate and urea transporter genes revealed in the transcriptome of Prorocentrum minimum CCMP1329.
Gene Accession number in the transcriptome CCMP1329
dur3 263164_1
nrt2.1 47143_1
DNA extraction
P. minimum cells were lysed by freezing at —80 °C for 10-15 min, thawed at room temperature and centrifuged at 10,000 g for 5 minutes. Total DNA was isolated using a DNA extraction kit (BioSilica Ltd., Russia) according to the manufacturer's instructions.
PCR amplification, electrophoresis and sequencing
The optimal annealing temperature for each primer pair was determined by means oftemperature gradient PCR. PCR reactions were carried out in a 10 ^l mixture containing 5 ^l 2X DreamTaq MasterMix (Thermo Fisher Scientific, USA), 1 ^l of forward and reverse primers (0.5 ^M), 1 ^l genomic DNA template (10.6 ng/^l) and 2 ^l PCR grade water. Amplification was performed as follows: pre-denaturation step at 94 °C for 3 min followed by 39 cycles of denaturation at 94 °C for 30 s, primer annealing at 55—60 °C for 30 s (Table 2), and elongation at 70 °C for 1 min. Cycling was completed by a final elongation step at 70 °C for 7 min. We determined the optimal annealing temperature that resulted in the best product specificity and yield. Unspecific amplification was observed at lower annealing temperatures. Tubulin-specific primers TUAF and TUAR were used as a positive control (Guo and Ki, 2012).
PCR products were separated in a 2 % agarose gel in 1 x TAE buffer, and amplicon sizes were estimated using GeneRuler 100 bp DNA ladder (Thermo Fisher Scientific, USA). Gel was further stained by ethidium bromide and amplified fragments were visualized under UV light. The PCR products were then extracted from agarose gel with BioSiIica gel extraction kit (BioSilica Ltd., Russia) according to the manufacturer's instructions. DNA sequencing was performed by Beagle Co. Ltd.
в S'
m:
Legend
PCR primer
Non-coding DNA Coding DNA
Fig. 1. A schematic representation of the primer location. A — Primers flanking the exon region between two AGG triplets; B — primers flanking the AGG triplet and putative intron.
Results
In this study, we propose an approach for development of an effective primer design strategy using transcriptomic sequences of dinoflagellates and plausible exon-intron structure of the target genes based on the findings of Mendez et al. (2015). Two variants of choosing primer positions were suggested: (1) on the exon region between the two AGG triplets (Fig. 1A), or (2) flanking the short region including the AGG triplet (Fig. 1B). The second option allows recognizing possible presence of intron within the target gene fragment.
We developed a set of primers for specific amplification ofthe fragments of P. minimum genes. Six primer pairs were designed for amplification of fragments of the urea transporter dur3 gene and three — for amplification of fragments of the nitrate transporter nrt2.1 gene (Table 3). Putative exon regions between the AGG triplets were targeted by primer pairs DUR3F1/DUR3R1, DUR3F2/ DUR3R2, DUR3F3/DUR3R3 designed for the dur3 gene and NRT2.1F1/NRT2.1R1 designed for the nrt2.1 gene. The AGG triplet and a putative intron within the target fragment were targeted by primer pairs DUR3F4/DUR3R4, DUR3F5/ DUR3R5, DUR3F6/DUR3R6 designed for the
dur3gene and NRT2.1F5/NRT2.1R5 and NRT2.1F6 /NRT2.1R6 designed for the nrt2.1 gene.
Dur3 gene amplification with primer pairs DUR3F1/DUR3R1, DU3F2/DUR3R2, DUR3F3/ DUR3R3, DU3F4/DUR3R4 and DUR3F5/ DUR3R5 resulted in the amplificons of expected size. No amplification products were obtained with DU3F6/DUR3R6 primers (Fig. 2). Nrt2.1 gene amplification using primer pairs NRT2.1F1/ NRT2.1R1, NRT2.1F5/NRT2.1R5 and NRT2.1F6 /NRT2.1R6 also resulted in the products of expected size. However, unspecific amplification was observed when the primer pair NRT2.1F6/NRT2.1R6 was applied (Fig. 3). It is worth noting that none of the PCR products obtained using primer pairs of the second type (flanking the short region including the AGG triplet, putative splice sites) contained an intron, which makes them possible to use.
Table 3. Primers for specific amplification of dur3 and nrt2.1 genes.
Table 2. Optimal annealing temperature for amplification.
Primer pairs Optimal TA, DC
NRT2.1F1/NRT2.1R1 56
NRT2.1F5/NRT2.1R5 NRT2.1F6/NRT2.1R6 57
DUR3F1/DUR3R1 DU3F2/DUR3R2 DUR3F3/DUR3R3 DUR3F4/DUR3R4 58
DUR3F5/DUR3R5 DUR3F6/DUR3R6 60
Primer name Primer sequence (S'-3') Target gene Expected product size, bp
DUR3F1 DUR3R1 CCTTCATCTTCTTCTGCCTGC ACAGGATCACGCCCCAC dur3 138
DUR3F2 DUR3R2 GCAACTGGCGATCAGATTCTC GTTCCACAGGGGCACCAC dur3 165
DUR3F3 DUR3R3 TCGGCGAGATCACGGTG CAGACTGGTCGTTCTCCATC dur3 171
DUR3F4 DUR3R4 GTGTACTTGGACAAGACCGC CACTGCGACACAATGACCGAC dur3 110
DUR3F5 DUR3R5 CACCGTGTTCGTGGACCAGTC GAACCACACCAAGCCGCCC dur3 97
DUR3F6 DUR3R6 CAGCAAAACGCCTCGTCCATAC CCGTCCCCAGGAGGAGTAG dur3 105
NRT2.1F1 NRT2.1R1 CGAAGTCCTCCCTAAGTGCG GCACAAAGATCGTGATGCCGAC nrt2.1 97
NRT2.1F5 NRT2.1R5 CATTGGGCGGCATCTTCAGC CATGGCTGCGAGTTCTCCAC nrt2.1 136
NRT2.1F6 NRT2.1R6 CGTTTGGGACGAGAGTTGTG GATCGTGATGCCGACCGAC nrt2.1 199
1 2 3 4 5 6 C+ C- M
400 bp 300 bp
200 bp
100 bp
Fig. 2. Gel electrophoresis of urea transporter dur3 gene amplification products. PCR performed with primers: 1 - DUR3F1/DU3R1, 2 - DUR3F2/ DUR3R2, 3 - DUR3F3/DUR3R3, 4 - DUR3F4/ DUR3R4, 5 - DUR3F5/DUR3R5, 6 - DUR3F6/ DUR3R6, C+ - positive control, C— negative control, M - molecular weight marker.
Alignment of the sequenced amplicons with the respective transcriptomic sequences showed that they were identical, which proves specificity of gene amplification with the designed primers (Fig. 4).
Discussion
Several previous attempts to design gene-specific PCR primers based on P. minimum sequences retrieved from the transcriptomic database of the MMETSP project were not successful (Pechkovskaya, Matantseva et al., unpublished data). Presumably, amplification was hampered by the presence of introns in the target sequences. Recent investigations shed light on the exon-intron organization of dinoflagellate genes exemplified by Crypthecodinium cohnii. According to Mendez et al. (2015), dinoflagellate genome sequences possess identical repeated intron boundary sequence that always contain a GG (or often an AGG) at the 3' splice site and always have an AGG at the 5' splice site, which gives an opportunity to take intron localization into consideration if primer design is based on transcriptomic sequences. However, it is still not clear whether this feature of splicing sites is universal for all dinoflagellates.
The primer pairs developed in this study can be successfully applied to amplify 100-200 bp fragments of the dur3 and nrt2.1 genes of the dinoflagellate P. minimum. These primers can be further used for RT-qPCR analysis of the urea transporter and nitrate transporter gene expression
Fig. 3. Gel electrophoresis of nitrate transporter nrt2.1 gene amplification products. PCR performed with primers: 1 - NRT2.1F1/NRT2.1R1, 2 - NRT2.1F5/NRT2.1R5, 3 - NRT2.1F6/ NRT2.1R6, C+ — positive control, C- — negative control, M — molecular weight marker.
in P. minimum. Investigation of the expression level of genes involved in nitrogen transport is necessary for a clearer understanding of the influence of various nitrogen sources on physiological parameters of dinoflagellates, which benefits will be manifold for a number of disciplines, including aquatic ecology and invasion biology.
Specifically, as shown recently in the laboratory experiments with P. minimum, high viability of dinoflagellate cells in brackish waters with nonoptimal salinity may be explained (at least in part) by speed up of their metabolic activity under stress (Skarlato et al., 2017). This cellular response may be considered as an effective mechanism which allows the bloom-forming dinoflagellates to dominate in hash environment for the extended periods of time (Skarlato and Telesh, 2017). In particular, the recently demonstrated invasion success of P. minimum in the Baltic Sea (Telesh et al., 2016) was assumed to be largely due to diverse feeding strategies and high intra-population variability of cellular responses to external stress (Matantseva et al., 2016b).
These and other specific traits of dinoflagellates that still need to be investigated, e.g. expression of nitrogen-transporting genes and nitrogen metabolism in general, most likely back up the remarkable environmental plasticity of P. minimum and allow this invasive species to conquer new environments, including the plankton species-rich coastal ecosystems subject to elevated nutrient loads (Telesh, 2016; Skarlato et al., 2017). Considering high rates of anthropogenic eutrophication worldwide and rapid
263164_1 DUR3F1/DUR3R1
263164_1 DUR3F2/DUR3R2
CCTTCATCTTCTTCTGCCTGCTCGCCAACGTGATCGTGACGTCGATGCTGCTGCTG CCTTCATCTTCTrCTGCCTGCTCGCCAACGTGATCGTGACGTCGAIGCTGCTGCTG
GAGCGCAACTGCCGATCAGATTCTCAAGATCTCCCGCGTCGTCATTGIGGTCTTCG GGTTGCAACTGGCGATCAGATTCTCAAGATTTCCCGCGTCGTCATTGTGGTCTTCG
263164_1 DUR3F3/DUR3R3
TT CGGCGAGATCACGGTGGACAAT С T С G G CACCCT С A A С С С G A A С С TGGGGGGCAA TTTGGCGAGATCACGGTGGACAATCTTGGCACCCTCAACCCGAACCTGGGGGGCAA
263164_1 □UR3F4/DUR3R4
GGTG TAC TTGGACAAGAC CGCCAACGGCACAGTGATCACT TCGGAGTTCT TCAACA TGTGTACrTGGACAAGACCGCCAACGGCACAGTGAICACCrCGGAGTTC-TCAACA
263164_1 DUR3F5/DUR3R5
GGCACCGTGTTCGTGGACCAGTCCTACTGGCAGTCCGCCATCGCAGCGAAGCCGGC GTTACCGTGTTCGTGGACCAGTCCTACTGGCAGTCCGCCATCGCAGCGAAGCCAGC
47143_1 CGAAGTCCTCCCTAAGTGCGTTTGCAGCCCGGGCACGCACTGCGGTTCGACGATCC
NRT2.1F1/NRT2.1R1 CGAAGTCCTCCCTAAGTGCG - TTGCAGCCCGGGCACGCACTGCGG - TCGACGATCC
47143_1 ATTGGGCGGCATCTTCAGCGATTTTCTTTTCGCCAGGTTCGGTTTCCCTGGCCGTA
NRT2.1F5/NRT2.1R5 ATTGGGCGGCATCTTCAGCGATTTTCTTTTCGCCAGATTCGGTTTCTCTGGCCGTA
Fig. 4. Fragments of alignments of amplicons with database sequences of urea transporter DUR3 (accession number 263164_1 in the transcriptome CCMP1329) and nitrate transporter NRT2.1 (accession number 47143_1 in the transcriptome CCMP1329) genes.
range expansion ofthe bloom-forming dinoflagellate species, the development of gene-specific primers, e.g. targeting urea and nitrate transporter genes of dinoflagellates, opens new perspectives for studies ofmetabolic regulation ofthese highly competitive, potentially toxic, invasive protists aiming at prognostic modeling of their ecosystem impacts under global environmental change.
Acknowledgments
The authors acknowledge critical comments of Dr. M. Vonsky (INC RAS) on the earlier version of the manuscript. The contributions of S.A.P. and I.V.T. to this study were supported in part by the Russian Foundation for Basic Research (project 15-29-02706); the contributions of O.V.M., N.A.F. and S.O.S. were funded by the Russian Science Foundation (project 16-14-10116).
References
Alonso-Rodríguez R. and Páez-Osuna F. 2003. Nutrients, phytoplankton and harmful algal blooms in shrimp ponds: a review with special reference to the situation in the Gulf of California. Aquaculture. 219, 317-336.
Anderson D.M., Glibert P.M. and Burkholder J.M. 2002. Harmful algal blooms and eutrophica-
tion: nutrient sources, composition, and consequences. Estuaries. 25, 704—726.
Bellefeuille S.D. and Morse D. 2016. The main nitrate transporter of the dinofagellate Lingulo-dinium polyedrum is constitutively expressed and not responsible for daily variations in nitrate uptake rates. Harmful Algae. 55, 272-281.
Denardou-Queneherve A., Grzebyk D., Pou-chus Y.F., Sauviat M.P., Alliot E., Biard J.F. and Berland Verbist J.F. 1999. Toxicity of French strains of the dinoflagellate Prorocentrum minimum and experimental natural contaminations of mussels. Toxicon. 37, 1711-1719.
Dyhrman S.T. and Anderson D.M. 2003. Urease activity in cultures and field populations of the toxic dinoflagellate Alexandrium. Limnol. Oceanogr. 48, 647-655.
Falkowski P.G. 1997. Evolution of the nitrogen cycle and its influence on the biological sequestration of CO2 in the ocean. Nature. 387, 272-275.
Galloway J.N., Dentener F.J., Capone D.G., Boyer E.W., Howarth R.W., Seitzinger S.P., Asner G.P., Cleveland C.C., Green P.A., Holland E.A., Karl D.M., Michaels A.F., Porter J.H., Townsend A.R. and Voosmarty C.J. 2004. Nitrogen cycles: past, present, and future. Biogeochemistry. 70, 153-226.
Glibert P.M., Burkholder J.M. and Kana T.M. 2012. Recent insights about relationships between nutrient availability, forms, and stoichiometry, and the distribution, ecophysiology, and food web
effects of pelagic and benthic Prorocentrum species. Harmful Algae. 14, 231-259.
Glibert P.M., Burkholder J.M., Parrow M.W., Lewitus A.J. and Gustafson D.E. 2006. Direct uptake of nitrogen by Pfiesteria piscicida and Pfiesteria shumwayae, and nitrogen nutritional preferences. Harmful Algae. 5, 380-394.
Glibert P.M., Seitzinger S., Heil C.A., Burkholder J.M., Parrow M.W., Codispoti L.A. and Kelly V. 2005. The role of eutrophication in the global proliferation of harmful algal blooms. Oceanography. 18, 198-209.
Glibert P.M., Wilkerson F.P., Dugdale R.C., Raven J.A., Dupont C.L., Leavitt P.R., Parker A.E., Burkholder J.M., Todd M. and Kana T.M. 2016. Pluses and minuses of ammonium and nitrate uptake and assimilation by phytoplankton and implications for productivity and community composition, with emphasis on nitrogen-enriched conditions. Limnol. Oceanogr. 61, 165-197.
Guillard R.R. and Ryther J.H. 1962. Studies of marine planktonic diatoms: I. Cyclotellanana Hustedt, and Detonula confervacea (Cleve) Gran. Can. J. Microbiol. 8, 229-239.
Guo R. and Ki J.S. 2012. Evaluation and validation of internal control genes for studying gene expression in the dinofagellate Prorocentrum minimum using real-time PCR. Eur. J. Protistol. 48, 199-206.
Hall T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser. 41, 95-98.
Heisler J., Glibert P.M., Burkholder J.M., Anderson D.M., Cochlan W., Dennison W.C., Dortch Q., Gobler C.J., Heil C.A., Humphries E., Lewitus A., Magnien R., Marshall H.G., Sellner K., Stockwell D.A., Stoecker D.K. and Suddleson M. 2008. Eutrophication and harmful algal blooms: a scientific consensus. Harmful Algae. 8, 3-13.
Howarth R.W. and Marino R. 2006. Nitrogen as the limiting nutrient for eutrophication in coastal marine ecosystems: evolving views over three decades. Limnol. Oceanogr. 51, 364-376.
Keeling P.J., Burki F., Wilcox H., Allam B., Allen E.E., Amaral-Zettler L.A. et al. 2014. The Marine Microbial Eukaryote Transcriptome Sequencing Project (MMETSP): illuminating the functional diversity of eukaryotic life in the oceans through transcriptome sequencing. PLoS Biol. 12, e1001889.
Matantseva O.V. and Skarlato S.O. 2013. Mixo-trophy in microorganisms: ecological and cyto-
physiological aspects. J. Evol. Biochem. Physiol. 49 (4), 377-388.
Matantseva O., Vogts A., Voss M., Skarlato S. 2016a. Heterogeneity in nutrient uptake by individual dinoflagellate cells revealed using NanoSIMS. Protistology. 10 (2), 44-45.
Matantseva O., Skarlato S., Vogts A., Pozd-nyakov I., Liskow I., Schubert H. and Voss M. 2016b. Superposition of individual activities: urea-mediated suppression of nitrate uptake in the dinoflagellate Prorocentrum minimum revealed at the population and single-cell levels. Front. Microbiol. 7:1310. doi:10.3389/fmicb.2016.01310.
Mendez G.S., Delwiche C.F., Apt K.B. and Lippmeier J.C. 2015. Dinoflagellate gene structure and intron splice sites in a genomic tandem array. J. Eukaryot. Microbiol. 62, 679-687.
Pechkovskaya S.A., Matantseva O.V., Filatova N.A. and Telesh I.V. 2016. Effect ofthe spectrum of available nitrogen sources on Prorocentrum minimum morphology and physiology. Protistology. 10 (2), 58-59.
Skarlato S., Filatova N., Knyazev N., Berdieva M. and Telesh I. 2017. Salinity stress response of the invasive dinoflagellate Prorocentrum minimum. Estuar. Coast. Shelf Sci. https://doi.org/10.1016/). ecss.2017.07.007.
Skarlato S.O. and Telesh I.V. 2017. The development of the protistan species-maximum concept for the critical salinity zone. Rus. J. Mar. Biol. 43 (1), 1-11.
Solomon C.M. and Glibert P.M. 2008. Urease activity in five phytoplankton species. Aquat. Microb. Ecol. 52, 149-157.
Stoecker D.K. 1999. Mixotrophy among dinoflagellates. J. Eukaryot. Microbiol. 46, 397-401.
Tango P.J., Magnien R., Butler W., Luckett C., Luckenbach M., Lacouture R. and Poukish C. 2005. Impacts and potential effects due to Prorocentrum minimum blooms in Chesapeake Bay. Harmful Algae. 4, 525-531.
Telesh I.V. 2016. The protistan species maximum concept and its implications to invasive biology. Protistology. 10 (2), 80.
Telesh I.V., Schubert H. and Skarlato S.O. 2016. Ecological niche partitioning of the invasive dinoflagellate Prorocentrum minimum and its native congeners in the Baltic Sea. Harmful Algae. 59, 100-111.
Vitousek P.M. and Howarth R.W. 1991. Nitrogen limitation on land and in the sea: how can it occur? Biogeochemistry. 13, 87-115.
Wang W.H., Köhler B., Cao F.Q. and Liu
L.H. 2008. Molecular and physiological aspects of urea transport in higher plants. Plant Science. 175, 467-477.
Witte C.P. 2011. Urea metabolism in plants. Plant Science. 180, 431-438.
Address for correspondence: Sofia A. Pechkovskaya. Institute of Cytology, Russian Academy of Sciences, Tikhoretsky Ave. 4, St. Petersburg, 194064, Russia; e-mail: [email protected]
