CC BY
28OECD+WoS: 1.06+IY (Entomology) https://doi.org/10.31993/2308-6459-2022-105-1-15260
Full-text article
MOLECULAR DETECTION OF ENDOSYMBIONTS IN LOCAL POPULATIONS OF HELICOVERPAARMIGERA (LEPIDOPTERA: NOCTUIDAE) IN EUROPEAN PART OF RUSSIA
A.G. Kononchuk*, S.M. Malysh, A.S. Rumiantseva, D.S. Kireeva, A.V. Gerus, V.S. Zhuravlyov
All-Russian Institute of Plant Protection, St. Petersburg, Russia
*corresponding author, e-mail: akononchuk@vizr.spb.ru
Cotton bollworm Helicoverpa armigera is one of the most polyphagous and cosmopolitan pests. Intracellular endosymbionts are widespread in Lepidoptera, often playing an important role in their dynamics. The prevalence of endosymbionts of cotton bollworm in Russia was not investigated. Cotton bollworm larvae and adults were collected in 2018-2020 in Krasnodar Area, and in Voronezh and Saratov Regions (from 131 to 170 insects) and analyzed by PCR using sets of group-specific primers for baculoviruses (locus lef8), bacteria of the genus of Wolbachia (locus wsp), and microsporidia (locus SSU rRNA). Level of infection with baculoviruses was 16 % for the sample of 32 individuals collected in Temryuk District of Krasnodar Area in 2018. The infection rate of the entire sample of 170 individuals was 2.9 %. The lef8 locus demonstrated 98.7-99.6 % of sequence similarity to the nuclear polyhedrosis virus isolates from the cotton bollworm and American bollworm. Among the tested 131 insects, bacteria of the genus of Wolbachia were not detected. PCR screening for microsporidia revealed one positive larvae among 19 insects collected in Krasnoarmeysk District of Krasnodar Area in 2019, which corresponded to the prevalence of 5 %. Partial sequencing of the genes coding for SSU rRNA and largest subunit RNA polymerase II made it possible to identify the new isolate as N. bombycis.
Keywords: obligate intracellular parasites, entomopathogenic microorganisms, pests lepidoptera, natural infection, nuclear polyhedrosis virus, Microsporidia, Wolbachia, Nosema bombycis
Submitted: 10.02.2022 Accepted: 07.04.2022
Introduction
Cotton bollworm Helicoverpa armigera (Noctuoidea: Noctuidae) is among the most polyphagous and cosmopolitan pests (Cunningham, Zalucki 2014; Gomes et al., 2017). This is a multivoltine species characterized by high ecological plasticity, which allows the insect to adapt easily to changing environmental conditions and reach a high abundance (Chenkin et al., 1990; Farrow, Daly, 1987; Jones et al., 2018). The cotton bollworm is one of the most dangerous agricultural pests in Russia and other countries of Europe, Asia, Africa, Australia etc. (Fitt, 1989; Tay et al., 2013; Arnemann et al., 2016; Murua et al., 2014; Czepak et al., 2013). According to different sources, the number of plant species damaged by this pest ranges between 120 and 180 species (Singh et al., 2002; Wu et al., 2008; Murua et al., 2014). The most preferred crops are cotton, tomatoes, cereals, such as corn and sorghum, as well as soybean, chickpea and other legumes (Riaz et al., 2021). The annual global cost of controlling this pest, together with crop losses, is estimated at US$5 billion (Murua et al., 2014; Haile et al., 2021). Intensive and sometimes unreasonable use of broad-spectrum synthetic pesticides reduces the effectiveness of natural enemies and biocontrol agents, while the target pest species develop resistance to a wide range of insecticides (Armes et al., 1996; Ahmed et al., 2004; Yang et al., 2013). Solving these problems requires improvement of the synthetic pesticides range and their rational use to preserve the natural enemies of H. armigera in different agroecosystems (Mohan et al., 2008; Williams et al., 2022), as well as development of alternative, environmentally friendly approaches to population management (Binod et al., 2007; Yu et al., 2008; Patil, Jadhav, 2015; Suryanarayanan et al., 2016; Knox et al., 2016; Kolosov et al., 2017; Agasieva et al., 2019). To understand the main patterns of population dynamics, improve forecasting systems
and identify new forms of potential sources of microbiological formulations, it is necessary to perform screening of the pest populations aimed at identification of pathogenic microorganisms of the main groups.
Among the obligate intracellular symbionts, which are the most widespread and frequently found in insects, three groups deserve attention in the first place.
The first group includes the nuclear polyhedrosis (NPV) and granulosis viruses from the Baculoviridae family of double-stranded DNA viruses that infect insects from the orders of Lepidoptera, Hymenoptera, and Diptera (Van Regenmortel et al., 2000). They serve as the basis of microbial formulations against Lepidoptera pests, including the cotton bollworm, which are widely used worldwide (Chen et al., 2000; Shapiro et al., 2002; Yu et al., 2015; Kolosov et al., 2017; Eroglu et al., 2019). NPV populations can grow rapidly, increasing it number at billion-fold rate per insect. Up to three such viral "generations" can be multiplied in one generation of insects (Harper, 1987), which provides in vivo large-scale propagation of baculoviruses and makes them the promising agents for biological plant protection (Eroglu et al., 2018). Despite the isolation of numerous NPV strains from the cotton bollworm in various parts of the world and studies of their genetic polymorphism and effectiveness in terms of combating this pest (Leslie Hayes, Bell, 1994; Moscardi, 1999; Erlandson, 2009; Baillie, Bouwer, 2012, Arrizubieta et al., 2014; Ardisson-Araujo et al., 2015), assessment of natural prevalence levels is usually not carried out. Specific data on the levels of natural infection of cotton bollworm populations are missing. For other members of the Noctuidae family, there are data on the prevalence of nuclear polyhedrosis virus for Spodoptera frugiperda in Louisiana, where the virus prevalence ranged
from 50 to 68 %, being higher than that of the other pathogens (Fuxa, 1982). In other works, the level of occurrence of NPV in lepidopteran was estimated after artificial introductions of viral particles, which did not allow estimating the natural prevalence rates (Fuxa and Richter, 1999; Cherry et al, 2000).
The second group, bacteria of the genus Wolbachia, belong to widespread endosymbionts of arthropods (Bouchon et al., 1998), and infect according to various estimates, from 40 to 65 % of the arthropod species (Hilgenboecker et al., 2008; Werren et al., 2008; Zug, Hammerstein 2012). The effects of Wolbachia on insects including Lepidoptera, are very diverse (Hiroki et al., 2004; Charlat et al., 2006, 2007; Narita et al., 2007; Graham, Wilson, 2012; Salunkhe et al., 2014; Arai et al., 2019), and the study of these bacteria is of interest both from theoretical and practical points of view. The prevalence of Wolbachia in lepidopteran populations varies from almost complete absence to 100 % infection (Tagami, Miura, 2004; Salunke et al., 2012; Ahmed et al., 2015; Solovyev et al., 2015; Ilinsky, Kosterin, 2017; Tokarev et al., 2017; Bykov et al., 2020). For example, in Dendrolimus superans, a high level of infection with Wolbachia (69-100 %) has been shown to be maintained in geographically distant populations for several years (Bykov et al., 2020). For Aporia crataegi, the frequency of Wolbachia occurrence was very low: out of 376 samples collected in 10 regions of Russia, only eight Wolbachia-positive insects were found in Yakutia, Buryatia, Sverdlovsk and Kaliningrad Regions (Bykov et al., 2021). In Loxostege sticticalis, the prevalence of Wolbachia varied from 21 to 40 % in Asian and from 0 to 47 % in European parts of Russia (Malysh et al., 2020). Analysis of the sample of 257 individuals for the presence of Wolbachia in Hypolimnas bolina females collected from the wild habitat showed that 99 % of the females were infected (Dyson, Hurst, 2004). The presence of endosymbiotic bacteria of the genus of Wolbachia was also found in populations of stem borers of the genus Ostrinia. In various geographic populations, endosymbiont prevalence ranged from 2.9 (N=34) to 65.8 % (N=38), with three of the four habitats showing a significantly higher level of infection for O. scapulalis as compared to O. nubilalis (Tokarev et al., 2017). Pieris rapae in Japan was infected with Wolbachia with the prevalence of 0-3 % (Tagami, Miura, 2004). In addition, in the Japanese populations of the gypsy moth (Lymantria dispar japonica and L. postalba), the presence of Wolbachia was not revealed (Ilinsky et al, 2017).
The third group is the microsporidia, parasitic protists related to fungi. They parasitize the representatives of all
major taxa of Animalia kingdom, including higher vertebrates and humans (Issi, 2020). The largest number of microsporidia was found in arthropods (Wittner, 1999), and many species are highly pathogenic to these hosts and significantly affect their populations. Interest in the study of microsporidia has notably increased recently due to the understanding of their role as dangerous pathogens of humans and economically significant species of vertebrates and invertebrates. They are also widely exploited as a model of intracellular parasites demonstrating the maximum level of genome and cell minimization (Wittner, 1999; Becnel, Andreadis, 2014). The role of infection with microsporidia in the host density dynamics has been studied well for several lepidopterans (Issi, 1986; Frolov et al., 2008; Lipa, Madziara-Borusiewicz, 1976; Zelinskaya, 1980; Solter et al., 1997; 2010; Van Frankenhuyzen et al., 2007; Kermani et al., 2013; Simoes et al., 2015; Hopper et al., 2016; Malysh et al., 2021). In particular, in the stem borers of the genus of Ostrinia, the levels of microsporidia infection in Russia ranged from 3.0 to 17.2 % in 2005-2010 (Malysh et al., 2011) and from 0 to 16 % in 2011-2016 (Grushevaya et al., 2018). PCR analysis of 98 individuals of L. sticticalis for the presence of microsporidia was positive for 7 %> of the samples (Malysh et al., 2019). The prevalence of microsporidiosis in Bombyx mori in India was about 15-20 % (Bhat et al., 2009). In Archips xylosteana in Bulgaria, the prevalence of microsporidiosis was 3 % for the sample of 791 individuals (Pilarska, 2017). In Japanese populations of Lymantria spp., microsporidia infection was not detected (Ilinsky et al, 2017), although they are known in European and North American populations (McManus, Solter, 2003). In the susceptibility bioassays of the cotton bollworm, isolates of microsporidia from different hosts were exploited. However, when spotting microsporidia infections of the cotton bollworm under natural conditions, the frequency data were not indicated (Issi, Nilova, 1967; Gaugler, Brooks, 1975; Lee, Anstee, 1992; Mitchell, Cali, 1994; Rabindra, Jayaraj, 1994; Pei et al., 2021).
Studies of natural infections by viruses and microorganisms in populations of this pest in the Former Soviet Union Countries in the 21st century are restricted to the detection of new isolates of baculoviruses, most of which were done using laboratory-maintained insect cultures of Central Asian origin (Kolosov et al., 2017). The aim of this work was to assess the natural occurrence of baculoviruses, Wolbachia spp. and microsporidia in local populations of the cotton bollworm in the European part of Russia using molecular markers.
Materials and methods
To detect the presence of entomopathogens in cotton bollworm populations, H. armigera larvae were collected in maize stands in five localities of Krasnodar Area, Voronezh and Saratov Regions, and adults were caught on the pheromone trap at one point, Gulkevichi Region of Krasnodar Area in 2019 (Fig. 1). The total amount of collected material was 170 individuals. Insects were stored either dry at room temperature without preservatives or in 90 % ethanol. Total DNA was extracted using a simplified protocol of Sambrook et al. (1989) without addition of phenol, with adjustments in the volumes of DNA washing agents (Malysh et al., 2019). Samples were homogenized in 100 ^l of CTAB (Cetyl Trimethyl Ammonium Bromide). Then, 500 ^l of CTAB + ß-mercaptoethanol (final
concentration 0.2 %) were added and incubated at a +65 °C for 2 hours, consequently washed with a mixture of chloroform and isoamyl alcohol (24:1), precipitated with ethanol and resuspended in 50 ^l of ultra-purified water. The DNA solution was used for PCR analysis. The PCR mix consisted of 4 ^l of DNA, 5 ^l of DreamTaq Green PCR Master Mix, and 0.5 ^l of primers (forward and reverse). For the analysis, only half of each individual sample was used, saving the other half for further analysis in case the microsporidia spores are detected.
The DNA quality of individual samples was checked by PCR with LepF1:LepR1 primers flanking the Metazoa mitochondrial DNA fragment (Hebert et al., 2004). Testing for the presence of Wolbachia, as well as baculoviral
and microsporidian infections, was carried out by PCR amplification with the following primer sets (Table 1):
- to determine the presence of baculoviruses, primers L8F2:L8R2 were used, flanking the conservative region of the late elongation factor gene (lef8). As a reference (positive control), we used DNA samples of the cotton bollworm nuclear polyhedrosis virus, isolate HS-18 (kindly provided by Kolosov A.V, FBSI SRC VB "Vector" of Rospotrebnadzor);
- to determine the presence of microsporidia, standard primers 18f:1047r were used, to amplify part of the small subunit rRNA gene (SSU rRNA). The positive control was
the DNA sample of microsporidia Nosema pyrausta from the corn borer (kindly provided by I.V. Grushevaya, All-Russian Institute of Plant Protection). For more accurate identification, primers nvRPb f1 were used: nvRPB r1 to the gene fragment of the large subunit of RNA polymerase II (rpbl);
- the analyses for the presence of Wolbachia, were carried out by amplification with the wsp81F:wsp691 primer set specific for the Wolbachia surface protein (wsp) locus. Wolbachia DNA samples from the corn borer (kindly provided by I.V. Grushevaya) were used as a positive control.
Table 1. Primers used for detection of endosymbionts of cotton bollworm Helicoverpa armigera Таблица 1. Праймеры, используемые для диагностики эндосимбионтов хлопковой совки Helicoverpa armigera
Primer name Название праймера 5'-3' Primer sequence 5'-3'последовательность праймера Target, amplicon size Цель, размер ампли-кона Reference Ссылка
L8F2 GTAAAACGACGGCCAGTNNNACNRCNGARGAYCC Baculovirus late elongation factor, ~500 bp Herniou et al., 2004
L8R2 AACAGCTATGACCATGMMNCCYTTYTGNCCRTG Herniou et al., 2004
wsp 81F TGGTCCAATAAGTGATGAAGAAAC Wolbachia surface protein, ~600 bp Zhou et al., 1998
wsp 691R AAAAATTAAACGCTACTCCA Zhou et al., 1998
18f GTTGATTCTGCCTGACG Microsporidia small subunit rRNA, ~900 bp Weiss, Vossbrinck, 1999
1047r AACGGCCATGCACAC Weiss, Vossbrinck, 1999
nvRPB1F1 CCWATGTTYCATGTYGGTTA' RNA polymerase II largest subunit, ~700 bp Tokarev et al., 2019
nvRPB1R1 TAATTACAGACCTGGCACT
The amplification program was the same for all primers: initial denaturation at 95 °C for 5 min, 35 cycles of denaturation at 95 °C for 1 min, annealing at 54 °C for 1 min, elongation at 72 °C for 1 min, and final elongation step of 72 °C for 5 min.
The amplicons were visualized using electrophoresis in 1 % agarose gels with GeneRuler Ladder Mix molecular weight marker, 75-20000 bp (Thermo Fisher Scientific). Amplicons in the gel of about 500 bp (primers L8F2:L8R2), 600 bp (wsp81F:wsp691), 900 bp (18f:1047r) and 700 bp (nvRPB1F1:nvRPB1F1) were excised with a scalpel and frozen until further purification. The cut sections of the gel were melted in a 3 M solution of guanidine isothiocyanate, and the amplicons were purified by the silica sorption method (Vogelstein, Gillepsie, 1979). The purified amplicons were sequenced at the Core Centrum «Genomic Technologies,
Proteomics and Cell Biology» of the All-Russian Institute of Agricultural Microbiology in both directions by a standard method of chain termination (Sanger et al., 1977) using an ABI Prism 3500 genetic analyzer. The obtained sequencing chromatograms were analyzed using the BioEdit software (Hall, 1999). The search for homologous sequences in GenBank was performed on the NCBI server using the built-in BLAST utility using the megablast and blast algorithms (Altschul et al., 1990).
To compare the morphometric characteristics of microsporidian spores, the length and width of at least 10 spores of the new isolate from the cotton bollworm were measured, and compared to the N. bombycis spores from the silkworm culture at the Research Institute of Sericulture (Tashkent, Uzbekistan), kindly provided by I.V. Senderskiy (All-Russian Institute of Plant Protection).
Results
The quality of DNA samples was confirmed by amplification of the DNA fragment of insects with primers LepF1:LepR1. In the most of samples, no positive signals or nonspecific reactions with non-target DNA were observed while diagnosing endosymbionts with corresponding primers. However, a few sequences of amplicons of the expected size amplified with baculovirus- and Wolbachia-specific primers, matched DNA fragments of the host insect or intestinal bacteria and were excluded from the study.
In particular, a number of amplicons positive reaction for baculoviruses was registered in 5 out of 32 samples from one sample of Temryuk District of Krasnodar Area in 2018. This corresponds to 16 % prevalence, and to 2.9 % if to consider the entire sample of 170 tested insects (Table 2).
Amplified fragments of the lef8 gene were sequenced. The obtained sequences demonstrated high levels of identity
with homologous regions of genomes of numerous viral isolates designated in GenBank as cotton bollworm nuclear polyhedrosis viruses (NPVs) (Helicoverpa armigera nucleopolyhedrovirus, HearNPV) or the American cotton bollworm NPVs (Helicoverpa zea nucleopolyhedrovirus, HzNPV). Both isolates derive from various representatives of closely related species of the Heliothis/Helicoverpa complex, and from Hybleapuera (Hyblaeoidea: Hyblaeidae). Alignment of 380 nucleotides showed 100 % identity of HS-18 strain used as standard in this study (1) with the corresponding fragment of the whole genome sequence deposited earlier for this strain in GenBank (accession # KJ004000) and (2) with some other HzNPV isolates (# KM596835) and (4) HearNPV (# KU738904 and # KJ922128). Isolates from Temryuk identified in this work contained two A/G transitions, one of which was not found in other isolates (Table 3). The similarity of
Figure 1. Sampling sites of Helicoverpa armigera larvae and adults in Temryuk (1), Slavyansk (2), Krasnoarmeysk (3), and Gulkevichi Districts (4) of Krasnodar Area, Ramon District of Voronezh Region (5), Engels District of Saratov Region (6) Рисунок 1. Места отборов проб гусениц и имаго Helicoverpa armigera в Темрюкском (1), Славянском (2), Красноармейском (3) и Гулькевичском (4) районах Краснодарского края, Рамонском районе Воронежской области (5)
и Энгельском районе Саратовской области (6)
the Temryuk isolates to the HzNPV and HearNPV sequences from GenBank, was 98.7-99.6 % (Table 4). To understand the genetic differentiation of HzNPV and HearNPV at the genome level, a BLAST analysis of the whole genome sequence of HS-18 was additionally performed, which showed a similarity of >99.9 % with HzNPV and >99.6 % with HearNPV (Table 5).
For assessing the prevalence of bacteria of the genus of Wolbachia, 131 individual DNA samples were tested. All of them produced a positive reaction with primers LepF1: LepR1 demonstrating thus suitability of the samples for PCR amplification. None of these samples produced a specific signal with Wolbachia-specific primers that could be confirmed by sequencing. At the same time, a sample of genomic DNA of a
Wolbachia-infected corn borer, used as a positive control, gave a signal of the expected size in all the experiments performed. Thus we consider the negative result of Wolbachia detection in bollworm samples as reliable.
PCR screening for microsporidia revealed one positive signal for the sample from Krasnoarmeysk District of Krasnodar Area, obtained in 2019. Prevalence level in this sample equaled to 5.2 % (N=19), and for the whole dataset of 168 individuals - to 0.6 %. Sequencing the SSU rRNA gene fragment showed 100 % identity to the microsporidium N. bombycis from the silkworm B. mori, as well as to numerous unidentified isolates from lepidopterans belonging to different families (Table 6). The rpbl sequence, deposited in GenBank
Kononchuk A.G. et al. /Plant Protection News, 2022, 105(1), p. 50-61 Table 2. Size of analyzed samples from local populations of the cotton bollworm
Sampling site
Year
Stage
Number of analyzed samples* (N) baculoviruses microsporidia Wolbachia
Krasnodar Area, Temryuk District
Krasnodar Area, Slavyansk District
Krasnodar Area, Gulkevichi District Krasnodar Area, Krasnoarmeysk District Voronezh Region, Ramon District Saratov Region, Engels District
TOTAL
2018 2018 2020 2019 2019
2019
2020
larvae larvae larvae adults (from traps) larvae larvae larvae
32(5) 30 9
30 12 29 28 170(5)
32 30
30
19(1) 29 28 168(1)
32
30 12 29 28 131(0)
* in brackets is the number of verified positive samples (if any).
Таблица 2. Объем проанализированных выборок локальных популяций хлопковой совки
Место сбора
Год сбора
Стадия развития
Объем выборки* при анализе на бакуловирусы микроспоридий вольбахию
Краснодарский край, Темрюкский район
Краснодарский край, Славянский район
Краснодарский край, Гулькевичский район Краснодарский край, Красноармейский район Воронежская область, Рамонский район Саратовская область, Энгельский район
ИТОГО
2018 2018 2020 2019 2019
2019
2020
Гусеницы Гусеницы Гусеницы Имаго (из ловушек) Гусеницы Гусеницы Гусеницы
32(5) 30 9
30 12 29 28 170(5)
32 30
30
19(1) 29 28 168(1)
32
30 12 29 28 131(0)
* в скобках указано количество верифицированных положительных проб (при наличии).
Table 3. Polymorphism of the nucleotide sequences of the lef8 gene fragment of the Helicoverpa armigera nucleopolyhedrovirus isolates obtained in the present study from Krasnodar Area (TEMRYUK21.. .32) and standard strain HS-18 (VECTOR), as well as those accessible through GenBank (annotated with accession number and host species)
Таблица 3. Полиморфизм нуклеотидных последовательностей фрагмента гена lef8 вируса ядерного полиэдроза хлопковой совки, полученных в настоящей работе для изолятов из Краснодарского края (TEMRYUK21.. .32) и эталонного штамма ХС-18 (VECTOR), а также доступных в GenBank (указан номер доступа и вид насекомого-хозяина)
GenBank Accession # or strain name
Host species
Nucleotide position as in reference sequence KJ004000* Положение нуклеотида относительно референсного сиквенса KJ004000*
Номер доступа в GenBank или название изолята Вид хозяина 32305 32308 32387 32389 32419 32488 32509 32524 32602
KJ004000 (HS-18) Helicoverpa zea С G T A G T G C G
VECTOR (HS-18 in this study) Helicoverpa armigera C G T A G T G C G
TEMRYUK21 Helicoverpa armigera C A T G G T G C G
TEMRYUK24 Helicoverpa armigera C A T G G T G C G
TEMRYUK32 Helicoverpa armigera C A T G G T G C G
KU738904 Helicoverpa C G T A G T G C G
KM596835 Helicoverpa zea C G T A G T G C G
KJ922128 Helicoverpa armigera C G T A G T G C G
KM357512 Helicoverpa armigera C G T G G T G C G
AY118080 Helicoverpa armigera C G T G G T A C G
KT013224 Helicoverpa armigera C G T G A T G C G
KJ701031 Helicoverpa armigera C G T G G T G C G
MK507817 Helicoverpa armigera T G T G G T G T A
MG569706 Helicoverpa assulta C G A G G C A T G
MT810812 Helicoverpa armigera C G A G G C A C G
MH254887 Hyblaea puera C G T G A T G C G
*The unique polymorphic position of the newly found baculovirus variants is highlighted with gray background.
*Уникальная полиморфная позиция вновь найденных вариантов бакуловируса отмечена серым фоном.
Table 4. The nucleotide sequences of the leß gene of isolates of the Helicoverpa armigera nuclear polyhedrosis virus available
in GenBank, used for comparative analysis in this work
Species, isolate Host Country GenBank Accession # Start position End position Identity level, %
Helicoverpa armigera nucleopolyhedrovirus Helicoverpa armigera Spain KJ701031 32242 32630 99.23
Helicoverpa SNPV AC53 Helicoverpa sp. Australia KU738904 32173 32561 98.97
Helicoverpa armigera nucleopolyhedrovirus Helicoverpa armigera India KT013224 14454 14842 98.97
Helicoverpa zea single nucleopolyhedrovirus Helicoverpa armigera Brazil KM596835 31027 31415 98.97
Helicoverpa zea single nucleopolyhedrovirus Helicoverpa zea Uzbekistan* KJ004000 32226 32614 98.97
Helicoverpa armigera nucleopolyhedrovirus Helicoverpa armigera India KM357512 1895 2283 99.23
Helicoverpa armigera SNPV Helicoverpa armigera Australia KJ922128 32207 32595 98.97
Helicoverpa armigera nucleopolyhedrovirus Helicoverpa armigera South Africa AY118080 460 848 98.97
Helicoverpa armigera nucleopolyhedrovirus Heliothis peltigera Turkey MK507817 32100 32488 98.46
Helicoverpa armigera nucleopolyhedrovirus Helicoverpa armigera China MT810812 32536 32924 98.46
Helicoverpa assulta nucleopolyhedrovirus Helicoverpa assulta China MG569706 32470 32858 98.20
Hyblaea puera nucleopolyhedrovirus Hyblaea puera India MH254887 29 341 98.72
* according to Kolosov A.V., personal communication.
Таблица 4. Доступные в GenBank нуклеотидные последовательности гена lef8 изолятов вируса ядерного полиэдроза Helicoverpa armigera, использованные для сравнительного анализа в настоящей работе
Вид, изолят Хозяин Страна Номер доступа в GenBank Начальная позиция Конечная позиция Уровень сходства, %
Helicoverpa armigera nucleopolyhedrovirus Helicoverpa armigera Испания KJ701031 32242 32630 99.23
Helicoverpa SNPV AC53 Helicoverpa sp. Австралия KU738904 32173 32561 98.97
Helicoverpa armigera nucleopolyhedrovirus Helicoverpa armigera Индия KT013224 14454 14842 98.97
Helicoverpa zea single nucleopolyhedrovirus Helicoverpa armigera Бразилия KM596835 31027 31415 98.97
Helicoverpa zea single nucleopolyhedrovirus Helicoverpa zea Узбекистан* KJ004000 32226 32614 98.97
Helicoverpa armigera nucleopolyhedrovirus Helicoverpa armigera Индия KM357512 1895 2283 99.23
Helicoverpa armigera SNPV Helicoverpa armigera Австралия KJ922128 32207 32595 98.97
Helicoverpa armigera nucleopolyhedrovirus Helicoverpa armigera Южная Африка AY118080 460 848 98.97
Helicoverpa armigera nucleopolyhedrovirus Heliothis peltigera Турция MK507817 32100 32488 98.46
Helicoverpa armigera nucleopolyhedrovirus Helicoverpa armigera Китай MT810812 32536 32924 98.46
Helicoverpa assulta nucleopolyhedrovirus Helicoverpa assulta Китай MG569706 32470 32858 98.20
Hyblaea puera nucleopolyhedrovirus Hyblaea puera Индия MH254887 29 341 98.72
* Согласно Колосову А.В., личное сообщение.
under the number ON099402, showed similarity with homologous N. bombycis sequences at the level of 96-99 %, while similarity to other closely related species was 93 % for N. disstriae (# HQ457438), 92 % for N. fumiferanae (# HQ457435) and 91 % for N. pyrausta (# MG182018). Spores
isolated from the infected cotton bollworm larva measured 3.2-4.5(mean 3.9) x 2.0-2.7(mean 2.4) ^m (n=12) and N. bombycis spores from silkworm - 3.8-4.4(mean 4.0) x 2.2-2.8(mean 2.4) ^m (n=11).
Discussion
Baculoviruses and microsporidia are widely distributed in nature, and their detection in populations of the cotton bollworm is quite expected. In addition, since bacteria of the genus of Wolbachia are also widespread among Lepidoptera, it was expected to detect their presence in the studied samples of H. armigera. Yet, no Wolbachia was found. This can be due to the low frequency of this endosymbiont, as well as due to its uneven spatial and temporal distribution in local populations of the pest. In particular, though no published data in scientific literature were found concerning Wolbachia in the cotton bollworm, presence of respective GenBank entries indirectly indicate occasional detection of this endosymbiont in this host in India (# KY781914) and China (## EU399644 and EU753172).
Since the species diversity of baculoviruses in cotton bollworms over the vast territory of Russia had been practically unexplored at the beginning of the work, diagnostics was
aimed at detecting baculovirus infections using degenerate primers, because of high evolutionary lability of viral genomes (Herniou et al., 2004). The virus isolates were found in only one geographic location, and the sequences of all of them were identical to each other and showed the maximum similarity to the HearNPV and HzNPV entries available in GenBank, with only minor genetic differences. Unfortunately, sequencing of the lef8 locus had insufficient resolution to differentiate these species and, accordingly, to accurately diagnose the new isolates. This goal should therefore recruit analysis of other, more polymorphic loci (protein kinase, DNA polymerase, DNA helicase, chitinase, zinc finger protein, etc.) or whole genome sequencing. In addition, it is possible that the two indicated above species of the virus should rather be considered as intraspecific isolates, since they cross-infect American cotton bollworms and the cotton bollworms, the closely related insect species. In addition, levels of genetic
Table 5. Results of BLAST analysis of the complete genome of the HS-18 strain against the Helicoverpa zea nucleopolyhedrovirus (gray background) and Helicoverpa armigera nucleopolyedrovirus sequenœs. Таблица 5. Результаты BLAST-анализа полного генома штамма ХС-18 относительно сиквенсов Helicoverpa zea nucleopolyhedrovirus (серый фон) и Helicoverpa armigera nucleopolyhedrovirus.
Species, strain GenBank Accession # Identity level, %
Вид, изолят Номер доступа в GenBank Уровень сходства, %
Helicoverpa zea single nucleopolyhedrovirus KJ004000 100.00
Helicoverpa zea single nucleopolyhedrovirus AF334030 99.97
Helicoverpa SNPV AC53 KM596835 99.96
Helicoverpa armigera SNPV KJ909666 99.55
Helicoverpa SNPV AC53 KJ922128 99.54
Helicoverpa SNPV AC53 KU738896 99.23
Helicoverpa SNPV AC53 KU738904 99.20
Helicoverpa SNPV AC53 KU738901 99.20
Helicoverpa SNPV AC53 KU738899 99.20
Helicoverpa SNPV AC53 KU738902 99.20
Helicoverpa SNPV AC53 KU738900 99.20
Helicoverpa SNPV AC53 KU738897 99.20
Helicoverpa SNPV AC53 KU738898 99.19
Helicoverpa armigera NPV NNg1 KU738903 99.13
Helicoverpa armigera nucleopolyhedrovirus AP010907 99.00
Helicoverpa armigera nucleopolyhedrovirus KJ701029 98.84
Helicoverpa armigera nucleopolyhedrovirus KJ701033 99.20
Helicoverpa armigera nucleopolyhedrovirus KJ701032 99.11
Helicoverpa armigera nucleopolyhedrovirus KJ701030 99.01
Helicoverpa armigera NPV strain Australia KJ701031 99.00
Helicoverpa armigera nucleopolyhedrovirus G4 JN584482 98.90
Helicoverpa armigera nucleopolyhedrovirus AF271059 98.78
Helicoverpa zea single nucleopolyhedrovirus AF303045 98.44
Table 6. GenBank entries of microsporidia isolates showing 100 % identity of small subunit ribosomal RNA sequence to the microsporidium from Helicoverpa armigera identified in the present study Таблица 6. Записи в GenBank для изолятов микроспоридий, демонстрирующие 100 % идентичность последовательности малой субъединицы рибосомной РНК с микроспоридией из Helicoverpa armigera,
выявленной в настоящем исследовании
Species, isolate Host species Country GenBank Accession #
Вид, изолят Вид хозяина Страна Номер доступа в GenBank
Nosema bombycis Bombyx mori Japan AB125665
Nosema bombycis Antheraea mylitta India AB036052
Nosema bombycis Bombyx mori Japan AY259631
Nosema bombycis Bombyx mori No data EU864525
Nosema bombycis (Nosema heliothidis) Helicoverpa armigera China FJ772435
Nosema bombycis (Nosema spodopterae) Spodoptera litura Taiwan AY747307
Nosema bombycis GD 1 Bombyx mori China JF443582
Nosema bombycis GNB3 Bombyx mori China MT510128
Nosema bombycis GX 1 Bombyx mori China JF443577
Nosema bombycis Sd-NU-IW8401 Spodoptera depravata Japan D85504
Nosema bombycis SES-NU Bombyx mori Japan D85503
Nosema sp. C01 Pieris rapae South Korea AY383655
Nosema sp. CmM1 Cnaphalocrocis medinalis China KC836091
Nosema sp. CP JX-2014 Catopsilia pyranthe China KM001609
Nosema sp. Hyblaea puera 1 Hyblaea puera India GQ244502
Nosema sp. AA1 Antheraea assamensis India MG584870
Nosema sp. OSL-2014-3 Spodoptera litura Japan LC422302
Nosema sp. PM-1 Papilio machaon Linnaeus China KM190863
Nosema sp. PX1 Plutella xylostellae Taiwan AY960986
Nosema sp. 'S. litura' Spodoptera litura Taiwan AF238239
Nosema sp. TWSL-2014-1 Spodoptera litura Taiwan LC422303
Nosema sp. VSl-2007-13 Spodoptera litura Viet Nam AB569602
Nosema sp. YGSL-2015-2 Spodoptera litura Japan LC422315
Nosema sp. YY-2018a Athetis lepigone China MF150255
divergence between viral isolates are extremely low, even when comparing among genome-wide sequences, (Kolosov et al., 2017). Detection of viruses with the same lef8 haplotype in the phylogenetically distant species of H. puera, registered in GenBank, is interesting. However, the host identification requires additional verification, since infection of distantly related host species does not correspond to modern ideas about the species specificity of baculoviruses (Thiem, 1997; Song et al., 2016).
As for microsporidia, the range of their potential hosts is much wider. In particular, N. bombycis was isolated from various Lepidoptera, including representatives of the Noctuidae family (Iwano and Ishihara, 1991; Tokarev et al., 2020). The rpbl sequence of the new isolate was identical to the GenBank entry for N. bombycis, and its morphometric characteristics coincided with those of N. bombycis, which allows us to consider the microsporidia from the cotton bollworm as an isolate of this species. This corresponds to the wide range of hosts of this microsporidium confirmed by molecular genetic analysis of the natural N. bombycis infections in different species of Lepidoptera (Tokarev et al., 2020).
Interpreting low levels of occurrence of microsporidia and baculoviruses in local populations of the cotton bollworm, one should take into account the fact that the analyzed samples were collected over a limited period of time, during the pest outbreak in 2018-2020. An increase in prevalence of microsporidia and viruses corresponding to the growth of population density beneficial to horizontal transmission, has been recorded for various Lepidoptera species including L. dispar (Solter et al., 2010), Choristoneura pinus (van Frankenhuyzen et al., 2011), Tortrix viridana (Lipa, Madziara-Borusiewicz, 1976), Taragama siva (Ahmed, Kumar, 1998), S. exempta (Odindo, 1983). It could be presumed that in the case of the cotton bollworm, pathogens' prevalence levels do not increase during the outbreaks. This can be explained by high motility of larvae that helps to avoid overcrowding and cannibalism. Interestingly, cannibalism was repeatedly reported under laboratory conditions but never observed in the field (Dhandapani et al., 1993; Kakimoto et al., 2003; Zalucki et al., 2021). We hope that further studies will clarify the interactions between the prevalence of infections with endosymbionts and dynamics of Helicoverpa armigera population density.
Acknowledgments
Authors are thankful to Aleksey V. Kolosov (State Research Center of Virology and Biotechnology «Vector», Novosibirsk Region, Russia) for HS-18 strain sample, Inna V. Grushevaya (All-Russian Institute of Plant Protection, St. Petersburg, Russia) for Wolbachia and Nosema DNA samples, and Igor V. Senderskiy (All-Russian Institute of Plant Protection, St. Petersburg, Russia) for N. bombycis spores, as well as to Yuliya S. Sokolova (George Washington University, Washington, US) for English correction of the manuscript. The research was supported by Russian Science Foundation, project # 20-66-46009. The research was performed using the equipment of the Core Centrum "Genomic Technologies, Proteomics and Cell Biology" at the All-Russian Institute of Agricultural Microbiology and the Core Centrum "Innovative plant protection technologies" at the All-Russian Institute of Plant Protection (St. Petersburg, Russia).
References
Agasieva IS, Nefedova MV, Fedorenko EV, Mkrtchyan AO (2019) Compatibility of entomophages with biological and biorational plant protection products. Agricultural Biology 54(1):101-109. https://doi.org/10.15389/ agrobiology. 2019.1.101rus (In Russian) Ahmed SI, Kumar S (1998) Role of natural epizootics of a NPV disease in controlling Prosopis juliflora defoliator Taragama siva outbreak in North-West Rajasthan. Indian forester 124(11):952-958 Ahmed MZ, Araujo-Jnr EV, Welch JJ, Kawahara AY (2015) Wolbachia in butterflies and moths: geographic structure in infection frequency. Front Zool 12 (1):1—16. https://doi. org/10.1186/s12983-015-0107-z Ahmed S, Zia K, Shah NR (2004) Validation of chemical control of gram pod borer, Helicoverpa armigera (Hub.) with new insecticides. Int J Agric Biol 6(6):978-980 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) «Basic local alignment search tool.» J Mol Biol 215:403-410 Arai H, Hirano T, Akizuki N, Abe A et al (2019) Multiple infection and reproductive manipulations of Wolbachia in Homona magnanima (Lepidoptera: Tortricidae). Microbial Ecol 77(1):257-266. https://doi.org/10.1007/ s00248-018-1210-4 Ardisson-Araújo DM, Sosa-Gómez DR, Melo FL, Báo SN, Ribeiro BM (2015) Characterization of Helicoverpa zea single nucleopolyhedrovirus isolated in Brazil during the first old world bolworm (Noctuidae: Helicoverpa armigera)
nationwide outbreak. Embrapa Soja-Artigo em periódico indexado (ALICE). https://doi.org/10.17525/vrrjournal. v20il.254
Armes NJ, Jadhav DR, De Souza KR (1996) A survey of insecticide resistance in Helicoverpa armigera in the Indian sub-continent. Bull EntomolRes 86:499-514 Arnemann JA, James WJ, Walsh TK, Guedes JVC, Smagghe G, Castiglioni E, Tay WT (2016) Mitochondrial DNA COI characterization of Helicoverpa armigera (Lepidoptera: Noctuidae) from Paraguay and Uruguay. Genet Mol Res 15(2):15028292. https://doi.org/10.4238/gmr.15028292 Arrizubieta M, Williams T, Caballero P, Simón O (2014) Selection of a nucleopolyhedrovirus isolate from Helicoverpa armigera as the basis for a biological insecticide. Pest Manag Sci 70(6):967-976 Baillie VL, Bouwer G (2012) High levels of genetic variation within Helicoverpa armigera nucleopolyhedrovirus populations in individual host insects. Arch Virol 157(12):2281-2289 Becnel JJ, Andreadis TG (2014) Microsporidia in Insects. In: Weiss LM, Becnel JJ (eds) Microsporidia: Pathogens of Opportunity, First Edition. Wiley: New York. 521-570. https://doi.org/10.1002/9781118395264.ch21 Bhat SA, Bashir I, Kamili AS (2009) Microsporidiosis of silkworm, Bombyx mori L. (Lepidoptera - Bombycidae): A review. Afr J Agric Res 4(13):1519-1523. https://doi. org/10.5897/AJAR.9000490
Binod P, Sukumaran RK, Shirke SV, Rajput JC, Pandey A (2007) Evaluation of fungal culture filtrate containing chitinase as a biocontrol agent against Helicoverpa armigera. J Appl Microbiol 103(5):1845-1852. https://doi. org/10.1111/j.1365-2672.2007.03428.x Bouchon D, Rigaud T, Juchault P (1998) Evidence for widespread Wolbachia infection in isopod crustaceans: molecular identification and host feminization. Proc R Soc Lond B 265(1401):1081-1090. https://doi.org/10.1098/ rspb.1998.0402
Bykov RA, Yurlova GV, Demenkova MA, Dubatolov VV et al (2020) High Wolbachia prevalence in populations of Siberian silk moth Dendrolimus superans sibiricus Tschetverikov, 1908 (Lepidoptera: Lasiocampidae) in the territory of Russia. Zhurnal obshchey biologii 81(5):387-393. (In Russian). https://doi.org/10.31857/S0044459620050036 Bykov R, Yurlova G, Demenkova M, Ilinsky Y (2021) Is Aporia crataegi unsuitable host of Wolbachia symbionts? Plant Protection News 104(1):53-60. https://doi. org/10.31993/2308-6459-2021-104-1-14945 Charlat S, Engelstädter J, Dyson EA, Hornett EA et al (2006) Competing selfish genetic elements in the butterfly Hypolimnas bolina. Current Biology 16(24):2453-2458. https://doi.org/10.1016/j.cub.2006.10.062 Charlat S, Hornett EA, Fullard JH, Davies NR et al (2007) Extraordinary flux in sex ratio. Science 317(5835):214-214. https://doi.org/10.1126/science.1143369 Chen X, Sun X, Hu Z, Li M, O'Reilly DR, Zuidema D, Vlak JM (2000) Genetic engineering of Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus as an improved pesticide. J Invertebr Pathol 76(2):140-146. https://doi. org/10.1006/jipa.2000.4963 Cherry AJ, Rabindra RJ, Parnell MA, Geetha N, Kennedy JS, Grzywacz D (2000) Field evaluation of Helicoverpa armigera nucleopolyhedrovirus formulations for control of the chickpea pod-borer, H. armigera (Hubn.), on chickpea (Cicer arietinum var. Shoba) in southern India. Crop Protection 19(1):51-60. https://doi.org/10.1016/ S0261-2194(99)00089-7 Chenkin AF, Cherkasova VA, Zakharenko VA, Goncharov NR (1990) Handbook of an agronomist on plant protection. Moscow: Agropromizdat 367p. (In Russian) Cunningham JP, Zalucki MP (2014) Understanding Heliothine (Lepidoptera: Heliothinae) pests: what is a host plant? J Econ Entomol 107:881-896. https://dx.doi.org/10.1603/ EC14036 Czepak C, Albernaz C, Vivan LM, Guimaraes HO, Carvalhais T (2013) First reported occurrence of Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) in Brazil. Pesq Agropec Trop 43:110-113 Dhandapani N, Jayaraj S, Rabindra RJ (1993) Cannibalism on nuclear polyhedrosis virus infected larvae by Heliothis armigera (Hubn.) and its effect on viral infection. Insect Sci Appl 14:427-430 Dyson EA, Hurst GDD (2004) Persistence of an extreme sex-ratio bias in a natural population. Proc Natl Acad Sci USA 101(17):6520-6523. https://doi.org/10.1073/ pnas.0304068101 Erlandson MA (2009) Genetic variation in field populations of baculoviruses: Mechanisms for generating variation and its potential role in baculovirus epizootiology. Virol Sin 24:458. https://doi.org/10.1007/s12250-009-3052-1
Eroglu GB, Demir I, Demirbag Z (2018) A novel alphabaculovirus isolated from the cotton bollworm, Helicoverpa armigera (Hubner) (Lepidoptera: Noctuidae): characterization and pathogenicity. Biologia 73:545-551. https://doi.org/10.2478/s11756-018-0053-2 Eroglu GB, Nalgacioglu R, Demirbag Z (2019) A new Helicoverpa armigera Nucleopolyhedrovirus isolate from Heliothis peltigera (Denis & Schiffermuller) (Lepidoptera: Noctuidae) in Turkey. Turk J Biol 43(5):340-348. https://doi. org/10.3906/biy-1902-64 Farrow RA, Daly JC (1987) Long-range movements as an adaptive strategy in the genus Heliothis (Lepidoptera, Noctuidae): a review of its occurrence and detection in four pest species. Aust JZool 35:1-24 Fitt GP (1989) The ecology of Heliothis species in relation to
agroecosystems. Annu Rev Entomol 34:17-52 Frolov AN, Malysh YM, Tokarev YS (2008) Biological features and population density forecasts of the beet webworm Loxostege sticticalis L. (Lepidoptera, Pyraustidae) in the period of low population density of the pest in Krasnodar Territory. Entomol Rev 88:666-675 (in Russian) Fuxa JR (1982) Prevalence of viral infections in populations of fall armyworm, Spodoptera frugiperda, in Southeastern Louisiana. Environ Entomol 11(1):239-242. https://doi. org/10.1093/ee/11.1.239 Fuxa JR, Richter AR (1999) Classical biological control in an ephemeral crop habitat with Anticarsia gemmatalis nucleopolyhedrovirus. BioControl 44:405-421. https://doi. org/10.1023/A:1009990709230 Gaugler RR, Brooks WM (1975) Sublethal effects of infection by Nosema heliothidis in the corn earworm, Heliothis zea. J Invertebr Pathol 26(1):57-63 Gomes ES, Santos V, Ávila CJ (2017) Biology and fertility life table of Helicoverpa armigera (Lepidoptera: Noctuidae) in different hosts. Entomol Sci 20(1):419-426. https://doi. org/10.1111/ens.12267 Graham RI, Wilson K (2012) Male-killing Wolbachia and mitochondrial selective sweep in a migratory African insect. BMC Evol Biol 12(1):204. https://doi. org/10.1186/1471-2148-12-204 Grushevaya IV, Ignatieva AN, Malysh SM, Senderskiy IV, Zubarev IV, Kononchuk AG (2018) Spore dimorphism in Nosema pyrausta (Microsporidia, Nosematidae): from morphological evidence to molecular genetic verification. Acta Protozool 57:49-52. https://doi.org/10.4467/16890027 AP. 18.004.8398 Haile F, Nowatzki T, Storer N (2021) Overview of pest status, potential risk, and management considerations of Helicoverpa armigera (Lepidoptera: Noctuidae) for U.S. Soybean Production. J Integr Pest Manag 12(1):1-10. https://doi.org/10.1093/jipm/pmaa030 Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/ NT. NuclAcids Symp 41:95-98 Harper JD (1987) Applied epizootiology: Microbial control of insects. In: Fuxa JR, Tanada Y (eds) Epizootiology of Insect Diseases. Wiley, Sons: New York. 473-496 Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc Natl Acad Sci USA 101:14812-14817. https://doi.org/10.1073/pnas.0406166101
Herniou EA, Olszewski JA, O'Reilly DR, Cory JS (2004) Ancient coevolution of baculoviruses and their insect hosts. J Virol 78(7):3244-3251. https://doi.org/10.1128/ JVI.78.7.3244-3251.2004 Hilgenboecker K, Hammerstein P, Schlattmann P, Telschow A et al (2008) How many species are infected with Wolbachia? - a statistical analysis of current data. FEMS Microbiol Lett 281(2):215-220. https://doi. org/10.nn/j.1574-6968.2008.0ni0.x Hiroki M, Tagami Y, Miura K, Kato Y (2004) Multiple infection with Wolbachia inducing different reproductive manipulations in the butterfly Eurema hecabe. Proc Roy Soc B: Biol Scie 271(1549):1751-1755. https://doi.org/10.1098/ rspb.2004.2769
Hopper JV, Huang WF, Solter LF, Mills NJ (2016) Pathogenicity, morphology, and characterization of a Nosema fumiferanae isolate (Microsporidia: Nosematidae) from the light brown apple moth, Epiphyas postvittana (Lepidoptera: Tortricidae) in California. J Invertebr Pathol 134:38-47. https://doi. org/10.1016/j.jip.2016.01.001. Ilinsky Y, Kosterin OE (2017) Molecular diversity of Wolbachia in Lepidoptera: prevalent allelic content and high recombination of MLST genes. Mol Phylogen Evol 109:164179. https://doi.org/10.1016/j.ympev.2016.12.034 Ilinsky YY, Tokarev YS, Bykov RA, Yudina MA, Pavlushin SV, Inoue MN, Martemyanov VV (2017) Detection of bacterial symbionts (Wolbachia, Spiroplasma) and eukaryotic pathogen (Microsporidia) in Japanese populations of gypsy moth species (Lymantria spp.). Euroasian Entomol J 16(1):1-5
Issi IV (1986) Microsporidia as a phylum of parasitic protozoa. In: Microsporidia. Ser. Protozoologiya. Leningrad: Nauka 10:6-135. (In Russian) Issi IV (2020) Development of Microsporidiology in Russia. Plant Protection News 103:161-176 (In Russian). https:// doi.org/10.31993/2308-6459-2020-103-3-4972 Issi IV, Nilova GN (1967) Microsporidia parasitizing the turnip moth and the cotton bollworm under conditions of Tadjikistan. Izvestia Akademii Nauk Tadzhikskoy SSR 26:65-70 Iwano H, Ishihara R (1991) Isolation of Nosema bombycis from moths of the lawn grass cutworm, Spodoptera depravata Butler. JSeric Sci Jpn 60:279-287 Jones CM, Parry H, Tay WT, Reynolds DR, Chapman JW (2018) Movement ecology of pest Helicoverpa: Implications for ongoing spread. Ann Rev Entomol 64(1):277-295. https:// doi.org/10.1146/annurev-ento-011118-111959 Kakimoto K, Hinomoto N, Noda T (2003) Responses of three Orius species collected in Kagoshima to different rearing temper-atures and photoperiods. Jpn J App. Entomol Zool 47:19-28. https://doi.org/10.1303/JJAEZ.2003.19 Kermani N, Abu-Hassan Zainal-Abidin, Dieng H, Ismail NF, Attia M, Abd Ghani I (2013) Pathogenicity of Nosema sp. (Microsporidia) in the Diamondback Moth, Plutella xylostella (Lepidoptera: Plutellidae). PLoS One 8:e62884. https://doi.org/10.1371/journal.pone.0062884 Kolosov AV, Ternovoy VA, Shvalov AN, Moiseeva AA, Safatov AS, Mikheev VN (2017) Adaptation of the single-capsid nuclear polyhedrosis virus of the American cotton scoop (Helicoverpa zea SNPV) to control the population of the cotton scoop (Helicoverpa armigera). Voprosy virusologii 62(3):134-137. https://doi.org/10.18821/0507-4088-2017-62-3-134-137 (In Russian)
Knox OGG, Anderson CMT, Ross JL, Tann CCR, Gupta VVSR (2016). Organisms with potential to assist in the control of Helicoverpa armigera in Australian cotton production systems. Crop Pasture Sci 67(12):1288. https:// doi.org/10.1071/cp16270 Lee MJ, Anstee JH (1992) An ultrastructural study on stages in the life cycle of a microsporidian parasite (Microspora: Nosematidae) in Helicoverpa armigera (Lepidoptera: Noctuidae). J Invertebr Pathol 59(3):271-279 Leslie Hayes J, Bell M (1994) Evaluation of early-season baculovirus treatment for suppression of Heliothis virescens and Helicoverpa zea (Lepidoptera: Noctuidae) over a wide area. JEcon Entomol 87(1):58-66 Lipa J, Madziara-Borusiewicz K (1976) Microsporidians parasitizing the green tortrix (Tortrix viridana L.) in Poland and their role in the collapse of the tortrix outbreak in Puszcza Niepolomicka during 1970-1974. Acta Protozool 15:529-536
Malysh JM, Chertkova EA, Tokarev YS (2021) The microsporidium Nosema pyrausta as a potent microbial control agent of the beet webworm Loxostege sticticalis. J Invertebr Pathol 186:107675 Malysh JM, Kononchuk AG, Frolov AN (2019) Detection of microsporidia infecting beet webworm Loxostege sticticalis (Pyraloidea: Crambidae) in European part of Russia in 2006-2008. Plant Protection News 2:45-51. https://doi. org/10.31993/2308-6459-2019-2(100)-45-51 Malysh J, Malysh S, Kireeva D, Kononchuk A, Demenkova M (2020) Detection of Wolbachia in larvae of Loxostege sticticalis (Pyraloidea: Crambidae) in European and Asian parts of Russia. Plant Protection News 103(1):49-52. https:// doi.org/10.31993/2308-6459-2020-103-1-49-52 Malysh YuM, Tokarev YuS, Sitnikova NV, Kononchuk AG, Grushetskaya TA, Frolov AN (2011) Incidence of microsporidian infection of stem borers of the genus Ostrin-ia (Lepidoptera: Crambidae) in Krasnodar territory. Parazi-tologiya 45(3):234-244 (In Russian) McManus ML, Solter F (2003) Microsporidian Pathogens in European gypsy moth populations. In: McManus ML, Liebhold AM (eds) Proceedings: ecology, survey and management of forest insects. Newtown Square: USDA. pp. 44-51
Mitchell MJ, Cali A (1994) Vairimorpha necatrix (Microsporida: Burenellidae) affects growth and development of Heliothis zea (Lepidoptera: Noctuidae) raised at various temperatures. J Econ Entomol 87(4):933-940 Mohan M, Sushil SN, Bhatt JC, Gujar GT, Gupta HS (2008) Synergistic interaction between sublethal doses of Bacillus thuringiensis and Campoletis chlorideae in managing Helicoverpa armigera. BioControl 53:375-386. https://doi. org/10.1007/s10526-007-9079-z Moscardi F (1999) Assessment of the application of baculoviruses for control of Lepidoptera. Ann Rev Entomol 44(1):257-289
Murua MG, Scalora FS, Navarro FR, Cazado LE, Casmuz A et all (2014) First record of Helicoverpa armigera (Lpidoptera: Noctuidae) in Argentina. The Florida Entomologist 97(2):854-856. https://doi.org/10.1653/024.097.0279 Narita S, Kageyama D, Nomura M, Fukatsu T (2007) Unexpected mechanism of symbiont-induced reversal of insect sex: feminizing Wolbachia continuously acts on the butterfly Eurema hecabe during larval development.
Appl Environ Microbiol 73(13):4332-4341. https://doi. org/10.1128/AEM.00145-07 Odindo MO (1983) Epizootiological observations on a nuclear polyhedrosis of the African armyworm Spodoptera exempta (Walk.;. Internat J Trop Insect Sci 4(3)291-298 Patil NS, Jadhav JP (2015) Significance of Penicillium ochrochloron chitinase as a biocontrol agent against pest Helicoverpa armigera. Chemosphere 128:231-235. https:// doi.org/10.1016/j.chemosphere.2015.01.038 Pei B, Wang C, Yu B, Xia D, Li T, Zhou Z (2021) The first report on the transovarial transmission of microsporidian Nosema bombycis in lepidopteran crop pests Spodoptera litura and Helicoverpa armigera. Microorganisms 9(7):1442 Pilarska D, Takov D, Hylis M, Radek R, Fiala I, Solter L, Linde (2017) Natural occurrence of microsporidia infecting Lepidoptera in Bulgaria. Acta Parasitol 62(4):858-869. https://doi.org/10.1515/ap-2017-0104 Rabindra RJ, Jayaraj S (1994) Effect of certain botanicals on the incidence of Vairimorpha sp. in Helicoverpa armigera larvae. J Biol Control 8(1):61-63 Riaz S, Johnson JB, Ahmad M, Fitt GP, Naiker M. (2021) A review on biological interactions and management of the cotton bollworm, Helicoverpa armigera (Lepidoptera: Noctuidae). J Appl Entomol 145(6):467-498. https://doi. org/10.1111/jen.12880 Salunke BK, Salunkhe RC, Dhotre DP, Walujkar SA et al (2012) Determination of Wolbachia diversity in butterflies from Western Ghats, India, by a multigene approach. Appl Environ Microbiol 78(12):4458-4467. https://doi. org/10.1128/AEM.07298-11 Salunkhe RC, Narkhede KP, Shouche YS (2014) Distribution and evolutionary impact of Wolbachia on butterfly hosts. Indian J Microbiol 54(3):249-254. https://doi.org/10.1007/ s12088-014-0448-x Sambrook J, Fritsch E, Maniatis T (1989) Molecular cloning: a laboratory manual. New York: Cold Spring Harbor laboratory.
Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci 74(12):5463-5467 Shapiro M, Farrar RRJr, Domek J, Javaid I (2002) Effects of virus concentration and ultraviolet irradiation on the activity of corn earworm and beet armyworm (Lepidoptera: Noctuidae) nucleopolyhedroviruses. J Econ Entomol 95(2):243-249. https://doi.org/10.1603/0022-0493-95.2.243 Simoes RA, Feliciano JR, Solter LF, Delalibera IJr (2015) Impacts of Nosema sp. (Microsporidia: Nosematidae) on the sugarcane borer, Diatraea saccharalis (Lepidoptera: Crambidae). J Invertebr Pathol 129:7-12. https://doi. org/10.1016/j.jip.2015.05.006 Singh SP, Ballal CR, Poorani J (2002) Old world bollworm Helicoverpa armigera, associated Heliothinae and their natural enemies. Project Directorate Biol Control Tech Bull 31:135
Song J, Wang X, Hou D, Huang H, Liu X, Deng F et al (2016) The host specificities of baculovirus per os infectivity factors. PLoS One 11(7):e0159862. https://doi.org/10.1371/ journal.pone.0159862 Solovyev VI, Ilinsky Y, Kosterin OE (2015) Genetic integrity of four species of Leptidea (Pieridae, Lepidoptera) as sampled in sympatry in West Siberia. Comparative cytogenetics 9(3):299. https://doi.org/10.3897/CompCytogen.v9i3.4636
Solter LF, Maddox JV, McManus ML (1997) Host specificity of microsporidia (Protista: Microspora) from European populations of Lymantria dispar (Lepidoptera: Lymantriidae) to indigenous North American Lepidoptera. J Invertebr Pathol 69:135-150 Solter LF, Pilarska D K, McManus ML, Zubrik M, Patocka J, Huang WF, Novotny J (2010) Host specificity of microsporidia pathogenic to the gypsy moth, Lymantria dispar (L.): Field studies in Slovakia. J Invertebr Pathol 105(1):1-10. https://doi.org/10.10167j.jip.2010.04.009 Suryanarayanan TS, Govinda Rajulu MB, Vidal S (2016) Biological control through fungal endophytes: Gaps in knowledge hindering success. Curr Biotechnol 5(3):185-198 https://doi.org/10.2174/2211550105666160504130322 Tagami Y, Miura K (2004) Distribution and prevalence of Wolbachia in Japanese populations of Lepidoptera. Insect Mol Biol 13(4):359-364. https://doi. org/10.1111/j.0962-1075.2004.00492.x Tay WT, Soria MF, Walsh T, Thomazoni D, Silvie P, Behere GT, Anderson C, Downes S (2013) A brave new world for an old world pest: Helicoverpa armigera (Lepidoptera: Noctuidae) in Brazil. PLoS One 8(11):e80134. https://doi.org/10.1371/ journal.pone.0080134 Thiem SM (1997) Prospects for altering host range for baculovirus bioinsecticides. Curr Opin Biotechnol 8(3):317-322
Tokarev YS, Huang WF, Solter LF, Malysh JM, Becnel JJ, Vossbrinck CR (2020) A formal redefinition of the genera Nosema and Vairimorpha (Microsporidia: Nosematidae) and reassignment of species based on molecular phylogenetics. J Invertebr Pathol 169:107279. https://doi.org/10.1016/j. jip.2019.107279 Tokarev YS, Timofeev SA, Malysh JM, Tsarev AA, Ignatieva AN, Tomilova OG, Dolgikh VV (2019) Hexokinase as a versatile molecular genetic marker for Microsporidia. Parasitology 146:472-478. https://doi.org/10.1017/ S0031182018001737 Tokarev YS, Yudina MA, Malysh JM, Bykov RA et al (2017) Prevalence rates of Wolbachia endosymbiotic bacterium in natural populations of Ostrinia nubilalis and Ostrinia scapulalis (Lepidoptera: Pyraloidea: Crambidae) in SouthWestern Russia. Ecological genetics 15(1):44-49. https:// doi.org/10.17816/ecogen15144-49 Tagami Y, Miura K (2004) Distribution and prevalence of Wolbachia in Japanese populations of Lepidoptera. Insect Mol Biol 13:359-364. https://doi. org/10.1111/j.0962-1075.2004.00492.x Van Frankenhuyzen K, Ryall K, Liu Y, Meating J, Bolan P, Scarr T (2011) Prevalence of Nosema sp. (Microsporidia: Nosematidae) during an outbreak of the jack pine budworm in Ontario. J Invertebr Pathol 108(3):201-208 Van Frankenhuyzen K, Nystrom C, Liu Y (2007) Vertical transmission of Nosema fumiferanae (Microsporidia: Nosematidae) and consequences for distribution, postdiapause emergence and dispersal of second-instar larvae of the spruce budworm, Choristoneura fumiferana (Clem.) (Lepidoptera: Tortricidae). J Invertebr Pathol 96(2):173-182. https://doi.org/10.1016/jjip.2007.03.017 Van Regenmortel MHV, Fauquet CM, Bishop DHL, Carstens EB, Estes MK, Lemon SM, et al. (2000) Virus taxonomy, classification and nomenclature of viruses Seventh Report
of the International Committee on Taxonomy of Viruses. Oxford: Academic Press Vogelstein B, Gillespie D (1979) Preparative and analytical purification of DNA from agarose. Proc Natl Acad Sci 76:615-619
Weiss LM, Vossbrinck CR (1999) Molecular biology, molecular phylogeny, and molecular diagnostic approaches to the Microsporidia. The microsporidia and microsporidiosis. Washington: ASM Press. pp. 129-171 Werren JH, Baldo L, Clark ME (2008) Wolbachia: master manipulators of invertebrate biology. Nature Rev Microbiol 6(10):741-751. https://doi.org/10.1038/nrmicro1969 Williams T, Lopez-Ferber M, Caballero P (2022) Nucleopolyhedrovirus coocclusion technology: a new concept in the development of biological insecticides. Front Microbiol 25(12):810026. https://doi.org/10.3389/ fmicb.2021.810026 Wittner M (1999) Historic perspective on the microsporidia: expanding horizons. In: Wittner M, Weiss LM (eds) The microsporidia and microsporidiosis. Washington: ASM Press. pp. 1-6
Wu KM, Lu YH, Feng HQ, Jiang YY, Zhao JZ (2008) Suppression of cotton bollworm in multiple crops in China in areas with Bt toxin-containing cotton. Science 321: 1676-1678
Yang Y, Li Y, Wu Y (2013) Current status of insecticide resistance in Helicoverpa armigera after 15 years of Bt
cotton planting in China. J Econ Entomol 106(1):375-381, https://doi.org/10.1603/EC12286 Yu H, Meng J, Xu J, Liu TX, Wang D (2015) A novel neurotoxin gene ar1b recombination enhances the efficiency of Helicoverpa armigera nucleopolyhedrovirus as a pesticide by inhibiting the host larvae ability to feed and grow. PLoS One 10(8):e0135279. https://doi.org/10.1371/journal. pone.0135279
Yu FL, Wu G, Liu TJ, Zhai BP, Chen FJ (2008) Effects of irrigation on the performance of cotton bollworm, Helicoverpa armigera (Hubner) during different pupal stages. Internat J Pest Management 54:137-142 Zalucki JM, Heckel DG, Wang P, Kuwar S et al (2021) A generalist feeding on Brassicaceae: It does not get any better with selection. Plants 10(5):954. https://doi.org/10.3390/ plants10050954 Zelinskaya LM (1980) Role of microsporidia in the abundance dynamics of the gypsy moth, Porthetria dispar, in forest plantings along the lower Dnieper river (Ukranian Republic, USSR). Vestn Zool 1:57-62 Zhou W, Rousset F, O'Neil S (1998) Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc Biol Sci 265(1395):509-515 Zug R, Hammerstein P (2012) Still a Host of Hosts for Wolbachia: analysis of recent data suggests that 40 % of terrestrial arthropod species are infected. PLoS One 7(6):e38544. https://doi.org/10.1371/journal.pone.0038544
Вестник защиты растений, 2022, 105(1), с. 50-61
OECD+WoS: 1.06+IY (Entomology) https://doi.org/10.31993/2308-6459-2022-105-1-15260
Полнотекстовая статья
МОЛЕКУЛЯРНАЯ ДИАГНОСТИКА ЭНДОСИМБИОНТОВ В ПОПУЛЯЦИЯХ ХЛОПКОВОЙ СОВКИ HELICOVERPA ARMIGERA (LEPIDOPTERA: NOCTUIDAE)
В ЕВРОПЕЙСКОЙ ЧАСТИ РОССИИ А.Г. Конончук*, С.М. Малыш, А.С. Румянцева, Д.С. Киреева, А.В. Герус, В.С. Журавлёв
Всероссийский научно-исследовательский институт защиты растений, Санкт-Петербург
* ответственный за переписку, e-mail: akononchuk@vizr.spb.ru
Хлопковая совка Helicoverpa armigera - один из самых многоядных и космополитичных видов фитофагов. Внутриклеточные эндосимбионты широко распространены в популяциях чешуекрылых насекомых и часто имеют важное значение в их динамике численности. Данные о распространении энтомопатогенов у хлопковой совки на территории России в современных условиях практически отсутствуют. Гусеницы и имаго хлопковой совки были собраны в 2018-2020 гг. в Краснодарском крае, Воронежской и Саратовской областях и проанализированы методом ПЦР с использованием наборов группо-специфичных праймеров на бакуловирусы (локус lef8), бактерий рода Wolbachia (локус wsp) и микроспоридий (локус SSU rRNA) в количестве от 131 до 170 особей для разных групп патогенов. Положительная реакция на бакуловирусы отмечалась на уровне 16 % для выборки из 32 особей Темрюкского района Краснодарского края 2018 г. Общая зараженность для всей выборки из 170 особей составила 2.9 %. Обнаружено сходство нуклеотидной последовательности lef8 на уровне 98.7-99.6 % с изолятами вирусов ядерного полиэдроза хлопковой совки и американской хлопковой совки. Результаты тестирования выборки из 131 особей на присутствие бактерий рода Wolbachia были отрицательными. При ПЦР-скрининге на микроспоридий получен один положительный сигнал для выборки из 19 особей Красноармейского района Краснодарского края 2019 г., что соответствует 5 %. Для всей выборки из 168 проанализированных особей зараженность составила 0.6 %. Нуклеотидные последовательности фрагментов генов, кодирующих SSU рРНК и большую субъединицу РНК-полимеразы II, позволило идентифицировать новый изолят как N. bombycis.
Ответственный за переписку, e-mail: akononchuk@vizr.spb.ru
Ключевые слова: облигатные внутриклеточные паразиты, энтомопатогенные микроорганизмы, вредные чешуекрылые, естественная зараженность, вирус ядерного полиэдроза, Microsporidia, Wolbachia, Nosema bombycis
Поступила в редакцию: 10.02.2022
Принята к печати: 07.04.2022
