CC BY
0
MICRORNA MIR-152 METHYLATION IN PATIENTS WITH OVARIAN CANCER: PROGNOSTIC POTENTIAL ANALYSIS
Yu.Yu. Fedoroval, A.V. Sagitova1, E.T. Mingazheva1, R.R. Faishanova3,4 I.R. Zagitov4, E.A. Andreeva1, A.Kh. Nurgalieva1, E.K. Khusnutdinova12, M. Darvish5, D.S. Prokofyeva1
1 Federal State Educational Institution of Higher Education «Ufa University of Science and Technology», 32 Zaki Validi St., Ufa, 450076, Russia;
2 Institute of Biochemistry and Genetics, Ufa Federal Research Center of the Russian Academy of Sciences, 71 Prospect Oktyabrya, Ufa, 450054, Russia;
3 Federal State Budgetary Educational Institution of Higher Education «Bashkir State Medical University» of the Ministry of Health of the Russian Federation, 3 Lenina St., Ufa, 450008, Russia;
4 Ministry of Health of the Republic of Bashkortostan State Autonomous Institution of Health «Republican Clinical Oncological Dispensary», 73/1 Prospect Oktyabrya, Ufa, 450054, Russia;
5 Arak University of Medical Sciences, Arak, Basij Square 3JPR+5FC, Iran.
* Corresponding author: dager-glaid@yandex.ru
Abstract. MicroRNAs play a crucial role in the regulation of biological processes variety associated with neoplasm development and progression, such as cell proliferation and differentiation, apoptosis, angiogenesis, inflammation, migration, invasion and metastasis, epithelial-mesenchymal transition and others. The purpose of this work was to investigate the DNA methylation level of miR-152 in 25 paired tissue samples from patients with an established diagnosis of ovarian cancer and various histological and clinical characteristics by the MS-HRM method. Our results indicate a higher frequency of the miR-152 methylation in ovarian tumor tissues (51.5% ± 5.4) compared to normal tissues (43.9% ± 7.2), however, the differences did not reach the statistical level significance, p = 0.5. There was no relationship between the metastatic process in the tumor depending on the level of methylation (46.5% ± 11.9 in patients with metastases vs 45.2% ± 7.8 in cases without metastases). One patient with the highest methylation level of all samples researched - 89.91%, despite a good response to primary therapy, had a relapse of the disease after 7 years. In addition, there is a tendency for a lower level of miR-152 methylation in patients with a complete response to therapy, in contrast to women with a partial response or the tumor process stabilization. Thus, our research provides evidence in favor of the suppressor function of the miR-152 in tumor, and its possible role in sensitivity to polychemotherapy, however, the results did not reach a statistical level of significance and additional studies on larger material are required.
Keywords: ovarian cancer, microRNA, methylation, miR-152, metastasis.
List of Abbreviations
OC - ovarian cancer DNA - deoxyribonucleic acid PCR - polymerase chain reaction MS-HRM - Methylation-Sensitive High Resolution Melting
Introduction
Ovarian cancer (OC) is one of the most common malignant neoplasms of the female reproductive system and currently represents a pressing health problem. According to the latest statistics, in 2022, 324,603 new ovarian cancer cases were registered worldwide and 206,956 women died due to this cancer pathology (Singh et al, 2023). The high mortality rate from ovarian cancer is primarily explained by
the fact that for a long time, it occurs without obvious symptoms and, as a rule, is diagnosed at late stages of development (III-IV), as well as the lack of effective screening methods (Menon et al, 2021).
A number of genes and signaling pathways, as well as epigenetic regulatory mechanisms, which include microRNAs, are involved in ovarian cancer pathogenesis and metastasis. MicroRNAs play a crucial role in the regulation of biological processes variety associated with the development and progression of neoplasms, such as cell proliferation and differentiation, apoptosis, angiogenesis, inflammation, migration, invasion and metastasis, epithelial-mesen-chymal transition (EMT), etc. Depending on which gene expression is suppressed by mi-
croRNAs, it's can function as tumor suppressors or oncogenes (Braga et al, 2017). There are many researchers on the role of microRNAs and their target genes in the ovarian cancer pathogenesis and progression (Nguyen et al, 2020; Salem et al, 2018; Loginov et al, 2018). It has been established that microRNA genes can be suppressed by hypermethylation of the CpG island promoter regions. Moreover, the percentage of genes whose regulation is disrupted by aberrant methylation is significantly higher among microRNA genes than among protein-coding genes (Piletic & Kunej, 2016). However, data on microRNA gene methylation in OC are limited to single experimental researches (Kushlinskii et al., 2020; Pernar Ko-vac et al, 2023).
Based on the above, the purpose of this work was to investigate the DNA methylation level of miR-152 in 25 paired tissue samples from patients with an established diagnosis of ovarian cancer and various histological and clinical characteristics.
Materials and Methods
For methylation analysis, we used DNA obtained from paired paraffin blocks from 25 patients with an ovarian cancer established diagnosis. The cases' clinical and histological characteristics are presented in Table 1.
Samples of epithelial ovarian cancer were collected and morphologically characterized at the Republican Clinical Oncology Dispensary, Ufa. This study received permission from the ethics committee of the Institute of Biochemistry and Genetics of the Ufa Federal Research Center of the Russian Academy of Sciences. Informed consent was obtained from all research participants. All ovarian tumors were classified according to the TNM classification of the International Union Against Cancer and histologically verified based on the World Health Organization (WHO) criteria (Kurman & Shih, 2016). To select samples with a high content of tumor cells (at least 70-80%), an additional histological analysis of microsections (3-5 p,m) stained with hematoxylin-eosin was performed.
DNA extraction from individual sections from blocks containing formalin-fixed, paraffin-
embedded (FFPE) tissue fragments was carried out using the ExtractDNA FFPE kit (Evrogen, Russia). All DNA samples (500 ng) analyzed in this work were subjected to bisulfite conversion. Bisulfite conversion was performed using the EZ DNA Methylation-Gold Kit (Zymo Research, USA), according to the manufacturer's instructions. The methylation level was assessed using the MS-HRM (Methylation-Sensitive High Resolution Melting) method using a LightCycler® 96 Roche device (Roche, Germany). Primers for analyzing the methylation status of miR-152 were selected using the Methyl Primer Express Software v1.0 program (Applied Biosystems, USA). Primer sequences: miR-152 F: 5' TTCGGGTTTAAGTTTTGTTATG 3' and R: 5' ATAACGCAAATCCAACCC 3', PCR product length - 136 bp, primer annealing temperature - 60°C.
MS-HRM was carried out using a PCR mixture containing MeltDoctor HRM Dye, Melt-Doctor HRM Master mix (Applied Biosystems, USA). Bisulfite-converted 100% methylated and 0% unmethylated DNA samples (Zymo Research, USA) were used to generate melting curves of standard controls (Hussmann & Hansen, 2018). Methylated and unmethylated DNA control standards (100%/0%) were mixed as a percentage, resulting in the methylation level of the control samples being 0%, 5%, 25%, 50%, 75% and 100%, respectively. Methylated standards were used to generate a methylation standard curve and quantify the methylation status of samples. All reactions were performed in duplicate. The MS-HRM results were confirmed by sequencing bisulfite-converted DNA on an ABI PRISM 3500 instrument (Applied Biosystems, USA).
Statistical analysis was performed using SPSS v.23 (SPSS Inc.). The standard curve that was used to determine the methylation status of unknown samples was generated using regression analysis. The normality of the distribution of quantitative characteristics was checked. The comparison of quantitative characteristics was carried out using the Mann-Whitney test. Differences were accepted as statistically significant at p < 0.05.
Table 1
Clinical and histologically characteristics of ovarian cancer patients (N = 25)
Parameters Patients
epithelial %
adenocarcinoma 32
cystadenocarcinoma 32
serous adenocarcinoma 12
malignant Brenner tumor 4
Histology mucinous adenocarcinoma 4
serous cystadenocarcinoma 4
endometrioid adenocarcinoma 4
endometrioid cystadenocarcinoma 4
non-epithelial
granulosa cell tumor of the ovary 4
I 32
Stage II 8
III 60
IV -
G1 -
G2 24
Grade G3 20
G4 12
Gx 44
Nodal status No 82
Yes 18
Metastasis No 64
Yes 36
Age, years 55.7 (39-80)
Menopause status premenopause 23
postmenopause 77
Bilateral No 54
Yes 46
Pathomorphosis Complete Response - CR 25
Partial Response - PR 25
Stable Disease - SD 50
Progressive Disease - PD -
Recurrence < 3 months -
3-6 months -
7-12 months -
1-3 years 12,5
3-5 years 12,5
> 5 years 12,5
Alive No 33
Yes 67
Results during bisulfite modification, all unmethylated
Quantitative assessment of methylation cytosine is converted to uracil, which leads to a based on HRM analysis is based on the fact that decrease in the content of GC nucleotides and
is reflected in a decrease in the melting temperature of the samples (Tm). We plotted the differential fluorescence levels (RFU) of methylated standards using the 0% control as the baseline. Using regression analysis, a standard curve was constructed, which was used to determine the methylation status of unknown samples when studying the methylation level of the miR-152 (Fig. 1).
The profiles of normalized curves and melting peaks of MS-HRM analysis for the miRNA - miR-152 in OC patients are shown in Figure 2 (a, b). The differential fluorescence values at the maximum peak temperature of the HRM curves were used in the regression formula derived from the diluted methylated standards and the percentage of methylation among the unknown samples was calculated. The average methylation level in tumor samples was 51.5% ± 5.4, which was higher than in normal tissue samples - 43.9% ± 7.2, but the differences did not reach the level of statistical significance (p = 0.5) (Fig. 2c). The level of methylation was confirmed by sequencing of bisulfite-converted DNA. Figure 2 (d, e) shows the results of sequencing patient samples with a methylation level of 5.89% of the miR-152 in normal tissue and 50.61% in tumor tissue.
When comparing the methylation level between patients with metastases (46.5% ± 11.9) and those without metastases (45.2% ± 7.8), no significant differences were found between the compared groups (p = 0.9).
Discussion
Ovarian cancer is the deadliest among all gynecological malignancies and its 5-year survival rate does not exceed 45% (Chan et al, 2008). The most common histological type of ovarian cancer is epithelial tumors, which account for 85% of all cases of the disease (Mein-hold-Heerlein et al., 2016). Traditionally, epithelial ovarian cancer is treated by surgical debulking of the original tumor followed by a combination of platinum and taxane treatments-primarily carboplatin and paclitaxel. Platinum therapy promotes the appearance of DNA strand breaks, which trigger miss-match repair (MMR) and apoptosis signaling pathways (Dijt
et al, 1988). Taxanes bind ß-tubulin, preventing microtubule depolymerization, which in turn promotes to cell cycle arrest and apoptosis (Abal et al, 2003). Although 70% of patients with ovarian cancer initially respond to chemotherapy, subsequent chemoresistance and disease relapse remain a serious problem and account for 90% of eventual deaths (Agarwal & Kaye, 2003).
Determining the methylation status of CpG island of genes in malignant neoplasms is an important step for understanding the function of a gene in the oncogenesis (Braga et al., 2020) and the development of tumor chemoresistance, in particular.
In this work, we analyzed the aberrant methylation level of miR-152, associated with carcinogenesis, in 25 paired (tumor/normal) OC samples. This microRNA is a member of the miR-148/152 family, members of which act as tumor suppressors and their activity is reduced in various types of cancer, including ovarian cancer (Chen et al., 2016; Lopes et al., 2021). It has been established that some of miR-152 oncogenic targets are MET, TGFa, FGF2, CD151 and MMP3 genes, acting on which miR-152 leads to inhibition of cell proliferation and tumor metastasis (Liu et al, 2016).
The increased level of methylation detected in tumor tissues found in our study may also indicate the tumor suppressor properties of this microRNA. These results obtained on clinical samples are consistent with the data of functional studies by other authors, which also indicate the suppressor properties of miR-152. Thus, in a study conducted by Lian-Wei et al., it was found that the miR-152 suppresses the proliferation, migration and invasion of ovarian cancer cells and promotes apoptosis through inhibition of the ERBB3 protein in vitro (Li et al., 2018). Recent work by Wu et al. (2023) also showed that the miR-152 suppresses the proliferation, migration and infiltration of cervical cancer cells and reduces their resistance to cis-platin chemotherapy by inhibiting protein expression in the ERBB3/Akt/c-myc and ERBB3/Akt pathways/Snail (Wu et al, 2023). A study by Liu et al. (2019) showed that miR-152 has an inhibitory effect on the growth
0.360
100%
75%
50% _ 25% 0% .. 5%
r.pssL ;
a
71,00 72,00 73.00 74,00 Temperature
75.00
77.00
r^^N^r _______100%
50%
25% 0%
5%
0.05
70.00
71.00
72,00 73,00 Temperature
74.00
75,00
76.00
77,00
-0.2-1
100
Methylation, %
150
Fig. 1. Melting curves of miR-152. a - graph of differential fluorescence level (RFU) values of melting curves of methylated standards with 0% standard used as a baseline; b - normalized melting curves of methylated standards; c - regression plot of differential fluorescence depending on the methylation level of standards (%)
69.00 70.00 71.00 72.00 73.00 74.00 75.00 76.00 77.00 Temperature
d e
eo 70
Fig. 2. MS-HRM analysis of miR-152 in patients with ovarian cancer (normal and tumor). a - Melting curves of MS-HRM analysis converted to difference plot with 0% control standard used as a baseline. b - Normalized melting curves of miR-152 in patients with ovarian cancer (normal and tumor). c - Relative level of methylation of miR-152 in patients with ovarian cancer (tumor, normal). d, e - Results of sequencing the region of miR-152 in a sample of normal tissue from a patient with ovarian cancer (d) and in a sample of tumor tissue (e)
of xenografts in mice obtained by subcutaneous injection of the human ovarian cancer cell line SKOV3 (Liu et al, 2019).
The main mechanism of miR-152 suppression is hypermethylation of the promoter region (Liu et al., 2016). A high degree of meth-ylation of the CpG island of miR-152 is found in mixed lineage leukemia (MLL), rearranged acute lymphoblastic leukemia, endometrial and gastrointestinal cancer (Chen et al., 2013). It was also observed that the expression level of miR-152 was significantly reduced in cis-platin-resistant epithelial ovarian cancer cell lines A2780/DPP and SKOV3/DPP. DNA me-thyltransferase 1 (DNMT1), the main enzyme that maintains DNA methylation patterns, is one of miR-152 targets (Xiang et al., 2014). Reduced expression of this miRNA leads to overexpression of DNMT1, promoting DNA methylation, which can lead to the suppression of genes involved in chemotherapy sensitivity (Yan et al., 2016). Thus, Khajehnoori et al. (2020) in their work demonstrated an increase in the levels of miR-152 and miR-148 and a decrease in the level of DNMT1 protein after treatment with both 5-azacytidine (5-aza) and trichostatin A (TSA) in cisplatin-resistant OC cell lines A2780. The authors of the study hypothesized that increased expression of miR-152 and miR-148 under the influence of 5-Aza and TSA may reverse cisplatin resistance by suppressing the DNMT1 protein in ovarian cancer, and a decrease in the expression level of these microRNAs may be associated with
DNA methylation and histone deacetylation (Khajehnoori et al., 2020).
Our results indicate a higher frequency of miR-152 methylation in ovarian tumor tissues (51.5% ± 5.4) compared to normal tissues (43.9% ± 7.2), however, the differences did not reach the statistical level significance, p = 0.5. There was no relationship between the meta-static process in the tumor depending on the level of methylation (46.5% ± 11.9 in patients with metastases vs 45.2% ± 7.8 in women without metastases). One patient with the highest methylation level of 89.91% of all samples studied, despite a good response to primary therapy, had a relapse of the disease after 7 years. In addition, there is a tendency for a lower level of miR-152 methylation in patients with a complete response to therapy, in contrast to women with a partial response or stabilization of the tumor process.
In general, our study provides evidence in favor of the suppressor function of the miR-152 in tumor formation, and its possible role in sensitivity to polychemotherapy, however, the results did not reach a statistical level of significance and additional studies on larger material are required.
Acknowledgments
This research work was funded by grant from the Russian Science Foundation, agreement No. 23-24-00452 dated January 13, 2023.
The authors declare no conflict of interest.
References
ABAL M., ANDREU J.M. & BARASOAIN I. (2003): Taxanes: microtubule and centrosome targets, and cell cycle dependent mechanisms of action. Curr Cancer Drug Targets 3(3), 193-203.
AGARWAL R. & KAYE S.B. (2003): Ovarian cancer: strategies for overcoming resistance to chemotherapy. Nat Rev Cancer 3(7), 502-16. "
BRAGA E.A., FRIDMAN M.V. & KUSHLINSKII N.E. (2017): Molecular Mechanisms of Ovarian Carcinoma Metastasis: Key Genes and Regulatory MicroRNAs. Biochemistry (Mosc) 82(5), 529-541.
BRAGA E.A., LOGINOV V.I., PRONINA I.V., ET AL. (2020): MicroRNA gene methylation: new markers for the diagnosis and prognosis of ovarian cancer metastasis. Oncogynecology 1(33), 4-15. (In Russ.)
CHAN J.K., TEOH D., HU J.M., SHIN J.Y., OSANN K. & KAPP D.S. (2008): Do clear cell ovarian carcinomas have poorer prognosis compared to other epithelial cell types? A study of 1411 clear cell ovarian cancers. Gynecol Oncol. 109(3), 370-6.
CHEN H., LIU H., ZOU H., CHEN R., DOU Y., SHENG S., DAI S., AI J., MELSON J., KITTLES R.A., PIROOZNIA M., LIPTAY M.J., BORGIA J.A. & DENG Y. (2016): Evaluation of Plasma miR-21 and miR-152 as Diagnostic Biomarkers for Common Types of Human Cancers. J Cancer 7(5), 490-97.
CHEN Y., SONG Y.X. & WANG Z.N. (2013): The microRNA-148/152 family: multi-faceted players. Mol
Cancer 12, 1-8.
DIJT F.J., FICHTINGER-SCHEPMAN A.M., BERENDS F. & REEDIJK J. (1988): Formation and repair of cisplatin-induced adducts to DNA in cultured normal and repair-deficient human fibroblasts. Cancer Res. 48(21), 6058-62.
HUSSMANN D. & HANSEN L.L. (2018): Methylation-Sensitive High Resolution Melting (MS-HRM). Methods Mol Biol. 1708, 551-571.
KHAJEHNOORI S., ZAREI F., MAZAHERI M. & DEHGHANI-FIROOZABADI A. (2020): Epidrug Modulated Expression of MiR--152 and MiR-148a Reverse Cisplatin Resistance in Ovarian Cancer Cells: An Experimental In-vitro Study. Iran J Pharm Res. 19(3), 509-519.
KURMAN R.J. & SHIH IE.M. (2016): Seromucinous Tumors of the Ovary. What's in a Name? Int J Gynecol Pathol. 35(1):78-81.
KUSHLINSKII N.E., UTKIN D.O., LOGINOV V.I., FILIPPOVA E.A. BURDENNYY A.M., KUSH-LINSKII D.N., PRONINA I.V. & BRAGA E.A. (2020): Clinical significance of methylation of a group of microRNA genes in patients with ovarian cancer. Klinicheskaya Laboratornaya Diagnostika 65(5), 321-327. (In Russ.)
LI L.W., XIAO HQ., MA R., YANG M., LI W. & LOU G. (2018): miR-152 is involved in the proliferation and metastasis of ovarian cancer through repression of ERBB3. Int J Mol Med. 41(3), 1529-1535.
LIU W., ZHANG L., WANG J., WANG X. & SUN H. (2019): Analysis of the inhibitory effects of miR-124 and miR-152 on human epithelial ovarian cancer xenografts in a nude mouse model. Oncol Lett. 17(1), 348-354.
LIU X., LI J., QIN F. & DAI S. (2016): miR-152 as a tumor suppressor microRNA: Target recognition and regulation in cancer. Oncol Lett. 11(6), 3911-3916.
LOGINOV V.I., PRONINA I.V., BURDENNYY A.M., FILIPPOVA E.A., KAZUBSKAYA TP., KUSH-LINSKY D.N., UTKIN D.O., KHODYREV D.S., KUSHLINSKII NE., DMITRIEV A.A. & BRAGA E.A. (2018): Novel miRNA genes deregulated by aberrant methylation in ovarian carcinoma are involved in metastasis. Gene 662, 28-36.
LOPES B.C., BRAGA C.Z., VENTURA F.V., DE OLIVEIRA JG., KATO-JUNIOR EM., BORDIN-JUNIOR N.A. & ZUCCARI DAPC. (2021): miR-210 and miR-152 as Biomarkers by Liquid Biopsy in Invasive Ductal Carcinoma. J Pers Med. 11(1), 31.
MEINHOLD-HEERLEIN I., FOTOPOULOU C., HARTER P., KURZEDER C., MUSTEA A., WIM-BERGER P., HAUPTMANN S. & SEHOULI J. (2016): The new WHO classification of ovarian, fallopian tube, and primary peritoneal cancer and its clinical implications. Arch Gynecol Obstet. 293(6), 695-700.
MENON U., GENTRY-MAHARAJ A., BURNELL M., SINGH N, RYAN A., KARPINSKYJ C., CAR-LINO G., TAYLOR J., MASSINGHAM S.K., RAIKOU M., KALSI J.K., WOOLAS R., MANCHANDA R., ARORA R., CASEY L., DAWNAY A., DOBBS S., LEESON S., MOULD T., SEIF M.W., SHARMA A., WILLIAMSON K., LIU Y., FALLOWFIELD L., MCGUIRE A.J., CAMPBELL S., SKATES S.J., JACOBS I.J. & PARMAR M. (2021): Ovarian cancer population screening and mortality after long-term follow-up in the UK Collaborative Trial of Ovarian Cancer Screening (UKCTOCS): a randomised controlled trial. Lancet 397(10290), 2182-2193.
NGUYEN V.H.L., YUE C., DU K.Y., SALEM M., O'BRIEN J. & PENG C. (2020): The Role of microRNAs in Epithelial Ovarian Cancer Metastasis. Int J Mol Sci. 21(19):7093.
PERNAR KOVAC M., TADIC V., KRALJ J., MILKOVIC PERISA M., ORESKOVIC S., BABIC I., BA-NOVIC V., ZHANG W., CULIG Z. & BROZOVIC A. (2023): MiRNA-mRNA integrative analysis reveals epigenetically regulated and prognostic miR-103a with a role in migration and invasion of car-boplatin-resistant ovarian cancer cells that acquired mesenchymal-like phenotype. Biomed Pharma-cother 166, 115349.
PILETIC K. & KUNEJ T. (2016): MicroRNA epigenetic signatures in human disease. Arch Toxicol 90(10), 2405-19.
SALEM M., O'BRIEN JA., BERNAUDO S., SHAWER H., YE G., BRKIC J., AMLEH A., VANDERHY-DEN B.C., REFKY B., YANG B.B., KRYLOV S.N. & PENG C. (2018): miR-590-3p Promotes Ovarian Cancer Growth and Metastasis via a Novel FOXA2-Versican Pathway. Cancer Res. 78, 4175-4190.
SINGH D., VIGNAT J., LORENZONI V., ESLAHI M., GINSBURG O., LAUBY-SECRETAN B., ARBYN M., BASU P., BRAY F. & VACCARELLA S. (2023): Global estimates of incidence and mortality of cervical cancer in 2020: a baseline analysis of the WHO Global Cervical Cancer Elimination Initiative. Lancet Glob Health. 11(2), e197-e206.
WU J., CHI X., YANG Q. & LI J. (2023): Expression of miR-152 in cervical cancer and its influence on cisplatin resistance. Afr Health Sci. 23(2), 246-255.
XIANG Y., MA N., WANG D., ZHANG Y., ZHOU J., WU G., ZHAO R., HUANG H., WANG X., QIAO Y., LI F., HAN D., WANG L., ZHANG G. & GAO X. (2014): MiR-152 and miR-185 co-contribute to ovarian cancer cells cisplatin sensitivity by targeting DNMT1 directly: a novel epigenetic therapy independent of decitabine. Oncogene 33(3), 378-86.
YAN B., YIN F., WANG Q.I., ZHANG W. & LI L.I. (2016): Integration and bioinformatics analysis of DNA-methylated genes associated with drug resistance in ovarian cancer. Oncol Lett. 12(1), 157-166.
