CC BY
26
Protistology 16 (1): 21-29 (2022) | doi:10.21685/1680-0826-2022-16-l-3
Protistology
Original article
Molecular detection of microsporidia Vairimorpha ceranae and Nosema bombycis growth in the lepidopteran Sf9 cell line
Viacheslav V. Dolgikh1*, Igor V. Senderskiy1, Vladimir S. Zhuravlyov1, Anastasija N. Ignatieva1, Sergej A. Timofeev1, Diloram A. Ismatullaeva2 and Bakhtiyar A. Mirzakhodjaev2
1 All-Russian Institute of Plant Protection, St. Petersburg, Pushkin, Russia
2 Scientific Research Institute ofSericulture, Tashkent, Uzbekistan
| Submitted November 8, 2021 | Accepted December 8, 2021 |
Summary
The search for new therapeutics and strategies to suppress microsporidiosis of domesticated insects requires cultivation of honeybee and silkworm parasites in available insect cell cultures as well as reliable methods of their detection. In this study, we infected the commonly used lepidopteran Sf9 cell line with the Vairimorpha ceranae and Nosema bombycis spores to evaluate molecular methods for microsporidia growth assay. The silkworm parasite N. bombycis effectively develops in lepidopteran cells and, according to literature data, its growth can be detected by qPCR analysis of P-tubulin gene copies in infected Sf9 cultures. Here, we used Western blotting with antibodies against N. bombycis P-tubulin to analyze Sf9 cultures infected with the parasite spores and demonstrated the prospects of immunochemical methods to assay its intracellular growth. Analysis of five genes of N. bombycis spore wall and polar tube proteins in infected cultures by reverse transcription (RT) PCR showed that expression of the polar tube protein PTP2 may serve as a specific marker of the parasite growth because only its transcripts were not detected in freshly inoculated Sf9 cells. The honeybee parasite V. ceranae infects Sf9 cells less efficiently. To find a sensitive and specific marker of the growth of this parasite, we analyzed the transcripts of its 13 genes in infected cultures using the same RT-PCR method. The spore wall protein SWP32 gene demonstrated the highest expression at the 4th-day post infection with V. ceranae spores, alongside with specificity of PCR-amplification, and the absence of transcripts in freshly inoculated cultures. Thus, quantitative PCR analysis of its expression may help to assay the V. ceranae intracellular growth in the Sf9 cell line.
Key words: domesticated insects, microsporidia, Nosema bombycis, Vairimorpha ceranae, Sf9 cell line, reverse transcription PCR, immunoblotting
https://doi.org/10.21685/1680-0826-2022-16-1-3
Corresponding author: Viacheslav Dolgikh. All-Russian Institute of Plant Protection, 196608 St. Petersburg-Pushkin, Podbelskogo Ave. 3, Russian Federation; [email protected]
© 2022 The Author(s)
Protistology © 2022 Protozoological Society Affiliated with RAS
Introduction
Microsporidia Vairimorpha (Nosema) ceranae and Nosema bombycis are intracellular obligate parasites of honeybees Apis mellifera and silkworms Bombyx mori, respectively. They cause destructive epizootics of domesticated insects. The microsporidium V. ceranae, firstly described in the Asian honeybee Apis cerana (Fries et al., 1996), is widely spread around the world (Fries, 2010) and associated with honeybee colony losses (Martín-Hernández et al., 2018), at least in southern European countries (Gisder and Genersch, 2015). Fumagillin, an antibiotic found in the fungus Aspergillus fumigatus, had been used to control honeybee microsporidiosis for many years (Katznelson and Jamieson, 1952; Bailey, 1953; Williams et al., 2008; van den Heever et al., 2014). However, in 2018 Canadian company Medivet Pharmaceuticals Ltd. shut down production of this fungicide due to toxicity for mammals. The microsporidium N. bombycis, a highly virulent parasite of the silkworm Bombyx mori causes a devastating for the world sericulture disease, commonly known as pébrine. Since the first scientific record of pébrine in France in 1845, traditional methods of sanitation that include culling of the infected insects and eggs and using disease-free stocks, remain the primary strategy to control N. bombycis infection (Hukuhara, 2017). The control of these diseases has great economic value and demands a search for new effective therapeutics and strategies such as metal nanoparticles (Saleh et al., 2016; Dong et al., 2021), RNA interference (Paldi et al., 2010; Rodríguez-García et al., 2018; Holt and Grozinger, 2016; Huang et al., 2016; He et al., 2021) or heterologous expression of recombinant antibodies (Abs) (Huang et al., 2018a; Tsarev et al., 2019; Dolgikh et al., 2020). Inconvenience of working with live insects (seasonal availability, poor standardization of experiments, ethical problems) makes insect cell lines attractive for such studies. Cultivation of honeybee and silkworm parasites in insect cell lines requires reliable methods to evaluate their growth.
Fall armyworm Spodoptera frugiperda-derived Sf9 cell line and its progenitor line Sf21 are the most available and widely used in research, including heterologous protein expression (Arunkarthick et al., 2017). Lepidoptera parasites N. bombycis effectively develop in these lines and their growth in infected Sf9 cells have been assessed by quantitative PCR
(qPCR) analysis of P-tubulin gene copies (Huang et al., 2018a; Huang et al., 2018b; Zheng et al., 2021). At the same time, there is little information on infection of S. frugiperda-derived cell lines with bee microsporidia, except for the reports on its ineffectiveness (Gisder et al., 2011; Senderskiy et al., 2020; Senderskiy et al., 2021).
In this study, we infected Sf9 cells with N. bombycis and V. ceranae spores to estimate the effectiveness ofimmunochemical, as well as reverse transcription PCR (RT-PCR)-based methods for detection ofmicrosporidia growth. Besides, we tried to find N. bombycis and V. ceranae genes, which expression could be a specific and sensitive marker of the development of these parasites in Sf9 cells.
Material and methods
Infection of Sf9 cells with microsporidia spores
Sf9 cell line was obtained from ECACC General Collection (ECACC 89070101). Cells were maintained in Sf-900III serum-free medium (SFM) (Thermo Fisher Scientific, MA) in the adhesive culture at 27 °C without control ofhumidity and CO2 concentration. For infecting with microsporidia spores, we used cells in the mid-log phase growth with the viability of over 90%. The viability ofinsect cells was estimated in the presence of an equal volume of 0.4% Trypan Blue solution with Luna II automated cell counter (Logos Biosystems, South Korea).
N. bombycis spores were obtained from the Uzbek Research Institute of Sericulture (UzNIISh) in Tashkent, Uzbekistan. Spores were isolated from fat bodies ofexperimentally infected 5th instar B. mori caterpillars. Fat bodies were homogenized in distilled water and the homogenate was centrifuged at 600 g for 5 min. The spore pellets were washed three times in water, and additionally purified by centrifugation at the same mode in a density gradient of 50% Percoll (Merck, Germany), prepared with distilled water at 13000 g for 15 min. Before infection, 5* 105, 107 or 2.5* 107 spores were treated with 1 ml of the 0.1% antiseptic Multicide (Sante Pharm, Russia) (Tetz et al., 2017) for 30 min and washed with water as described above. To activate polar tube extrusion, washed N. bombycis spores were resuspended in 20 ^l of the 10 mM KOH (Ohshima, 1937), incubated for 30 min and added to 500 ^l of SF-900 III SFM with 5 * 105 Sf9 cells in a well of 12-well cell culture
plate. We used a 10 mM KOH solution instead of 100 mM KOH (Huang, 2018a) to reduce the effect of alkali on the culture and avoid cell lysis. Polar tube extrusion was observed within 5 min in 90% of the microsporidia spores. Infection efficiency was ensured by mixing insect cells with parasite spores on an orbital shaker at 100 rpm for 1.5 h at 27 °C till no more extrusions of polar tubes were observed in a light microscope. Infected cell cultures were either pelleted at 600 g for 5 min and frozen at —80 °C, or maintained at 27 °C for 4 or 7 days without control of humidity and CO2 concentration. In the latter case, the culture medium was supplemented with 5 ^l of the Gibco® Antibiotic-Antimycotic solution (Thermo Fisher Scientific) per a plate well to prevent accidental bacterial contamination of the infected culture.
The spores of V. ceranae for cell culture infection were obtained from artificially infected honeybees. Infected midguts of living insects were dissected and homogenized in distilled water. Centrifugation of homogenates at 600 g for 5 min was followed by washing the spore pellet with distilled water and additional purification in 50% Percoll gradient, prepared with distilled water at 13000 g for 15 min. To infect insect cells, spores were sterilized for 30 min with antiseptic Multicide (Tetz et al., 2017), washed in sterile distilled water, and dried in a well of 24-well cell culture plate for 30 min under sterile conditions. Then 2*105 Sf9 cells in 500 Щ of Sf-900 III SFM were added to 2.5x107 dried spores. Previously, a short-term drying followed by rehydration was used as an artificial trigger for extrusion of V. ceranae polar tubes (Gisder et al., 2011). In our case, we successfully stimulated their extrusion by rehydration of parasite spores in the culture medium (Senderskiy et al., 2021). After spore extrusion had been completed (1.5 h post infection), the cells were pelleted at 600 g for 5 min and frozen at —80 °C, or incubated at 27 °C for 4 days without control of humidity and CO2 concentration, as described for N. bombycis spores.
Production of Abs against N. bombycis P-tubulin
The following procedures of (1) PCR-amplifi-cation of N. bombycis P-tubulin gene with forward (5'-CAAGGATCCATGAGAGAAATTATTCA CTTACA-3') and reverse (5'-TCACTCGAGTTA ATTTCCCATATAATCCCCTTC-3') primers using the parasite genomic DNA as a template (Tokarev et al. 2018), (2) its cloning in the vector
pRSETa (Thermo Fisher Scientific) followed by heterologous expression in E. coli, and (3) production of immune serum to the recombinant protein and isolation of specific immunoglobulins (Igs) were performed according to the protocols identical to those described for production of Abs against V. ceranae ß-tubulin (Senderskiy, 2021).
Western-blot analysis of N. bombycis ß-TUBULIN IN INFECTED CELL CULTURES
Five*105 Sf9 cells infected with N. bombycis spores in ratios of 1 and 20 spores per cell were cultivated for 1.5 h, 4 days and 7 days. After cultivation, the cells were pelleted by centrifugation at 600 g for 5 min, sonicated with 50 ^l of 50 mM Tris-Cl (pH7.4) buffer solution, heated at 95 °C for 10 min with an equal volume of 2 * sample buffer (125 mM Tris-HCl, pH 6.8, 4% SDS, 10% 2-mercaptoethanol, 20% glycerol). Prepared samples (15 ^l per lane) were loaded on 12% gel for SDS-PAGE and analyzed by immunoblotting with immune serum or isolated polyclonal Abs against N. bombycis ß-tubulin diluted 1:1000 in TTBS (50 mM Tris-Cl (pH 7.4), 150 mM NaCl, 0.05% Tween-20) and the second polyclonal Abs against rabbit Igs conjugated with horseradish peroxidase (HRP) (Bio-Rad, CA) also diluted 1:1000 in TTBS, as previously described (Dolgikh et al., 2009).
RT-PCR ANALYSIS OF MICROSPORIDIA TRANSCRIPTS IN INFECTED Sf9 CULTURES
For PCR with reverse transcription, 2* 105 Sf9 cells were infected with N. bombycis in the ratio of 20 or 50 spores per cell or with V. ceranae in the ratio of 125 spores per cell. After 1.5 h, 4 days or 7 days post infection cells were pelleted by centrifugation at 600 g for 5 min and kept at — 80 °C before RNA isolation. Total RNA was isolated using Trizol reagent, DNase I, and RNA grade glycogen (all reagents were produced by Thermo Fisher Scientific) according to the manufacturer's instructions. To synthesize cDNA, 1 ^g RNA in 12.5 ^l of deionized water was mixed with 1 ^l of 20 ^M oligo-dT primers (Evrogen, Russia), denatured at 65 °C for 5 min and kept on ice before the addition of 1 ^l of deionized water, 4 ^l 5 *reverse transcriptase (RT) buffer, 0.5 ^l 25 mM dNTPs, 0.5 ^l RevertAid M-MuLV-RT (100 U) and 0.5 ^l RNAase inhibitor (2.5 U) (all reagents were produced by Thermo Fisher Scientific). In control samples, RT and RNAase inhibitor were replaced
Table 1. The list of primers used for PCR amplification of fragments or full-length copies of microsporidia V. ceranae, N. bombycis, and S. frugiperda genes.
Target gene Sequence (5'-3') NCBI ref., size (bp)
Vc beta-tubulin TTGGGCTAAGGGTCACTACACG TCActcaaaTTAATTAACGAATAAGTCTTCTGAATCT XM_024475113.1 1030 (fragment)
Vc ubiquitin hydrolase TGTaaatccATGGTTGTAAGAGCTAAAAGAATAGAA** CACaaattcTTAAATTG TTTTAGAATAAAATACCAT XM_024474448.1 894 (full gene)
Vc alpha, alpha- trehalase TGTaaatccATGCTACCCATTATTTTTATGACAGCA ACACaaattcCTATATATCAACCACACCTTCGTTATC XM 024474995.1 1872 (full gene)
Vc disulfide isomerase GTGTaaatctATGTTGTTAATATTTCTATTACACTTT ACACaaattc 1 IAGACICII IIIIIGIICI IACTTGA XM 024476079.1 1482 (full gene)
Vc proteasome beta-subunit IGlaaatccAIGIGIAI I ICCICCI I I I IAIAICI I CACaaattc I IAAI IAAGAAI IIII ICICCAGAATA XM_024476253.1 693 (full gene)
Vc alpha/beta hydrolase IGIaaatccAIG I IIII IAAAAAIAAAAAAAIAAGA CACaaattcTTAATGAAATATATTTTCTATCTCCTTCCA XM_024475802.1 948 (full gene)
Vc hexokinase IGIaaatccAIGAAC I IIIIICIGIIIIII IAIACC TCActacaaI IAAI ICAI IGIIIIII ICGGTTTCACA XM 024475587.1 1293 (full gene)
Vc proteasome alpha-subunit GTGTaaatccATGTTAGCTAGACTTTCAATACTATTC ACACaaattcTTATTTATCAGCTATAGACAAAAGTAA AC0L01000014.1 2948..3706. 759 (full gene)
Vc ruvb-like 1 DNA helicase* TCCTAAGGGATGTGGTAAAACCGCC CGATATGCACAACGTCTCCCACTT XM_002995407.1 323 (fragment)
Vc checkpoint protein kinase* TGGCTCCTGAGGTTGCAATGGAAA GTGTATCCCTGGCCACAGAACTTTCT XM_002995655.1 303 (fragment)
Vc chitin synthase* TGCGAAATGCATGGCGAGAGA GAGTTGCTTTCCAAAGGCTCGCT XM_002996666.1 278 (fragment)
Vc spore wall protein 32* AGGTAGACACTTTGGGATGCGGGA GCTGAAGGAATACCCGAGAAGCTGC XM_002996303.1 531 (fragment)
Vc polar tube protein 2* GCTTTTGTAGGATCTGTTCCCGGCA TGC IIII IAGGTGGCAACTTGGCT XM_002995446.1 269 (fragment)
Nb beta-tubulin ACGTAGGGACATCAGATAACCAAT TCActcaaaTTAATTTCCCATATAATCCCCTTC KM207664.1 1229 (fragment)
Nb spore wall protein 25 CI I ICIGIAI ICGGIGCCI IIII AGTAACCCTCTTGATCTGTATTTC EF683102.1 431 (fragment)
Nb spore wall protein 30 GGATACGTCTCAGGCGATGTT CTGCGGCTGAAAGATAGTAGAAG EF683101.1 376 Fragment)
Nb spore wall protein 32 CCTTATATCGTCCACTTTACAACC AGCGGGGCATAI IIIICIG EF683103.1 332 (fragment)
Nb polar tube protein 1 CCCGGAACAGCAGGAAATAAT GATGGCCACCGGTTGAAGATA KY636450.1 445 (fragment)
Nb polar tube protein 2 CAATAATCCAGCCGAGTGTCAA AGTGGGGTACCTTCAGCAGTTT HQ881498.1 462 (fragment)
Lepidoptera COXI subunit ATTCAACCAATCATAAAGATATTGG TAAACTTCTGGATGTCCAAAAAATCA universal primers 709 (fragment)
* - Primers were designed by Gisder and Genersch (2015).
** - Sites for restriction enzymes to clone PCR product into any plasmid are in small letters and underlined.
by 1 ^L of deionized water. The cDNA synthesis was performed at 42 °C for 1 h using S1000 Thermal Cycler (Bio-Rad, CA). The reaction mixture was heated up to 95 °C for 5 min and diluted 2.5 times with deionized water. PCR was run with the primers specific to 13 V. ceranae and 6 N. bombycis genes (Table 1) according to the following protocol: 2 ^l of diluted cDNA was mixed with 10 pmol of forward and reverse primers in 10 ^l of deionized water (the final volume) and with 10 ^l 2*DreamTaq Green PCR Master Mix (Thermo Fisher Scientific). After matrix denaturing for 3 min at 94 °C, followed by 30 cycles including denaturation (30s at 94 °C), annealing (30s at 55 °C), and synthesis (1 min at
72 °C), amplified fragments were analyzed in 1% agarose gel.
Results
Western-blot analysis of N. bombycis ß-TUBULiN ACCUMULATION IN INFECTED Sf9 CELLS SHOWED THE PROSPECT OF IMMUNOCHEMICAL METHODS TO ASSESS THE PARASITE GROWTH
Immunoblotting of Sf9 cultures infected with 20 N. bombycis spores per insect cell demonstrated that immunochemical methods with Abs specific to
Fig. 1. Western blot analysis of N. bombycis-infected Sf9 cell cultures with Abs against the parasite ß-tubulin. Specific staining of the microsporidian protein is indicated by thick arrows. Unspecific cross-reactivity of Abs with S. frugiperda ß-tubulin is pointed by thin arrows.
on 4th and 7th days post infection demonstrated that significant amount of the transcripts was present in infected cultures already in the first hours of the parasite's development (1.5 h post inoculation) (Fig. 2). Expression of N. bombycis polar tube proteins PTP1 and PTP2 started later. Even without realtime qPCR, visualization of products of cDNA amplification in agarose gel suggests a lower content of PTP1 transcripts compared to the ones of N. bombycis SWPs. In the case of the PTP2 gene, RT-PCR analysis did not reveal visible products of cDNA amplification in the samples obtained from freshly inoculated cultures 1.5 h post infection even if a ratio of infection was maximal (50 spores per insect cell). Thus, (1) the presence of N. bombycis PTP2 transcripts in infected cell cultures may only be due to their synthesis in the course of the parasite sporogenesis but not due to their release from discharged spores and sporoplasms after inoculation; (2) the expression of N. bombycis PTP2 gene may serve as a specific marker of the microsporidia intracellular growth.
parasite proteins like ß-tubulins may be applied to assess microsporidia growth in this line. The protein band corresponding to N. bombycis ß-tubulin became well detectable 4 days after the infection and was maximal at the 7th day of the parasite propagation (Fig. 1, indicated by a thick arrow). In the case of ratio of infection 1 spore per cell, N. bombycis ß-tubulin band appeared only 7 days post infection being still hardly visible. In the control uninfected cells, the parasite protein was absent. Both immune serum and purified Abs also stained the protein band corresponding to the S. frugiperda ß-tubulin (Fig. 1, indicated by a thin arrow). Since the insect and microsporidia proteins have more than 70% identity, such cross-reactivity was expected. The staining of this band was less intense compared to the parasite ß-tubulin and did not depend on a ratio of infection. The staining of samples was more specific in the case of purified Abs than in the case of immune serum (Fig. 1).
RT-PCR ANALYSIS OF TRANSCRIPTS ENCODING N. bombycis SPORE WALL AND POLAR TUBE PROTEINS SUGGESTED A SPECIFIC MARKER OF THE PARASITE GROWTH IN INFECTED Sf9 CELLS
Infection of Sf9 cells by N. bombycis spores in ratios of 20 and 50 per insect cell followed by RT-PCR analysis of mRNA-transcripts of three spore wall proteins SWP25, SWP30, SWP32 at 1.5 h and
RT-PCR ANALYSIS OF TRANSCRIPTS ENCODING 13 V. ceranae PROTEINS REVEALED A SENSITIVE AND SPECIFIC MARKER OF THE GROWTH OF THIS BEE PATHOGEN IN
Sf9 CELLS
To find a specific and particularly sensitive marker of inefficient V. ceranae growth in infected Sf9 cultures, we analyzed the expression of 13 parasite genes by RT-PCR at 1.5 h and on 4th days post spore inoculation. Even though all used primer pairs (Table 1) amplified the PCR products of the appropriate predicted sizes when the parasite geno-mic DNA was used as a template (Fig. 3), we did not find a detectable expression of six genes encoding the following V. ceranae proteins: ubiquitin hydrolase, a,a-trehalase, a- and p- proteasome subunits, a/p-hydrolase, and hexokinase, although these proteins could be potentially involved in micro-sporidia-host relationships. Among five genes suggested by Gisder and Genersch for V. ceranae growth detection in infected IPL-LD-65Y cells of the gypsy moth Lymantria dispar (Gisder and Genersch, 2015), the transcripts encoding spore wall protein SWP32 demonstrated the most effective and specific amplification (Fig. 3, indicated by a thick arrow). The expression of the PTP2 gene was also well detectable (Fig. 3, indicated by a thin arrow); however, it was accompanied by unspecific amplification of an additional 400 bp band in the samples prepared 1.5 h and 4 days post infection.
Fig. 2. Analysis of transcripts encoding N. bombycis spore wall, polar tube proteins, and P-tubulin in infected Sf9 cells by RT-PCR. The predicted sizes of amplified fragments are indicated in parentheses.
The expression of V. ceranaehelicase, a checkpoint protein kinase, and chitin synthase genes was lower compared to the spore wall and polar tube proteins. Besides, both helicase and checkpoint protein kinase genes encoding "housekeeping" proteins showed the presence of mRNA transcripts in freshly infected cell cultures and could not serve as the specific markers of microsporidia growth. The same may be concluded about V. ceranae P-tubulin gene because its transcripts were also present in cell cultures 1.5 h post infection. As expected, the gene encoding subunit I of S. frugiperda mitochondrial cytochrome c oxidase, which we used to control the quality of RNA isolation and cDNA synthesis, showed similar expression at 1.5 h and 4 days post infection. Thus, the high content of the SWP32 mRNA-transcripts 4 days post infection, their absence in freshly inoculated cultures, and specificity of PCR-amplification suggested that expression of this gene may serve as a specific and sensitive marker of the V. ceranae growth in Sf9 cells.
Discussion
The silkworm pathogen N. bombycis effectively infects S. frugiperda-derived cell lines, and at least three publications demonstrated that real-time qPCR analysis of the parasite ß-tubulin gene copies in isolated genomic DNA may be used to assay its growth after inoculation of Sf9 cultures with 1 (Huang et al., 2018a) or 5 (Huang et al., 2018b; Zheng et al., 2021) spores per insect cell, although in two identical experiments this approach showed different results. In the first study of Sf9 cultures
Fig. 3. RT-PCR analysis of transcripts of 13 V. ceranae genes in two independently infected Sf9 cell cultures (A, B). The predicted sizes ofamplified full-size genes and fragments are indicated in parentheses. The most highly expressed genes SWP32 and PTP2 are marked with thick and thin arrows, respectively. SWP32 - spore wall protein 32; PTP2 - polar tube protein 2, ch p kin - checkpoint protein kinase; ch synt - chitin synthase; Lep COXI - subunit I of S. frugiperda mitochondrial cytochrome c oxidase. In the case of lanes DNA (A), genomic DNA was used as a template for PCR.
expressing the control eGFP-dsRNA and infected with 5 spores per insect cell, the number of copies of the P-tubulin gene increased on the 5th day after infection relative to the 3rd day by approximately 1.7 times (Huang et al., 2018b). In the recent study ofthe same research team, in the same Sf9 cells expressing the same control eGFP-dsRNA and infected at the same ratio ofinfection 5, the number of copies ofthe P-tubulin gene on the 3rd and 5th days post infection differed by 10 times (Zheng et al., 2021).
The drawback of PCR analysis of genomic copies of microsporidia genes in infected cultures is their contamination with DNA of discharged spores. For the correct estimation of microsporidia
intracellular growth, such an approach requires the start point analysis followed by subtracting these values from the ones determined at the later points. The search for the genes expressed at the later stages of the parasite development whose mRNA transcripts are absent in the inoculum used to infect cell cultures is an alternative to the genomic DNA analysis. Infecting of the gypsy moth Lymantria dispar IPL-LD 65Y cell line (Goodwin et al., 1978) by V. ceranae spores demonstrated that, in contrast to housekeeping proteins and even chitin synthase, spore wall and polar tube components are necessary for the parasite spore formation at the late stages of the parasite intracellular development. Therefore, their genes start expression only 30 hours post infection (Gisder and Genersch, 2015).
The lepidopteran IPL-LD 65Y cells heterologous for the bee microsporidia were chosen as a model due to the lack of continuous hymenopteran cell lines (Gisder et al., 2011). Although the authors reported in the same paper that five other lepidopteran lines (including Sf9 cells) were susceptible to V. ceranae infection, they noted that only IPL-LD-65Y cells might be infected reproducibly with the microsporidia spores. This result and high ratio of infection (250 spores per cell), used in this study to inoculate the IPL-LD-65Y line (Gisder et al., 2011), demonstrated that bee pathogens infect lepidopte-ran cultures not very effectively. Previously, we raised Abs against V. ceranae ß-tubulin over-expressed in bacteria E. coli, and used immunofluorescent microscopy to demonstrate a low rate (about 1%) of infection of Sf9 cultures with V. ceranae when 200 spores per 1 cell were added (Senderskiy et al., 2021). In the current work, we observed that transcripts of many V. ceranae genes were not detected in the infected Sf9 cultures using RT-PCR. However, as in the case of IPL-LD-65Y line infection (Gisder and Genersch, 2015), V. ceranae gene encoding spore wall protein SWP32 was specifically expressed in the late stages ofthe parasite intracellular development, and the presence of its transcripts can serve as a sensitive marker ofmicrosporidia growth in Sf9 cells. Interestingly, in contrast to V. ceranae SWP32, all three investigated genes encoding N. bombycis spore wall proteins SWP25, SWP30, and SWP32, showed the presence of significant amounts of mRNA-transcripts in freshly inoculated Sf9 cultures.
Another approach to analyzing N. bombycis intracellular growth in Sf9 and other lepidopteran cell lines may be based on immunodetection of some parasite proteins in infected cultures using specific Abs. Since Abs against N. bombycis ß-tubulin
were previously applied for immunofluorescence microscopy of the parasite intracellular stages in infected silkworm B. mori BmE cells (Chen et al., 2017), we tried to verify whether polyclonal Abs against this protein may be used for Western-blot analysis of N. bombycis growth in infected Sf9 cultures. The successful detection of N. bombycis development in infected cultures by immunoblot-ting with anti-ß-tubulin Abs and high intensity of the parasite protein staining, even with low sensitivity colorimetric (not chemiluminescent) HRP substrate, suggested that immunochemical approaches could be successfully used to analyze the microsporidia growth in Sf9 cells. Such quantitative or semiquantitative approaches for the parasite growth analysis may be based on ELISA (enzyme-linked immunosorbent assay) or Western blotting combined with digital image analysis (Janes, 2015). The problem of cross-reactivity of anti-ß-tubulin Abs may be solved by constructing a chimeric protein, carrying only the parasite-specific peptides, or by searching for another N. bombycis protein suitable for production of diagnostic Abs.
Thus, a comparison of different methods to assay microsporidia growth in infected cell cultures suggests that the most sensitive one is the PCR-based analysis of transcripts highly and specifically expressed during intracellular development of parasites. It is sensitive enough to detect intracellular growth of V. ceranae that weekly infects Sf9 cells. In the case of the silkworm pathogen N. bombycis, which effectively develops in this cell line, intra-cellular development may be assayed by different methods based on the use of PCR, RT-PCR, or Abs specific to the parasite proteins. Further investigations should compare these methods and find an optimal approach that would allow tracking microsporidia development in cultured cell lines.
Acknowledgments
The work was supported by the Russian Science Foundation, project no. 18-16-00054.
References
Arunkarthick S., Asokan R., Aravintharaj R., Niveditha M. and Krishna Kumar N.K. 2017. A review of insect cell culture: establishment, maintenance and applications in entomological research. J. Entomol. Sci. 52: 261—273. https://doi. org/10.18474/JES17-02PT.1
Bailey L. 1953. Effect of fumagillin upon Nosema apis (Zander). Nature. 171: 212—213.
Chen J., Guo W., Dang X., Huang Y. et al. 2017. Easy labeling of proliferative phase and sporogonic phase ofmicrosporidia Nosema bombycis in host cells. PloS ONE. 12: e0179618. https://doi. org/10.1371/journal.pone.0179618
Dolgikh V.V., Seliverstova E.V., Naumov A.M., Senderskiy I.V., Pavlova O.A. and Beznoussenko G.V. 2009. Heterologous expression of pyruvate dehydrogenase E1 subunits of the microsporidium Paranosema (Antonospora) locustae and immuno-localization of the mitochondrial protein in amitochondrial cells. FEMS Microbiol. Lett. 293: 285291. https://doi.org/10.1111/j.1574-6968.2009. 01545.x
Dolgikh V.V., Timofeev S.A., Zhuravlyov V.S. and Senderskiy I.V. 2020. Construction and heterologous overexpression oftwo chimeric proteins carrying outer hydrophilic loops of Vairimorpha ceranae and Nosema bombycis ATP/ADP carriers. J. Invertebr. Pathol. 171: 107337. https://doi.org/10. 1016/j.jip.2020.107337
Dong Z., Wu Q., Long J., Lu B. et al. 2021. Silver nanoparticles are effective in controlling microsporidia. Mater. Sci. Eng. C. 125: 112106. https://doi.org/10.1016/j.msec.2021.112106
Fries I. 2010. Nosema ceranae in European honey bees (Apis mellifera). J. Invertebr. Pathol. 103: S73-S79. https://doi.org/10.1016/jjip.2009.06.017 Fries I., Feng F., Silva A.D., Slemenda S.B. and Pieniazek N.J. 1996. Nosema ceranae n. sp. (Microspora, Nosematidae), morphological and molecular characterization of a microsporidian parasite of the Asian honey bee Apis cerana (Hyme-noptera, Apidae). Europ. J. Protistol. 32: 356-365. https://doi.org/10.1016/S0932-4739(96)80059-9
Gisder S. and Genersch E. 2015. Identification of candidate agents active against N. ceranae infection in honey bees: establishment of a medium throughput screening assay based on N. ceranae infected cultured cells. PLoS One. 10: e0117200. https://doi.org/10.1371/journal.pone.0117200
Gisder S., Möckel N., Linde A. and Genersch E. 2011. A cell culture model for Nosema ceranae and Nosema apis allows new insights into the life cycle of these important honey bee-pathogenic microsporidia. Environ. Microbiol. 13: 404-413. https://doi.org/10.1111/j.1462-2920.2010.02346.x Goodwin R.H., Tompkins G.J. and McCawley P. 1978. Gypsy moth cell lines divergent in viral susceptibility. In Vitro. 14: 485-494.
He N., Zhang Y., Duan X.L., Li J.H. et al. 2021. RNA interference-mediated knockdown of genes encoding spore wall proteins confers protection against Nosema ceranae infection in the European honey bee, Apis mellifera. Microorganisms. 9: 505. https://doi.org/10.3390/microorganisms9030505
Holt H.L. and Grozinger C.M. 2016. Approaches and challenges to managing Nosema (Microspora: Nosematidae) parasites in honey bee (Hymenoptera: Apidae) colonies. J. Econ. Entomol. 109: 1487— 1503. https://doi.org/10.1093/jee/tow103
Huang Q., Chen Y., Neumann P. and Evans J.D. 2016. Effective silencing of dicer decreases spore load of the honey bee parasite Nosema ceranae. Fungal Genomics Biol. 6, 1—4. https://doi.org/10. 4172/2165-8056.1000144
Huang Y., Chen J., Sun B., Zheng R. et al. 2018a. Engineered resistance to Nosema bombycis by in vitro expression of a single-chain antibody in Sf9-III cells. PLoS One. 13: e0193065. https://doi. org/10.1371/journal.pone.0193065
Huang Y., Zheng S., Mei X., Yu B. et al. 2018b. A secretory hexokinase plays an active role in the proliferation of Nosema bombycis. Peer J. 6, e5658. https://doi.org/10.7717/peerj.5658
Hukuhara T. 2017. The epizootiology ofpebrine, one of the great scourges of sericulture. J. Biochem. Biotech. 1: 1-3. https://doi.org/10.35841/Bioche-mistry-Biotechnology.1000102
Janes K.A. 2015. An analysis of critical factors for quantitative immunoblotting. Sci Signal. 8: rs2. https://doi.org/10.1126/scisignal.2005966
Katznelson H. and Jamieson C.A. 1952. Control of Nosema disease of honeybees with fumagillin. Science. 115: 70-71.
Martín-Hernández R., Bartolomé C., Chejano-vsky N., Le Conte Y. et al. 2018. Nosema ceranae in Apis mellifera: a 12 years postdetection perspective. Environ. Microbiol. 20, 1302-1329. https://doi.org/ 10.1111/1462-2920.14103
Ohshima K. 1937. On the function of the polar filament of Nosema bombycis. Parasitology. 29: 220-224.
Paldi N., Glick E., Oliva M., Zilberberg Y. et al. 2010. Effective gene silencing in a microsporidian parasite associated with honeybee (Apis mellifera) colony declines. Appl. Environ. Microbiol. 76: 5960-5964. https://doi.org/10.1128/AEM.01067-10
Rodríguez-García C., Evans J.D., Li W., Bran-chiccela B. et al. 2018. Nosemosis control in European honey bees, Apis mellifera, by silencing
the gene encoding Nosema ceranae polar tube protein 3. J. Exp. Biol. 221: jeb184606. https://doi. org/10.1242/jeb.184606
Saleh M., Kumar G., Abdel-Baki A.A., Sa-leh A.Q. and El-Matbouli M. 2016. In vitro anti-microsporidial activity ofgold nanoparticles against Heterosporissaurida. BMC Vet. Res. 12: 44. https:// doi.org/10.1186/s12917-016-0668-x
Senderskiy I., Ignatieva A. and Dolgikh V. 2020. Vairimorpha (Nosema) ceranae (Opisthosporidia: Microsporidia) in vitro infection of Sf9 insect cell line as an experimental model of parasite—host interrelations. BIO Web of Conferences 18: 00026 (2020) IV All-Russian Plant Protection Congress. https://doi.org/10.1051/bioconf/20201800026
Senderskiy I.V., Ignatieva A.N., Kireeva D.S. and Dolgikh V.V. 2021. Polyclonal anti-ß-tubulin antibodies production and immunodetection of Vairimorpha (Nosema) ceranae (Opisthosporidia: Microsporidia) proliferative stages in the midguts of Apis mellifera and in the Sf9 cell culture. Protistology. 15: 3-9. https://doi.org/10.21685/1680-0826-2021 -15-1-1
Senderskiy I.V., Timofeev S.A., Seliverstova E.V., Pavlova O.A. and Dolgikh V.V. 2014. Secretion of Antonospora (Paranosema) locustae proteins into infected cells suggests an active role of microsporidia in the control of host programs and metabolic processes. PLoS One. 9: e93585.
Tetz G.V., Artemenko N.K., Yankovskii G.M., Kever L.V.et al. 2017. Effects of multicide, antibacterial drug, on Staphylococcus biomembranes. Bull. Exp. Biol. Med. 163: 780-784. https://doi.org/10. 1007/s10517-017-3902-z
Timofeev S.A., Senderskiy I.V., Tsarev A.A., Tokarev Y.S. and Dolgikh V.V. 2017. Heterologous
expression of Paranosema (Antonospora) locustae hexokinase in lepidopteran, Sf9, cells is followed by accumulation of the microsporidian protein in insect cell nuclei. J. Invertebr. Pathol. 143, 104-107. https://doi.org/10.1016/jjip.2016.12.002. Epub 2016 Dec 16.
Tokarev Y.S., Timofeev S.A., Malysh J.M., Tsarev A.A.et al. 2018. Hexokinase as a versatile molecular genetic marker for microsporidia. Para-sitology. 15: 1-7. https://doi.org/10.1017/S003118 2018001737
Tsarev A.A., Senderskiy I.V., Timofeev S.A., Zhuravlyov V.S. and Dolgikh V.V. 2019. Recombinant single chain antibodies as an instrument to search proteins involved in interaction of microsporidia and other intracellular parasites with infected host cell. Protistology. 13: 5-13. https://doi.org/ 10.21685/1680-0826-2019-13-1-1
van den Heever J.P., Thompson T.S., Curtis J.M., Ibrahim A. and Pernal S.F. 2014. Fumagillin: an overview of recent scientific advances and their significance for apiculture. J. Agric. Food Chem. 62: 2728-2737. https://doi.org/10.1021/jf4055374 Williams G.R., Sampson M.A., Shutler D. and Rogers R.E. 2008. Does fumagillin control the recently detected invasive parasite Nosema ceranae in western honey bees (Apis mellifera)? J. Invertebr. Pathol. 99: 342-344. https://doi.org/10.1016/jjip. 2008.04.005
Zheng S., Huang Y., Huang H., Yu B. et al. 2021. The role of NbTMP1, a surface protein of sporoplasm, in Nosema bombycis infection. Parasit. Vectors. 14: 81. https://doi.org/10.1186/s13071-021-04595-8
